KR102200041B1 - Composition for Nucleic Acid Purification and Extraction and Nucleic Acid Detection Kit and Method using the same - Google Patents

Abstract

The present invention relates to a nucleic acid purification and extraction composition and a nucleic acid detection kit and method using the same, since impurities contained in a biological sample can be effectively purified, and at the same time, nucleic acids such as infectious bacteria contained in a biological sample can be amplified, With a simple and simple process, it can be usefully used to detect nucleic acids such as infectious bacteria present in biological samples.

Description

Composition for nucleic acid purification and extraction, and nucleic acid detection kit and method using the same {Composition for Nucleic Acid Purification and Extraction and Nucleic Acid Detection Kit and Method using the same}

The present invention relates to a nucleic acid purification and extraction composition and a nucleic acid detection kit and method using the same.

Currently, most medical samples used for the analysis of infectious bacteria are blood such as whole blood. Blood is an important sample that provides not only infectious bacteria, but also a hundred health values. Blood samples are composed of many elements such as blood cells and plasma proteins, and among them, infectious bacteria are present in less than about one millionth or one billionth. Therefore, there is a limit to accurately detecting a small amount of target. Nucleic acid-based molecular diagnosis methods are excellent in sensitivity and accuracy, but there are difficulties in the blood because there are factors that interfere with the subsequent process of molecular diagnosis, such as PCR, such as hemoglobin, lactoferrin, and immunoglobulin.

There are two methods to detect infections in the blood. 1) Extracting nucleic acid from infectious bacteria in blood, and 2) Amplifying and confirming the nucleic acid. First, the most common method for extracting nucleic acids from infectious bacteria in the blood is to lyse cells and remove proteins and impurities using chaotropic salts. This method provides purified nucleic acids so as not to affect subsequent processes, but since a washing process is required to remove used salts, the process is complex and requires an experienced expert. Thereafter, the extracted nucleic acid is amplified by a polymerase to perform qualitative and quantitative analysis.

The above-described method is limited by location and time because it must be handled in a complex and elaborate manner. However, since blood is the most important sample representing most medical information, many field-type equipment has been developed with the development of miniaturized equipment and simplified processes to solve this problem. Among them, the direct buffer is a reagent that extracts nucleic acids from infectious bacteria in the blood using chemical substances and purifies impurities to some extent. Direct buffers are usually composed of reagents containing surfactants and ions, and are simple to use, but cannot completely remove impurities, so under conditions that require a sensitive amplification reaction environment (e.g., RNA amplification reaction , Isothermal amplification reaction, etc.) There is a limit to detecting nucleic acids.

Accordingly, the present inventor completed the present invention by carrying out a study to discover a method for detecting an infectious bacteria in a biological sample by a simple and simple process.

Korean Patent Publication No. 10-2009-0107927

One object of the present invention is to provide a composition for purifying and extracting nucleic acids, wherein the composