KR102207348B1 - Composition for detecting Hepatitis A virus comprising multiplex primer set, kit for diagnosing Hepatitis A and method for obtaining Hepatitis A virus whole genome sequence - Google Patents

Abstract

The present invention relates to a composition for detecting a hepatitis A virus comprising a multiple complex primer set, a kit for diagnosing hepatitis A, and a method for obtaining the full-length genome sequence of the hepatitis A virus. When the multiple complex primer set is used, a very small amount of Since the virus genome can be amplified to determine whether a virus is infected and the concentration of the genome sequence can be increased, it can be effectively used for detection of a virus, diagnosis of infection, and acquisition of the full-length virus genome.

Description

Composition for detecting Hepatitis A virus comprising multiplex primer set, kit for diagnosing Hepatitis A and method (Composition for detecting Hepatitis A virus comprising multiplex primer set, kit for diagnosing Hepatitis A and method) for obtaining Hepatitis A virus whole genome sequence}

The present invention relates to a composition for detecting hepatitis A virus comprising multiple complex primer sets, a kit for diagnosing hepatitis A, and a method for obtaining the full-length genome sequence of the hepatitis A virus, and more specifically, A from a sample of a hepatitis A patient. The present invention relates to a method of detecting hepatitis A virus to diagnose hepatitis A, and obtaining a full-length genome sequence through a next-generation sequencing method by detecting even a very small amount of genome sequence using multiple complex primer sets.

The technology for determining the sequence of genes constituting living organisms is divided into the first generation Sanger method and the next generation sequencing method, NGS (Next Generation Sequencing).

The first-generation method, called Sanger sequencing, developed around 1977, is a chain-stop in which ddNTPs (di-deoxynucleotidetriphosphates) stop the synthesis of DNA strands during the polymerase chain reaction (PCR) process This is a method of confirming the base sequence by collecting the amplified DNA fragments by applying the (chain-termination) principle. Although this method has high accuracy, it has a problem that it takes a long time to determine the base sequence, and a high cost occurs.

In order to overcome this problem, a next-generation nucleotide sequence analysis method has been developed. After segmenting and amplifying the genetic information of numerous genomes, big data is obtained, and then whole genome sequences (WGS) of the desired organism are obtained using bioinformatics.

As low-cost, high-speed, and large-capacity analysis technology was required from the human genome analysis project started in the 1990s, the history of NGS began with the development of next-generation sequencing equipment in 2006 and 2007, respectively, by Roche and Illumina. . By using micro or nano technology to shorten the sample length and enable parallel sequencing, it paved the way for simultaneous analysis of millions of multiple samples at low cost.

Although there are slight differences depending on the model, the above devices basically perform amplification of the DNA sequence and then take a fluorescent marker with a camera and perform image processing to read the base. Depending on the PCR amplification method, Roche (454) and Life Technologies models are emulsion PCR (emPCR) methods, whereas Illumina models use solid-phase amplification. It can be divided into what is used.

NGS is widely used in human WGS, exome-seq, RNA research (RNA-seq), and epi-genomics research. Genomic analysis based on NGS is a study involving 46% of humans, and can be ranked in the order of animals (25%), plants (12%), and microorganisms (2%). In particular, the virus field is only an early stage in using NGS. In the case of microorganisms, there are many sequences with relatively well-conserved genes, but in the case of viruses, each virus has different sequences and gene mutations occur very well, so progress has been slow in viral research using NGS. .

Currently, test methods to check whether hepatitis A virus infection is present include anti-hepatitis A virus immunoglobulin M antibody test (IgM anti-HAV), RT-PCR, and real-time PCR. Anti-hepatitis A virus IgM antibody can be positive in test results from the beginning of symptoms to 6 months after recovery of hepatitis. It is an antibody test used only to confirm acute hepatitis A infection. RT-PCR or real-time PCR methods are fast and have high sensitivity, but have a limitation in reacting only with virus-specific primers, so contamination occurs between samples. As described above, there is a disadvantage that the full-length genome sequence of the hepatitis A virus cannot be effectively obtained with the conventional infection test method.

NGS has the advantage that it can improve the effectiveness of the diagnosis of hepatitis A virus infection by supplementing the disadvantages of each method and adding the advantages of the NGS experiment, and can shorten the time rather than obtaining the entire sequence by the RT-PCR test method.

In addition, it is known that it is very difficult to directly identify the viral genome sequence from a sample of an infected patient because the viral genome is in an extremely fine dose. In order to overcome these shortcomings, there is a need for a method to quickly and directly obtain the nucleotide sequence information of the hepatitis A virus genome at a very fine dose from infected patients using molecular enrichment.

Therefore, the present inventors confirmed that it is useful to obtain the full-length genome sequence of hepatitis A virus by detecting a very small amount of genome as a result of performing multiplex PCR using a multi-complex primer set, and using a next-generation sequencing method. I did.

Accordingly, an object of the present invention is to provide a composition for detecting Hepatitis A virus comprising 52 primers consisting of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 1 to 52.

Another object of the present invention is to provide a kit for diagnosing hepatitis A including 52 primers consisting of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 1 to 52.

Another object of the present invention is to provide a method of obtaining full-length genome sequences of hepatitis A virus.

The present invention relates to a composition for detecting a hepatitis A virus including a multiple complex primer set, a kit for diagnosing hepatitis A, and a method for obtaining the full-length genome sequence of the hepatitis A virus. When using the multiple complex primer set according to the present invention Even a small amount of genome sequence can be detected and the full-length genome sequence can be obtained through Next Generation Sequencing (NGS).

The present inventors detected the genomic sequence of the hepatitis A virus from a sample of a hepatitis A patient using multiple complex primer sets, and confirmed that it can be applied to the NGS system by constructing a library through this.

Hereinafter, the present invention will be described in more detail.

One aspect of the present invention is a composition for detecting Hepatitis A virus comprising 52 primers consisting of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 1 to 52.

In one embodiment of the present invention, the detection composition includes a primer consisting of a nucleotide sequence of SEQ ID NO: 1, a primer consisting of a nucleotide sequence of SEQ ID NO: 2, a primer consisting of a nucleotide sequence of SEQ ID NO: 3, and a nucleotide sequence of SEQ ID NO: 4 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 5, a primer consisting of a nucleotide sequence of SEQ ID NO: 6, a primer consisting of a nucleotide sequence of SEQ ID NO: 7, a primer consisting of a nucleotide sequence of SEQ ID NO: 8, a nucleotide sequence of SEQ ID NO: 9 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 10, a primer consisting of a nucleotide sequence of SEQ ID NO: 11, a primer consisting of a nucleotide sequence of SEQ ID NO: 12, a primer consisting of a nucleotide sequence of SEQ ID NO: 13, a nucleotide sequence of SEQ ID NO: 14 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 15, a primer consisting of a nucleotide sequence of SEQ ID NO: 16, a primer consisting of a nucleotide sequence of SEQ ID NO: 17, a primer consisting of a nucleotide sequence of SEQ ID NO: 18, a nucleotide sequence of SEQ ID NO: 19 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 20, a primer consisting of a nucleotide sequence of SEQ ID NO: 21, a primer consisting of a nucleotide sequence of SEQ ID NO: 22, a primer consisting of a nucleotide sequence of SEQ ID NO: 23, a nucleotide sequence of SEQ ID NO: 24 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 25, a primer consisting of a nucleotide sequence of SEQ ID NO: 26, a primer consisting of a nucleotide sequence of SEQ ID NO: 27, a primer consisting of a nucleotide sequence of SEQ ID NO: 28, a nucleotide sequence of SEQ ID NO: 29 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 30, a primer consisting of a nucleotide sequence of SEQ ID NO: 31, a primer consisting of a nucleotide sequence of SEQ ID NO: 32, a primer consisting of a nucleotide sequence of SEQ ID NO: 33, a nucleotide sequence of SEQ ID NO: 34 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 35, a primer consisting of a nucleotide sequence of SEQ ID NO: 36, a primer consisting of a nucleotide sequence of SEQ ID NO: 37, a primer consisting of a nucleotide sequence of SEQ ID NO: 38 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 39, a primer consisting of a nucleotide sequence of SEQ ID NO: 40, a primer consisting of a nucleotide sequence of SEQ ID NO: 41, a primer consisting of a nucleotide sequence of SEQ ID NO: 42, a primer consisting of a nucleotide sequence of SEQ ID NO: 43 Primer, a primer consisting of the nucleotide sequence of SEQ ID NO: 44, a primer consisting of the nucleotide sequence of SEQ ID NO: 45, a primer consisting of the nucleotide sequence of SEQ ID NO: 46, a primer consisting of the nucleotide sequence of SEQ ID NO: 47, It may include a primer, a primer consisting of the nucleotide sequence of SEQ ID NO: 49, a primer consisting of the nucleotide sequence of SEQ ID NO: 50, a primer consisting of the nucleotide sequence of SEQ ID NO: 51, and a primer consisting of the nucleotide sequence of SEQ ID NO: 52.

The composition may further include 29 primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 53 to 81.

In one embodiment of the present invention, the composition comprises a primer consisting of a nucleotide sequence of SEQ ID NO: 1, a primer consisting of a nucleotide sequence of SEQ ID NO: 2, a primer consisting of a nucleotide sequence of SEQ ID NO: 3, and a nucleotide sequence of SEQ ID NO: 4 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 5, a primer consisting of a nucleotide sequence of SEQ ID NO: 6, a primer consisting of a nucleotide sequence of SEQ ID NO: 7, a primer consisting of a nucleotide sequence of SEQ ID NO: 8, a primer consisting of a nucleotide sequence of SEQ ID NO: 9 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 10, a primer consisting of a nucleotide sequence of SEQ ID NO: 11, a primer consisting of a nucleotide sequence of SEQ ID NO: 12, a primer consisting of a nucleotide sequence of SEQ ID NO: 13, a primer consisting of a nucleotide sequence of SEQ ID NO: 14 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 15, a primer consisting of a nucleotide sequence of SEQ ID NO: 16, a primer consisting of a nucleotide sequence of SEQ ID NO: 17, a primer consisting of a nucleotide sequence of SEQ ID NO: 18, a primer consisting of a nucleotide sequence of SEQ ID NO: 19 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 20, a primer consisting of a nucleotide sequence of SEQ ID NO: 21, a primer consisting of a nucleotide sequence of SEQ ID NO: 22, a primer consisting of a nucleotide sequence of SEQ ID NO: 23, a primer consisting of a nucleotide sequence of SEQ ID NO: 24 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 25, a primer consisting of a nucleotide sequence of SEQ ID NO: 26, a primer consisting of a nucleotide sequence of SEQ ID NO: 27, a primer consisting of a nucleotide sequence of SEQ ID NO: 28, a primer consisting of a nucleotide sequence of SEQ ID NO: 29 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 30, a primer consisting of a nucleotide sequence of SEQ ID NO: 31, a primer consisting of a nucleotide sequence of SEQ ID NO: 32, a primer consisting of a nucleotide sequence of SEQ ID NO: 33, a primer consisting of a nucleotide sequence of SEQ ID NO: 34 Primer, a primer consisting of the nucleotide sequence of SEQ ID NO: 35, a primer consisting of the nucleotide sequence of SEQ ID NO: 36, a primer consisting of the nucleotide sequence of SEQ ID NO: 37, a fry consisting of the nucleotide sequence of SEQ ID NO: 38 Mer, a primer consisting of the nucleotide sequence of SEQ ID NO: 39, a primer consisting of the nucleotide sequence of SEQ ID NO: 40, a primer consisting of the nucleotide sequence of SEQ ID NO: 41, a primer consisting of the nucleotide sequence of SEQ ID NO: 42, Primer, a primer consisting of the nucleotide sequence of SEQ ID NO: 44, a primer consisting of the nucleotide sequence of SEQ ID NO: 45, a primer consisting of the nucleotide sequence of SEQ ID NO: 46, a primer consisting of the nucleotide sequence of SEQ ID NO: 47, A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 49, a primer consisting of a nucleotide sequence of SEQ ID NO: 50, a primer consisting of a nucleotide sequence of SEQ ID NO: 51, a primer consisting of a nucleotide sequence of SEQ ID NO: 52, a primer consisting of a nucleotide sequence of SEQ ID NO: 53 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 54, a primer consisting of a nucleotide sequence of SEQ ID NO: 55, a primer consisting of a nucleotide sequence of SEQ ID NO: 56, a primer consisting of a nucleotide sequence of SEQ ID NO: 57, a primer consisting of a nucleotide sequence of SEQ ID NO: 58 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 59, a primer consisting of a nucleotide sequence of SEQ ID NO: 60, a primer consisting of a nucleotide sequence of SEQ ID NO: 61, a primer consisting of a nucleotide sequence of SEQ ID NO: 62, a primer consisting of a nucleotide sequence of SEQ ID NO: 63 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 64, a primer consisting of a nucleotide sequence of SEQ ID NO: 65, a primer consisting of a nucleotide sequence of SEQ ID NO: 66, a primer consisting of a nucleotide sequence of SEQ ID NO: 67, a primer consisting of a nucleotide sequence of SEQ ID NO: 68 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 69, a primer consisting of a nucleotide sequence of SEQ ID NO: 70, a primer consisting of a nucleotide sequence of SEQ ID NO: 71, a primer consisting of a nucleotide sequence of SEQ ID NO: 72, a primer consisting of a nucleotide sequence of SEQ ID NO: 73 Primer, a primer consisting of the nucleotide sequence of SEQ ID NO: 74, a primer consisting of the nucleotide sequence of SEQ ID NO: 75, a primer consisting of the nucleotide sequence of SEQ ID NO: 76, A primer consisting of a nucleotide sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 78, a primer consisting of a nucleotide sequence of SEQ ID NO: 79, a primer consisting of a nucleotide sequence of SEQ ID NO: 80, and a primer consisting of a nucleotide sequence of SEQ ID NO: 81 may be included. .

The concentration of the primers is 0.1 to 1.0 pM, 0.1 to 0.8 pM, 0.1 to 0.6 pM, 0.2 to 1.0 pM, 0.2 to 0.8 pM, 0.2 to 0.6 pM, 0.3 to 1.0 pM, 0.3 to 0.8 pM, 0.3 to 0.6 pM, respectively. , 0.4 to 1.0 pM or 0.4 to 0.8 pM, for example, 0.4 to 0.6 pM, but is not limited thereto.

Another aspect of the present invention is a kit for diagnosing hepatitis A including 52 primers consisting of a nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 1 to 52.

The kit may further include 29 primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 53 to 81.

The concentration of the primers is 0.1 to 1.0 pM, 0.1 to 0.8 pM, 0.1 to 0.6 pM, 0.2 to 1.0 pM, 0.2 to 0.8 pM, 0.2 to 0.6 pM, 0.3 to 1.0 pM, 0.3 to 0.8 pM, 0.3 to 0.6 pM, respectively. , 0.4 to 1.0 pM or 0.4 to 0.8 pM, for example, 0.4 to 0.6 pM, but is not limited thereto.

Another aspect of the present invention is a method of obtaining the whole genome sequences of Hepatitis A virus, comprising the following steps:

For the sample, a multiplex polymerase chain reaction (mPCR) using a multiplex primer set including 52 primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 1 to 52 ) To perform a sequence amplification step; And

An NGS analysis step of analyzing the hepatitis A virus sequence library containing the product by mPCR by next generation sequencing (NGS).

The sample may be RNA or cDNA.

In one embodiment of the present invention, a gene amplification reaction may be performed using a pair of primers that bind to cDNA synthesized from total RNA obtained from the target virus in the sample. To obtain mRNA, total RNA can be isolated from the sample. Isolation of total RNA can be carried out according to conventional methods known in the art. For example, using Trizol can easily isolate total RNA. Then, cDNA can be synthesized from the isolated mRNA, and this cDNA can be amplified.

The sample may be obtained from the group consisting of blood, serum, sputum, urine, feces, and living tissue.

In one embodiment of the present invention, the multiple complex primer set includes a primer consisting of a nucleotide sequence of SEQ ID NO: 1, a primer consisting of a nucleotide sequence of SEQ ID NO: 2, a primer consisting of a nucleotide sequence of SEQ ID NO: 3, and a base of SEQ ID NO: 4 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 5, a primer consisting of a nucleotide sequence of SEQ ID NO: 6, a primer consisting of a nucleotide sequence of SEQ ID NO: 7, a primer consisting of a nucleotide sequence of SEQ ID NO: 8, a base of SEQ ID NO: 9 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 10, a primer consisting of a nucleotide sequence of SEQ ID NO: 11, a primer consisting of a nucleotide sequence of SEQ ID NO: 12, a primer consisting of a nucleotide sequence of SEQ ID NO: 13, a base of SEQ ID NO: 14 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 15, a primer consisting of a nucleotide sequence of SEQ ID NO: 16, a primer consisting of a nucleotide sequence of SEQ ID NO: 17, a primer consisting of a nucleotide sequence of SEQ ID NO: 18, a base of SEQ ID NO: 19 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 20, a primer consisting of a nucleotide sequence of SEQ ID NO: 21, a primer consisting of a nucleotide sequence of SEQ ID NO: 22, a primer consisting of a nucleotide sequence of SEQ ID NO: 23, a base of SEQ ID NO: 24 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 25, a primer consisting of a nucleotide sequence of SEQ ID NO: 26, a primer consisting of a nucleotide sequence of SEQ ID NO: 27, a primer consisting of a nucleotide sequence of SEQ ID NO: 28, a base of SEQ ID NO: 29 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 30, a primer consisting of a nucleotide sequence of SEQ ID NO: 31, a primer consisting of a nucleotide sequence of SEQ ID NO: 32, a primer consisting of a nucleotide sequence of SEQ ID NO: 33, a base of SEQ ID NO: 34 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 35, a primer consisting of a nucleotide sequence of SEQ ID NO: 36, a primer consisting of a nucleotide sequence of SEQ ID NO: 37, a nucleotide sequence of SEQ ID NO: 38 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 39, a primer consisting of a nucleotide sequence of SEQ ID NO: 40, a primer consisting of a nucleotide sequence of SEQ ID NO: 41, a primer consisting of a nucleotide sequence of SEQ ID NO: 42, a nucleotide sequence of SEQ ID NO: 43 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 44, a primer consisting of a nucleotide sequence of SEQ ID NO: 45, a primer consisting of a nucleotide sequence of SEQ ID NO: 46, a primer consisting of a nucleotide sequence of SEQ ID NO: 47, a nucleotide sequence of SEQ ID NO: 48 It may include a primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 49, a primer consisting of a nucleotide sequence of SEQ ID NO: 50, a primer consisting of a nucleotide sequence of SEQ ID NO: 51, and a primer consisting of a nucleotide sequence of SEQ ID NO: 52.

The multiple complex primer set may additionally include 29 primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 53 to 81.

In one embodiment of the present invention, the multiple complex primer set includes a primer consisting of a nucleotide sequence of SEQ ID NO: 1, a primer consisting of a nucleotide sequence of SEQ ID NO: 2, a primer consisting of a nucleotide sequence of SEQ ID NO: 3, and a base of SEQ ID NO: 4 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 5, a primer consisting of a nucleotide sequence of SEQ ID NO: 6, a primer consisting of a nucleotide sequence of SEQ ID NO: 7, a primer consisting of a nucleotide sequence of SEQ ID NO: 8, a base of SEQ ID NO: 9 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 10, a primer consisting of a nucleotide sequence of SEQ ID NO: 11, a primer consisting of a nucleotide sequence of SEQ ID NO: 12, a primer consisting of a nucleotide sequence of SEQ ID NO: 13, a base of SEQ ID NO: 14 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 15, a primer consisting of a nucleotide sequence of SEQ ID NO: 16, a primer consisting of a nucleotide sequence of SEQ ID NO: 17, a primer consisting of a nucleotide sequence of SEQ ID NO: 18, a base of SEQ ID NO: 19 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 20, a primer consisting of a nucleotide sequence of SEQ ID NO: 21, a primer consisting of a nucleotide sequence of SEQ ID NO: 22, a primer consisting of a nucleotide sequence of SEQ ID NO: 23, a base of SEQ ID NO: 24 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 25, a primer consisting of a nucleotide sequence of SEQ ID NO: 26, a primer consisting of a nucleotide sequence of SEQ ID NO: 27, a primer consisting of a nucleotide sequence of SEQ ID NO: 28, a base of SEQ ID NO: 29 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 30, a primer consisting of a nucleotide sequence of SEQ ID NO: 31, a primer consisting of a nucleotide sequence of SEQ ID NO: 32, a primer consisting of a nucleotide sequence of SEQ ID NO: 33, a base of SEQ ID NO: 34 A primer consisting of a sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 35, a primer consisting of a nucleotide sequence of SEQ ID NO: 36, a primer consisting of a nucleotide sequence of SEQ ID NO: 37, a nucleotide sequence of SEQ ID NO: 38 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 39, a primer consisting of a nucleotide sequence of SEQ ID NO: 40, a primer consisting of a nucleotide sequence of SEQ ID NO: 41, a primer consisting of a nucleotide sequence of SEQ ID NO: 42, a nucleotide sequence of SEQ ID NO: 43 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 44, a primer consisting of a nucleotide sequence of SEQ ID NO: 45, a primer consisting of a nucleotide sequence of SEQ ID NO: 46, a primer consisting of a nucleotide sequence of SEQ ID NO: 47, a nucleotide sequence of SEQ ID NO: 48 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 49, a primer consisting of a nucleotide sequence of SEQ ID NO: 50, a primer consisting of a nucleotide sequence of SEQ ID NO: 51, a primer consisting of a nucleotide sequence of SEQ ID NO: 52, a nucleotide sequence of SEQ ID NO: 53 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 54, a primer consisting of a nucleotide sequence of SEQ ID NO: 55, a primer consisting of a nucleotide sequence of SEQ ID NO: 56, a primer consisting of a nucleotide sequence of SEQ ID NO: 57, a nucleotide sequence of SEQ ID NO: 58 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 59, a primer consisting of a nucleotide sequence of SEQ ID NO: 60, a primer consisting of a nucleotide sequence of SEQ ID NO: 61, a primer consisting of a nucleotide sequence of SEQ ID NO: 62, a nucleotide sequence of SEQ ID NO: 63 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 64, a primer consisting of a nucleotide sequence of SEQ ID NO: 65, a primer consisting of a nucleotide sequence of SEQ ID NO: 66, a primer consisting of a nucleotide sequence of SEQ ID NO: 67, a nucleotide sequence of SEQ ID NO: 68 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 69, a primer consisting of a nucleotide sequence of SEQ ID NO: 70, a primer consisting of a nucleotide sequence of SEQ ID NO: 71, a primer consisting of a nucleotide sequence of SEQ ID NO: 72, a nucleotide sequence of SEQ ID NO: 73 A primer consisting of, a primer consisting of a nucleotide sequence of SEQ ID NO: 74, a primer consisting of a nucleotide sequence of SEQ ID NO: 75, a primer consisting of a nucleotide sequence of SEQ ID NO: 76, A primer consisting of the nucleotide sequence of SEQ ID NO: 77, a primer consisting of the nucleotide sequence of SEQ ID NO: 78, a primer consisting of the nucleotide sequence of SEQ ID NO: 79, a primer consisting of the nucleotide sequence of SEQ ID NO: 80, and a primer consisting of the nucleotide sequence of SEQ ID NO: 81 Can include.

The concentrations of the primers of the multiple complex primer sets are 0.1 to 1.0 pM, 0.1 to 0.8 pM, 0.1 to 0.6 pM, 0.2 to 1.0 pM, 0.2 to 0.8 pM, 0.2 to 0.6 pM, 0.3 to 1.0 pM, 0.3 to 0.8 pM, respectively. , 0.3 to 0.6 pM, 0.4 to 1.0 pM, or 0.4 to 0.8 pM, for example, 0.4 to 0.6 pM, but is not limited thereto.

The mPCR of the amplification step is 30 to 50 cycles, 30 to 46 cycles, 30 to 44 cycles, 33 to 50 cycles, 33 to 46 cycles, 33 to 44 cycles, 36 to 50 cycles, 36 to 46 cycles, 36 to 44 cycles. , 38 to 50 cycles or 38 to 46 cycles, for example, may be performed under the conditions of 38 to 44 cycles, but is not limited thereto.

The product by mPCR in the sequence amplification step may be 300 to 1000 bp in length.

After the sequence amplification step, mPCR is performed using a multi-complex primer set including 52 primers consisting of 52 types of primers selected from the group consisting of the nucleotide sequences of SEQ ID NOs: 1 to 52 using the product by mPCR as a sample. It may be to further include a sequence re-amplification step.

The multiple complex primer set may additionally include 29 primers consisting of a nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 53 to 81.

The mPCR of the re-amplification step is 15 to 35 cycles, 15 to 32 cycles, 15 to 30 cycles, 15 to 28 cycles, 18 to 35 cycles, 18 to 32 cycles, 18 to 30 cycles, 18 to 28 cycles, 22 to 35 Cycles, 22 to 32 cycles, or 22 to 30 cycles, for example, may be performed under the conditions of 22 to 28 cycles, but is not limited thereto.

The NGS analysis step may be performed using NGS equipment.

In one embodiment of the present invention, the NGS equipment may be MiSeq developed by Illumina. MiSeq is a small NGS device that does not amplify the DNA sequence in a solution like the existing technique, but performs the process by fixing the sequence on a plate and inducing the sequence to be amplified while bending on the plate to form a sequence group. To do. Sequence groups formed as described above are sequenced for each group, converted into nucleotide sequence information of each read, and this information can be applied to the analysis process. MiSeq can produce 3.7 ~ 4.6 Gb of biometric data within 24 hours at 2 x 150 bp.

The present invention relates to a composition for detecting a hepatitis A virus comprising a multiple complex primer set, a kit for diagnosing hepatitis A, and a method for obtaining the full-length genome sequence of the hepatitis A virus. When the multiple complex primer set is used, a very small amount of Since the virus genome can be amplified to check whether a virus is infected and the concentration of the genome sequence can be increased, it can be effectively used for detection of a virus, diagnosis of infection, and acquisition of the full-length virus genome.

1 is a schematic diagram showing an expected amplified product when PCR is performed with a multiplex primer for amplifying a full-length genome sequence.
2A is a picture of PCR results using multiple complex primer sets consisting of 52 primers for a hepatitis A patient serum sample.
FIG. 2B is a picture of confirming PCR results using multiple complex primer sets consisting of 81 primers for serum samples of hepatitis A patients.

Hereinafter, the present invention will be described in more detail by the following examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples.

Example 1: type A Hepatitis virus Multiple complexes for full-length genome detection Of the primer Design and production

Hepatitis A virus prototype (Hepatitis A virus) belonging to the Hepatovirus genus (Hepatitis A virus) for the design and production of multiple complex primers that can act in combination with hepatitis A virus and enable genome detection. Prototype), the full-length genome sequence of GBM (Germany_1976) was used as the Reference Genome Sequence.

In the present invention, the design of multiple complex primers for detecting the full-length genome of the hepatitis A virus is shown in FIG. 1.

The multiple complex primer set was designed so that the product can be amplified in units of 300 to 1000 bp in length from single-stranded RNA of hepatitis A virus. Multi-complex primers are made by combining all these single primers.

Each primer sequence of the hepatitis A virus multiple complex primer set is shown in Table 1.

Sequence number designation order location One 1F TTCAAGAGGGGTCTCCGGA 1_19 2 84F AGGCTATAGGCTAAATTTCCCT 84-105 3 208F ACGCTTTCTGTCTCYTTTCTT 208-228 4 493F CATTCAACGCCGGAGGACT 493-511 5 732F TAATGAATATGTCCAGACAAGGT 732-754 6 923F GAACCTTTGAAAACCTCTGTTG 923-944 7 1426F TTTACAGATTTGGAGTTGC 1426-1444 8 1528F TATGAAGATGCAAGGGCAAA 1528-1547 9 1818F TTGATTTYCAGGTTTTTCC 1818-1836 10 2210F GGAGATGATTCAGGAGGTTTT 2210-2230 11 2412F CTGAATTGAARCCTGGAGAGT 2412-2432 12 2746F TTACAAAACTGCCCTTGGA 2746-2764 13 3263F ACTGAGGAGCATGAAATAATGAA 3263-3285 14 3591F TGTTGCATTGGCTAAATCC 3591-3609 15 4103F AATTATGGCAADAAGAAGGAT 4103-4123 16 4260F TGAGAACTGTYCAYTCAATGG 4260-4280 17 4394F TGTGAGCCAGTTGTTTGCT 4394-4412 18 4636F ATGCCCAATGAGATTGAATA 4636-4655 19 4846F GGCTAAAACAAATGATGCAATT 4846-4867 20 5007F CAGATGATGAYAATGATAGTGC 5007-5028 21 5674F GGAGATGTACCTAGAGCCTTG 5674-5694 22 5788F AGGTCTTCCWGGAATGTGTG 5788-5807 23 6082F AGTCCCATTCATCATCACATTG 6082-6103 24 6678F ATTTTTCTGCYTTTGATGCTAGT 6678-6700 25 6936F TGTGGTTCAATGCCTTCTG 6836-6854 26 7027F GTGCCTCAATTGAAGCCAGT 7027-7046 27 595R TGCCCTAAGCACAGAGAGGT 576-595 28 1093R AACCTTGAACAGCAAACTGC 1074-1093 29 1485R AATTCATTTCTCATCATCTGTGT 1463-1485 30 1680R GAATCTGAAGCATTAAATGGA 1660-1680 31 1998R ATCCAAGGAACACGAAATCT 1979-1998 32 2230R AAAACCTCCTGAATCATCTCC 2210-2230 33 2379R GGATCYTCAATTGTTGTAATAGC 2357-2379 34 2578R TGGCAAACCATGAGGAGGATTAG 2556-2578 35 2921R AATGATTGTAATTTGCAATCT 2901-2921 36 3285R TTCATTATTTCATGCTCCTC 3266-3285 37 3354R CCAGCAGCCAAAGARAATCCA 3334-3354 38 3911R AGATAACTGAGCAGCCAAT 3893-3911 39 4179R GCTTCCTCAATYGCTTTCTCTAT 4157-4179 40 4413R TAGCAAACAACTGGCTCAC 4395-4413 41 4763R CAATKGCTTCCTTAACATAAACT 4741-4763 42 4917R AATGAAACATTATGTCCATCCAT 4895-4917 43 5240R TCACGCCATGGTAAACCCC 5222-5240 44 5390R CTCCTAAGGCATTCATAACCC 5370-5390 45 5583R TCTCTAAACTTDGGAATTGTAGGA 5560-5583 46 5818R CAAGGCCCCACCACACATT 5800-5818 47 6364R GGACATAAGGAAACCCAGG 6346-6364 48 6560R AACTAATAGCTGGACCCCAATAC 6538-6560 49 6674R ATGCCAATAGCAACACCTGT 6655-6674 50 6792R ATAGTRTTGATAAGAGCYGTTCC 6770-6792 51 7278R TGCATAAAAGCAAACCACT 7260-7278 52 7477R ATTTACTGAWAARARAAATAAACA 7454-7477 53 130R AAGGAAATAGGGRAAGGAC 112-130 54 145R TTACAAACAAAACAAAAGGA 126-145 55 167R CTGAACCTGCAGGAATTAATA 147-167 56 212R AGCGTGAAAATTGAGTGTTC 193-212 57 311R GACTCCTACAGCTCCATGC 293-311 58 374R GGTTCATGAAAGCCAAGTTA 353-372 59 467R TATCCGCCGCTGTTACCCTATCC 445-467R 60 535R CATTTAAGGCCAAATAGTGTTTG 513-535 61 564R CTAGAGACAGCCCTGACAATC 554-564 62 671R CTTGTTTGGACATATTCATTA 651-671 63 796R GACAGGATGTGGTCAAGGC 778-796 64 855R CCAGTCACTGCAGTMCTATCAAC 833-855 65 1588F CTCTCAAGGTGGTGGAATTAA 1588-1608 66 2120R AAGCAACATTAGAAGGAGAAGTC 2098-2120 67 2782F AAGAAGAACAGGRAACATTCAGAT 2782-2805 68 2894F TCTATTCAGATTGCAAATTACAA 2894-2916 69 3197R CATTTGACAACTCTTCCTGAGC 3176-3197 70 3368F ACTCTTGAGATGGATGCTG 3368-3386 71 3428F TGGACAGAAATGAARGATGA 3428-3447 72 3510F CACATGGAATGTTGGATCTT 3510-3529 73 3581F TTGTGTTTCYTGTTGCATTG 3581-3600 74 3602R GCCAATGCAACARGAAACA 3584-3602 75 3977R TCATTCTGGARTCCATTTG 3959-3977 76 4499R CCGGTTCAACACCATAGTG 4481-4499 77 4567F CATCATTGATGATATTGGCC 4567-4586 78 4770R CTACGATCAATTGCTTCCT 4752-4770 79 4858F TGATGCAATTAAGGACATGTC 4858-4878 80 5619F CTAGAGCTTTGAATCGKYTGGC 5619-5638 81 6770F CAATGCCTTCTGGGTCTCCT 6770-6789

Example 2: RNA extraction and cDNA synthesis from sample

Serum of the hepatitis A patient (82w-82, 82w-70 and 04-1, respectively) was obtained, and total RNA was isolated by treating the obtained samples with LS TRIzol (Invitrogen). 1 ug of the isolated total RNA was prepared in a final volume of 20 ul using a kit (High-Capacity RNA-to-cDNA Kit, Applied Biosytems). The prepared sample was reacted at 37°C for 60 minutes and 94°C for 5 minutes to synthesize cDNA.

Example 3: Performing the multiplex primary PCR

Using 1.0 ul of cDNA prepared according to Example 2 as a template, a multi-complex primer set mix (the concentration of each primer is 0.5 pM) 10.0 ul, a mix (SolgTM 2X Uh-Taq PCR Smart mix) 12.5 ul and purified water (Molecular grade water) 25.0 ul was used to perform the first PCR (Proflex Thermal Cycler, Biosystems).

Specifically, the multiple complex primer set mix, in Table 1, 52 primer sets including primers corresponding to SEQ ID NOs: 1 to 52 and 81 primer sets including primers corresponding to SEQ ID NOs: 1 to 81, that is, two It was divided into cases and used for each experiment.

Conditions for performing the first PCR are shown in Table 2 below.

Temperature time Remark 95℃ 15 min X 1 95℃
50℃
72℃ 20 sec
40 sec
1 min X 40 72℃ 3 min X 1 10℃ ∞

One cycle at 95°C for 15 minutes, 20 seconds at 95°C, 40 seconds at 50°C, and 40 cycles at 72°C for 1 minute, the final extension reaction was reacted 1 cycle at 72°C for 3 minutes. After amplifying the nucleic acid by performing PCR according to the reaction conditions, the amplification product was electrophoresed on a 3% (w/w) agarose gel to confirm the amplification of the target detection gene based on the standard marker.

Example 4: Performing Multiplex Secondary PCR

1.0 ul of the product prepared through primary multiplex PCR according to Example 3 as a template, and a multi-complex primer set mix (52 primer sets and 81 primer sets, each primer concentration is 0.5 pM) 10.0 ul, mix (SolgTM 2X Uh-Taq PCR Smart mix) A second PCR was performed using 12.5 ul and 25.0 ul of purified water (Proflex Thermal Cycler, Biosystems).

The conditions for performing the secondary PCR are shown in Table 3 below.

Temperature time Remark 95℃ 15 min X 1 95℃
50℃
72℃ 20 sec
40 sec
1 min X 25 72℃ 3 min X 1 10℃ ∞

One cycle at 95° C. for 15 minutes, 20 seconds at 95° C., 40 seconds at 50° C., and 25 cycles at 72° C. for 1 minute, the final extension reaction was 1 cycle at 72° C. for 3 minutes. After amplifying the nucleic acid by performing PCR according to the reaction conditions, the amplification product was electrophoresed on a 3% (w/w) agarose gel to confirm the amplification of the target detection gene based on the standard marker. As can be seen in Figures 2a and 2b, in some samples with a large amount of viral nucleic acid sequence in the serum sample of a hepatitis A virus patient, a product in the form of a step was confirmed from the results of the first PCR reaction, and the product in the second PCR As a result of performing, in the photo, a thinly spread and cloudy reaction product could be confirmed.

Example 5: type A Hepatitis virus Sample preparation and NGS for full-length genome sequence detection

The multiplex PCR product was fragmented using a sample preparation device (Covaris Focused-Ultrasonicator). Fragmented PCR products are cleaned up using magnetic beads, and then the end repair reaction is performed at 30°C for 30 minutes using 40 ul of the end repair mix. Performed during.

After that, magnetic beads (Illumina) were diluted with DEPC-treated water (Invitrogen) equivalent to twice the volume (1:2, v/v) to remove large (Large, 1,000 bp or more)-sized DNA fragments. , Small (Small, 300 bp or less) size DNA fragments were removed using magnetic beads. PCR products selected based on size were adenosine-tailing mix (A-tailing mix, Illumina TruSeq Nano DNA LT Library Prep Kit (Catalog number: FC-121-4-1, FC-121-4002)) 12.5 ul. The reaction was performed at 37°C for 30 minutes, 70°C for 5 minutes, and 4°C for 5 minutes in 1 cycle.

Using the PCR product subjected to the reaction as a sample, using 2.5 ul of Illumina buffer, 2.5 ul of ligation mix, and 2.5 ul of a specific DNA adapter (Illumina) at 30°C. Ligation reaction was performed for 10 minutes. After 10 minutes, 5 ul of a stop solution (Illuminum) was added and the ligation reaction was stopped.

For the sample that went through the two purification processes, 5 ul of a PCR primer cocktail (Illumina) and 20 ul of an enhanced PCR mix (Illumina) were added, and the amount of the sample was amplified through PCR. 1 cycle at 95°C for 3 minutes, 20 seconds at 98°C, 15 seconds at 60°C, 8 cycles at 72°C for 30 seconds, and the final extension reaction was 1 cycle at 72°C for 5 minutes.

After the above reaction was completed, it was prepared to be carried out in NGS equipment (MiSeq, Illumina) through quality control after undergoing one purification process. After checking the concentration and quality of the sample through a bio-analyzer and RT-qPCR, an NGS reaction was performed using the equipment. After that, the full-length genome sequence of the hepatitis A virus was obtained.

<110> Industry-University Cooperation Foundation Korea University <120> Composition for detecting Hepatitis A virus comprising multiplex primer set, kit for diagnosing Hepatitis A and method for obtaining Hepatitis A virus whole genome sequence <130> PN180044 <160> 81 <170> KopatentIn 2.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 1 ttcaagaggg gtctccgga 19 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 2 aggctatagg ctaaatttcc ct 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 3 acgctttctg tctcytttct t 21 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 4 cattcaacgc cggaggact 19 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 5 taatgaatat gtccagacaa ggt 23 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 6 gaacctttga aaacctctgt tg 22 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 7 tttacagatt tggagttgc 19 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 8 tatgaagatg caagggcaaa 20 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 9 ttgatttyca ggtttttcc 19 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 10 ggagatgatt caggaggttt t 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 11 ctgaattgaa rcctggagag t 21 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 12 ttacaaaact gcccttgga 19 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 13 actgaggagc atgaaataat gaa 23 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 14 tgttgcattg gctaaatcc 19 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 15 aattatggca adaagaagga t 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 16 tgagaactgt ycaytcaatg g 21 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 17 tgtgagccag ttgtttgct 19 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 18 atgcccaatg agattgaata 20 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 19 ggctaaaaca aatgatgcaa tt 22 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 20 cagatgatga yaatgatagt gc 22 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 21 ggagatgtac ctagagcctt g 21 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 22 aggtcttccw ggaatgtgtg 20 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 23 agtcccattc atcatcacat tg 22 <210> 24 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 24 atttttctgc ytttgatgct agt 23 <210> 25 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 25 tgtggttcaa tgccttctg 19 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 26 gtgcctcaat tgaagccagt 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 27 tgccctaagc acagagaggt 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 28 aaccttgaac agcaaactgc 20 <210> 29 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 29 aattcatttc tcatcatctg tgt 23 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 30 gaatctgaag cattaaatgg a 21 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 31 atccaaggaa cacgaaatct 20 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 32 aaaacctcct gaatcatctc c 21 <210> 33 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 33 ggatcytcaa ttgttgtaat agc 23 <210> 34 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 34 tggcaaacca tgaggaggat tag 23 <210> 35 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 35 aatgattgta atttgcaatc t 21 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 36 ttcattattt catgctcctc 20 <210> 37 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 37 ccagcagcca aagaraatcc a 21 <210> 38 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 38 agataactga gcagccaat 19 <210> 39 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 39 gcttcctcaa tygctttctc tat 23 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 40 tagcaaacaa ctggctcac 19 <210> 41 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 41 caatkgcttc cttaacataa act 23 <210> 42 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 42 aatgaaacat tatgtccatc cat 23 <210> 43 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 43 tcacgccatg gtaaacccc 19 <210> 44 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 44 ctcctaaggc attcataacc c 21 <210> 45 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 45 tctctaaact tdggaattgt agga 24 <210> 46 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 46 caaggcccca ccacacatt 19 <210> 47 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 47 ggacataagg aaacccagg 19 <210> 48 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 48 aactaatagc tggaccccaa tac 23 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 49 atgccaatag caacacctgt 20 <210> 50 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 50 atagtrttga taagagcygt tcc 23 <210> 51 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 51 tgcataaaag caaaccact 19 <210> 52 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 52 atttactgaw aararaaata aaca 24 <210> 53 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 53 aaggaaatag ggraaggac 19 <210> 54 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 54 ttacaaacaa aacaaaagga 20 <210> 55 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 55 ctgaacctgc aggaattaat a 21 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 56 agcgtgaaaa ttgagtgttc 20 <210> 57 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 57 gactcctaca gctccatgc 19 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 58 ggttcatgaa agccaagtta 20 <210> 59 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 59 tatccgccgc tgttacccta tcc 23 <210> 60 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 60 catttaaggc caaatagtgt ttg 23 <210> 61 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 61 ctagagacag ccctgacaat c 21 <210> 62 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 62 cttgtttgga catattcatt a 21 <210> 63 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 63 gacaggatgt ggtcaaggc 19 <210> 64 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 64 ccagtcactg cagtmctatc aac 23 <210> 65 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 65 ctctcaaggt ggtggaatta a 21 <210> 66 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 66 aagcaacatt agaaggagaa gtc 23 <210> 67 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 67 aagaagaaca ggraacattc agat 24 <210> 68 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 68 tctattcaga ttgcaaatta caa 23 <210> 69 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 69 catttgacaa ctcttcctga gc 22 <210> 70 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 70 actcttgaga tggatgctg 19 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 71 tggacagaaa tgaargatga 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 72 cacatggaat gttggatctt 20 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 73 ttgtgtttcy tgttgcattg 20 <210> 74 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 74 gccaatgcaa cargaaaca 19 <210> 75 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 75 tcattctgga rtccatttg 19 <210> 76 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 76 ccggttcaac accatagtg 19 <210> 77 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 77 catcattgat gatattggcc 20 <210> 78 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 78 ctacgatcaa ttgcttcct 19 <210> 79 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 79 tgatgcaatt aaggacatgt c 21 <210> 80 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 80 ctagagcttt gaatcgkytg gc 22 <210> 81 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Artificial Sequence <400> 81 caatgccttc tgggtctcct 20

Claims (18)

A primer consisting of the nucleotide sequence of SEQ ID NO: 1, a primer consisting of the nucleotide sequence of SEQ ID NO: 2, a primer consisting of the nucleotide sequence of SEQ ID NO: 3, a primer consisting of the nucleotide sequence of SEQ ID NO: 4, a primer consisting of the nucleotide sequence of SEQ ID NO: 5, A primer consisting of the nucleotide sequence of SEQ ID NO: 6, a primer consisting of the nucleotide sequence of SEQ ID NO: 7, a primer consisting of the nucleotide sequence of SEQ ID NO: 8, a primer consisting of the nucleotide sequence of SEQ ID NO: 9, a primer consisting of the nucleotide sequence of SEQ ID NO: 10, A primer consisting of the nucleotide sequence of SEQ ID NO: 11, a primer consisting of the nucleotide sequence of SEQ ID NO: 12, a primer consisting of the nucleotide sequence of SEQ ID NO: 13, a primer consisting of the nucleotide sequence of SEQ ID NO: 14, a primer consisting of the nucleotide sequence of SEQ ID NO: 15, A primer consisting of the nucleotide sequence of SEQ ID NO: 16, a primer consisting of the nucleotide sequence of SEQ ID NO: 17, a primer consisting of the nucleotide sequence of SEQ ID NO: 18, a primer consisting of the nucleotide sequence of SEQ ID NO: 19, a primer consisting of the nucleotide sequence of SEQ ID NO: 20, A primer consisting of the nucleotide sequence of SEQ ID NO: 21, a primer consisting of the nucleotide sequence of SEQ ID NO: 22, a primer consisting of the nucleotide sequence of SEQ ID NO: 23, a primer consisting of the nucleotide sequence of SEQ ID NO: 24, a primer consisting of the nucleotide sequence of SEQ ID NO: 25, A primer consisting of the nucleotide sequence of SEQ ID NO: 26, a primer consisting of the nucleotide sequence of SEQ ID NO: 27, a primer consisting of the nucleotide sequence of SEQ ID NO: 28, a primer consisting of the nucleotide sequence of SEQ ID NO: 29, a primer consisting of the nucleotide sequence of SEQ ID NO: 30, A primer consisting of the nucleotide sequence of SEQ ID NO: 31, a primer consisting of the nucleotide sequence of SEQ ID NO: 32, a primer consisting of the nucleotide sequence of SEQ ID NO: 33, a primer consisting of the nucleotide sequence of SEQ ID NO: 34, a primer consisting of the nucleotide sequence of SEQ ID NO: 35, A primer consisting of the nucleotide sequence of SEQ ID NO: 36, a primer consisting of the nucleotide sequence of SEQ ID NO: 37, a primer consisting of the nucleotide sequence of SEQ ID NO: 38, and a primer consisting of the nucleotide sequence of SEQ ID NO: 39 Reamer, a primer consisting of a nucleotide sequence of SEQ ID NO: 40, a primer consisting of a nucleotide sequence of SEQ ID NO: 41, a primer consisting of a nucleotide sequence of SEQ ID NO: 42, a primer consisting of a nucleotide sequence of SEQ ID NO: 43, a primer consisting of a nucleotide sequence of SEQ ID NO: 44 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 45, a primer consisting of a nucleotide sequence of SEQ ID NO: 46, a primer consisting of a nucleotide sequence of SEQ ID NO: 47, a primer consisting of a nucleotide sequence of SEQ ID NO: 48, a primer consisting of a nucleotide sequence of SEQ ID NO: 49 A composition for detecting Hepatitis A virus comprising a primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 50, a primer consisting of a nucleotide sequence of SEQ ID NO: 51, and a primer consisting of a nucleotide sequence of SEQ ID NO: 52.
delete The method of claim 1, wherein the composition comprises a primer consisting of the nucleotide sequence of SEQ ID NO: 53, a primer consisting of the nucleotide sequence of SEQ ID NO: 54, a primer consisting of the nucleotide sequence of SEQ ID NO: 55, a primer consisting of the nucleotide sequence of SEQ ID NO: 56, and sequence A primer consisting of the nucleotide sequence of SEQ ID NO: 57, a primer consisting of the nucleotide sequence of SEQ ID NO: 58, a primer consisting of the nucleotide sequence of SEQ ID NO: 59, a primer consisting of the nucleotide sequence of SEQ ID NO: 60, a primer consisting of the nucleotide sequence of SEQ ID NO: 61, and sequence A primer consisting of the nucleotide sequence of SEQ ID NO: 62, a primer consisting of the nucleotide sequence of SEQ ID NO: 63, a primer consisting of the nucleotide sequence of SEQ ID NO: 64, a primer consisting of the nucleotide sequence of SEQ ID NO: 65, a primer consisting of the nucleotide sequence of SEQ ID NO: 66, and sequence A primer consisting of the nucleotide sequence of SEQ ID NO: 67, a primer consisting of the nucleotide sequence of SEQ ID NO: 68, a primer consisting of the nucleotide sequence of SEQ ID NO: 69, a primer consisting of the nucleotide sequence of SEQ ID NO: 70, a primer consisting of the nucleotide sequence of SEQ ID NO: 71, and sequence A primer consisting of the nucleotide sequence of SEQ ID NO: 72, a primer consisting of the nucleotide sequence of SEQ ID NO: 73, a primer consisting of the nucleotide sequence of SEQ ID NO: 74, a primer consisting of the nucleotide sequence of SEQ ID NO: 75, a primer consisting of the nucleotide sequence of SEQ ID NO: 76, and sequence In addition, a primer consisting of the nucleotide sequence of SEQ ID NO: 77, a primer consisting of the nucleotide sequence of SEQ ID NO: 78, a primer consisting of the nucleotide sequence of SEQ ID NO: 79, a primer consisting of the nucleotide sequence of SEQ ID NO: 80, and a primer consisting of the nucleotide sequence of SEQ ID NO: 81 are additionally added. That containing, a composition for detecting hepatitis A virus.
The composition for detecting hepatitis A virus according to claim 1, wherein the concentration of the primers is 0.1 to 1.0 pM, respectively.
A primer consisting of the nucleotide sequence of SEQ ID NO: 1, a primer consisting of the nucleotide sequence of SEQ ID NO: 2, a primer consisting of the nucleotide sequence of SEQ ID NO: 3, a primer consisting of the nucleotide sequence of SEQ ID NO: 4, a primer consisting of the nucleotide sequence of SEQ ID NO: 5, A primer consisting of the nucleotide sequence of SEQ ID NO: 6, a primer consisting of the nucleotide sequence of SEQ ID NO: 7, a primer consisting of the nucleotide sequence of SEQ ID NO: 8, a primer consisting of the nucleotide sequence of SEQ ID NO: 9, a primer consisting of the nucleotide sequence of SEQ ID NO: 10, A primer consisting of the nucleotide sequence of SEQ ID NO: 11, a primer consisting of the nucleotide sequence of SEQ ID NO: 12, a primer consisting of the nucleotide sequence of SEQ ID NO: 13, a primer consisting of the nucleotide sequence of SEQ ID NO: 14, a primer consisting of the nucleotide sequence of SEQ ID NO: 15, A primer consisting of the nucleotide sequence of SEQ ID NO: 16, a primer consisting of the nucleotide sequence of SEQ ID NO: 17, a primer consisting of the nucleotide sequence of SEQ ID NO: 18, a primer consisting of the nucleotide sequence of SEQ ID NO: 19, a primer consisting of the nucleotide sequence of SEQ ID NO: 20, A primer consisting of the nucleotide sequence of SEQ ID NO: 21, a primer consisting of the nucleotide sequence of SEQ ID NO: 22, a primer consisting of the nucleotide sequence of SEQ ID NO: 23, a primer consisting of the nucleotide sequence of SEQ ID NO: 24, a primer consisting of the nucleotide sequence of SEQ ID NO: 25, A primer consisting of the nucleotide sequence of SEQ ID NO: 26, a primer consisting of the nucleotide sequence of SEQ ID NO: 27, a primer consisting of the nucleotide sequence of SEQ ID NO: 28, a primer consisting of the nucleotide sequence of SEQ ID NO: 29, a primer consisting of the nucleotide sequence of SEQ ID NO: 30, A primer consisting of the nucleotide sequence of SEQ ID NO: 31, a primer consisting of the nucleotide sequence of SEQ ID NO: 32, a primer consisting of the nucleotide sequence of SEQ ID NO: 33, a primer consisting of the nucleotide sequence of SEQ ID NO: 34, a primer consisting of the nucleotide sequence of SEQ ID NO: 35, A primer consisting of the nucleotide sequence of SEQ ID NO: 36, a primer consisting of the nucleotide sequence of SEQ ID NO: 37, a primer consisting of the nucleotide sequence of SEQ ID NO: 38, and a primer consisting of the nucleotide sequence of SEQ ID NO: 39 Reamer, a primer consisting of a nucleotide sequence of SEQ ID NO: 40, a primer consisting of a nucleotide sequence of SEQ ID NO: 41, a primer consisting of a nucleotide sequence of SEQ ID NO: 42, a primer consisting of a nucleotide sequence of SEQ ID NO: 43, a primer consisting of a nucleotide sequence of SEQ ID NO: 44 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 45, a primer consisting of a nucleotide sequence of SEQ ID NO: 46, a primer consisting of a nucleotide sequence of SEQ ID NO: 47, a primer consisting of a nucleotide sequence of SEQ ID NO: 48, a primer consisting of a nucleotide sequence of SEQ ID NO: 49 A kit for diagnosing hepatitis A comprising a primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 50, a primer consisting of a nucleotide sequence of SEQ ID NO: 51, and a primer consisting of a nucleotide sequence of SEQ ID NO: 52.
delete The method of claim 5, wherein the kit comprises a primer consisting of a nucleotide sequence of SEQ ID NO: 53, a primer consisting of a nucleotide sequence of SEQ ID NO: 54, a primer consisting of a nucleotide sequence of SEQ ID NO: 55, a primer consisting of a nucleotide sequence of SEQ ID NO: 56, and a sequence A primer consisting of the nucleotide sequence of SEQ ID NO: 57, a primer consisting of the nucleotide sequence of SEQ ID NO: 58, a primer consisting of the nucleotide sequence of SEQ ID NO: 59, a primer consisting of the nucleotide sequence of SEQ ID NO: 60, a primer consisting of the nucleotide sequence of SEQ ID NO: 61, and sequence A primer consisting of the nucleotide sequence of SEQ ID NO: 62, a primer consisting of the nucleotide sequence of SEQ ID NO: 63, a primer consisting of the nucleotide sequence of SEQ ID NO: 64, a primer consisting of the nucleotide sequence of SEQ ID NO: 65, a primer consisting of the nucleotide sequence of SEQ ID NO: 66, and sequence A primer consisting of the nucleotide sequence of SEQ ID NO: 67, a primer consisting of the nucleotide sequence of SEQ ID NO: 68, a primer consisting of the nucleotide sequence of SEQ ID NO: 69, a primer consisting of the nucleotide sequence of SEQ ID NO: 70, a primer consisting of the nucleotide sequence of SEQ ID NO: 71, and sequence A primer consisting of the nucleotide sequence of SEQ ID NO: 72, a primer consisting of the nucleotide sequence of SEQ ID NO: 73, a primer consisting of the nucleotide sequence of SEQ ID NO: 74, a primer consisting of the nucleotide sequence of SEQ ID NO: 75, a primer consisting of the nucleotide sequence of SEQ ID NO: 76, and sequence In addition, a primer consisting of the nucleotide sequence of SEQ ID NO: 77, a primer consisting of the nucleotide sequence of SEQ ID NO: 78, a primer consisting of the nucleotide sequence of SEQ ID NO: 79, a primer consisting of the nucleotide sequence of SEQ ID NO: 80, and a primer consisting of the nucleotide sequence of SEQ ID NO: 81 are additionally added. That includes, hepatitis A diagnostic kit.
The kit for diagnosing hepatitis A according to claim 5, wherein the concentration of the primer is 0.1 to 1.0 pM, respectively.
A method for obtaining the whole genome sequences of Hepatitis A virus, including the following steps:
A sequence amplification step of performing a multiplex polymerase chain reaction (mPCR) on the sample using multiple complex primer sets; And
An NGS analysis step of analyzing a hepatitis A virus sequence library containing the product by mPCR by next generation sequencing (NGS),
The multiple complex primer set includes a primer consisting of the nucleotide sequence of SEQ ID NO: 1, a primer consisting of the nucleotide sequence of SEQ ID NO: 2, a primer consisting of the nucleotide sequence of SEQ ID NO: 3, a primer consisting of the nucleotide sequence of SEQ ID NO: 4, and A primer consisting of a base sequence, a primer consisting of a base sequence of SEQ ID NO: 6, a primer consisting of a base sequence of SEQ ID NO: 7, a primer consisting of a base sequence of SEQ ID NO: 8, a primer consisting of a base sequence of SEQ ID NO: 9, A primer consisting of a base sequence, a primer consisting of a base sequence of SEQ ID NO: 11, a primer consisting of a base sequence of SEQ ID NO: 12, a primer consisting of a base sequence of SEQ ID NO: 13, a primer consisting of a base sequence of SEQ ID NO: 14, A primer consisting of a nucleotide sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 16, a primer consisting of a nucleotide sequence of SEQ ID NO: 17, a primer consisting of a nucleotide sequence of SEQ ID NO: 18, a primer consisting of the nucleotide sequence of SEQ ID NO: 19, A primer consisting of a base sequence, a primer consisting of a base sequence of SEQ ID NO: 21, a primer consisting of a base sequence of SEQ ID NO: 22, a primer consisting of a base sequence of SEQ ID NO: 23, a primer consisting of a base sequence of SEQ ID NO: 24, A primer consisting of a nucleotide sequence, a primer consisting of the nucleotide sequence of SEQ ID NO: 26, a primer consisting of the nucleotide sequence of SEQ ID NO: 27, a primer consisting of the nucleotide sequence of SEQ ID NO: 28, a primer consisting of the nucleotide sequence of SEQ ID NO: 29, A primer consisting of a nucleotide sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 31, a primer consisting of a nucleotide sequence of SEQ ID NO: 32, a primer consisting of a nucleotide sequence of SEQ ID NO: 33, a primer consisting of a nucleotide sequence of SEQ ID NO: 34, A primer consisting of a nucleotide sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 36, a primer consisting of a nucleotide sequence of SEQ ID NO: 37, a primer consisting of a nucleotide sequence of SEQ ID NO: 38, and a sequence number A primer consisting of the nucleotide sequence of SEQ ID NO: 39, a primer consisting of the nucleotide sequence of SEQ ID NO: 40, a primer consisting of the nucleotide sequence of SEQ ID NO: 41, a primer consisting of the nucleotide sequence of SEQ ID NO: 42, a primer consisting of the nucleotide sequence of SEQ ID NO: 43, and sequence A primer consisting of the nucleotide sequence of SEQ ID NO: 44, a primer consisting of the nucleotide sequence of SEQ ID NO: 45, a primer consisting of the nucleotide sequence of SEQ ID NO: 46, a primer consisting of the nucleotide sequence of SEQ ID NO: 47, a primer consisting of the nucleotide sequence of SEQ ID NO: 48, and sequence It includes a primer consisting of the nucleotide sequence of SEQ ID NO: 49, a primer consisting of the nucleotide sequence of SEQ ID NO: 50, a primer consisting of the nucleotide sequence of SEQ ID NO: 51, and a primer consisting of the nucleotide sequence of SEQ ID NO: 52.
delete The method of claim 9, wherein the multiple complex primer set is a primer consisting of a nucleotide sequence of SEQ ID NO: 53, a primer consisting of a nucleotide sequence of SEQ ID NO: 54, a primer consisting of a nucleotide sequence of SEQ ID NO: 55, and a nucleotide sequence of SEQ ID NO: 56. A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 57, a primer consisting of a nucleotide sequence of SEQ ID NO: 58, a primer consisting of a nucleotide sequence of SEQ ID NO: 59, a primer consisting of a nucleotide sequence of SEQ ID NO: 60, a primer consisting of a nucleotide sequence of SEQ ID NO: 61 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 62, a primer consisting of a nucleotide sequence of SEQ ID NO: 63, a primer consisting of a nucleotide sequence of SEQ ID NO: 64, a primer consisting of a nucleotide sequence of SEQ ID NO: 65, a primer consisting of a nucleotide sequence of SEQ ID NO: 66 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 67, a primer consisting of a nucleotide sequence of SEQ ID NO: 68, a primer consisting of a nucleotide sequence of SEQ ID NO: 69, a primer consisting of a nucleotide sequence of SEQ ID NO: 70, a primer consisting of a nucleotide sequence of SEQ ID NO: 71 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 72, a primer consisting of a nucleotide sequence of SEQ ID NO: 73, a primer consisting of a nucleotide sequence of SEQ ID NO: 74, a primer consisting of a nucleotide sequence of SEQ ID NO: 75, a primer consisting of a nucleotide sequence of SEQ ID NO: 76 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 77, a primer consisting of a nucleotide sequence of SEQ ID NO: 78, a primer consisting of a nucleotide sequence of SEQ ID NO: 79, a primer consisting of a nucleotide sequence of SEQ ID NO: 80, and a nucleotide sequence of SEQ ID NO: 81 The method of obtaining a full-length genome sequence, further comprising a primer.
The method of claim 9, wherein the concentration of the primers of the multiple complex primer sets is 0.1 to 1.0 pM, respectively.
The method of claim 9, wherein mPCR in the amplification step is performed under 30 to 50 cycle conditions.
The method of claim 9, wherein the product by mPCR in the sequence amplification step is 300 to 1000 bp in length.
The method of claim 9, wherein the method further comprises a sequence re-amplification step of performing mPCR using a multiple complex primer set using a product by mPCR as a sample after the sequence amplification step,
The multiple complex primer set includes a primer consisting of the nucleotide sequence of SEQ ID NO: 1, a primer consisting of the nucleotide sequence of SEQ ID NO: 2, a primer consisting of the nucleotide sequence of SEQ ID NO: 3, a primer consisting of the nucleotide sequence of SEQ ID NO: 4, and A primer consisting of a base sequence, a primer consisting of a base sequence of SEQ ID NO: 6, a primer consisting of a base sequence of SEQ ID NO: 7, a primer consisting of a base sequence of SEQ ID NO: 8, a primer consisting of a base sequence of SEQ ID NO: 9, A primer consisting of a base sequence, a primer consisting of a base sequence of SEQ ID NO: 11, a primer consisting of a base sequence of SEQ ID NO: 12, a primer consisting of a base sequence of SEQ ID NO: 13, a primer consisting of a base sequence of SEQ ID NO: 14, A primer consisting of a nucleotide sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 16, a primer consisting of a nucleotide sequence of SEQ ID NO: 17, a primer consisting of a nucleotide sequence of SEQ ID NO: 18, a primer consisting of the nucleotide sequence of SEQ ID NO: 19, A primer consisting of a base sequence, a primer consisting of a base sequence of SEQ ID NO: 21, a primer consisting of a base sequence of SEQ ID NO: 22, a primer consisting of a base sequence of SEQ ID NO: 23, a primer consisting of a base sequence of SEQ ID NO: 24, A primer consisting of a nucleotide sequence, a primer consisting of the nucleotide sequence of SEQ ID NO: 26, a primer consisting of the nucleotide sequence of SEQ ID NO: 27, a primer consisting of the nucleotide sequence of SEQ ID NO: 28, a primer consisting of the nucleotide sequence of SEQ ID NO: 29, A primer consisting of a nucleotide sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 31, a primer consisting of a nucleotide sequence of SEQ ID NO: 32, a primer consisting of a nucleotide sequence of SEQ ID NO: 33, a primer consisting of a nucleotide sequence of SEQ ID NO: 34, A primer consisting of a nucleotide sequence, a primer consisting of a nucleotide sequence of SEQ ID NO: 36, a primer consisting of a nucleotide sequence of SEQ ID NO: 37, a primer consisting of a nucleotide sequence of SEQ ID NO: 38, and a sequence number A primer consisting of the nucleotide sequence of SEQ ID NO: 39, a primer consisting of the nucleotide sequence of SEQ ID NO: 40, a primer consisting of the nucleotide sequence of SEQ ID NO: 41, a primer consisting of the nucleotide sequence of SEQ ID NO: 42, a primer consisting of the nucleotide sequence of SEQ ID NO: 43, and sequence A primer consisting of the nucleotide sequence of SEQ ID NO: 44, a primer consisting of the nucleotide sequence of SEQ ID NO: 45, a primer consisting of the nucleotide sequence of SEQ ID NO: 46, a primer consisting of the nucleotide sequence of SEQ ID NO: 47, a primer consisting of the nucleotide sequence of SEQ ID NO: 48, and sequence A method for obtaining a full-length genome sequence comprising a primer consisting of the nucleotide sequence of No. 49, a primer consisting of the nucleotide sequence of SEQ ID NO: 50, a primer consisting of the nucleotide sequence of SEQ ID NO: 51, and a primer consisting of the nucleotide sequence of SEQ ID NO: 52.
delete The method of claim 15, wherein the multiple complex primer set is a primer consisting of a nucleotide sequence of SEQ ID NO: 53, a primer consisting of a nucleotide sequence of SEQ ID NO: 54, a primer consisting of a nucleotide sequence of SEQ ID NO: 55, and a nucleotide sequence of SEQ ID NO: 56. A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 57, a primer consisting of a nucleotide sequence of SEQ ID NO: 58, a primer consisting of a nucleotide sequence of SEQ ID NO: 59, a primer consisting of a nucleotide sequence of SEQ ID NO: 60, a primer consisting of a nucleotide sequence of SEQ ID NO: 61 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 62, a primer consisting of a nucleotide sequence of SEQ ID NO: 63, a primer consisting of a nucleotide sequence of SEQ ID NO: 64, a primer consisting of a nucleotide sequence of SEQ ID NO: 65, a primer consisting of a nucleotide sequence of SEQ ID NO: 66 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 67, a primer consisting of a nucleotide sequence of SEQ ID NO: 68, a primer consisting of a nucleotide sequence of SEQ ID NO: 69, a primer consisting of a nucleotide sequence of SEQ ID NO: 70, a primer consisting of a nucleotide sequence of SEQ ID NO: 71 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 72, a primer consisting of a nucleotide sequence of SEQ ID NO: 73, a primer consisting of a nucleotide sequence of SEQ ID NO: 74, a primer consisting of a nucleotide sequence of SEQ ID NO: 75, a primer consisting of a nucleotide sequence of SEQ ID NO: 76 A primer, a primer consisting of a nucleotide sequence of SEQ ID NO: 77, a primer consisting of a nucleotide sequence of SEQ ID NO: 78, a primer consisting of a nucleotide sequence of SEQ ID NO: 79, a primer consisting of a nucleotide sequence of SEQ ID NO: 80, and a nucleotide sequence of SEQ ID NO: 81 The method of obtaining a full-length genome sequence, further comprising a primer.
The method of claim 15, wherein the mPCR of the re-amplification step is performed under 15 to 35 cycle conditions.

Images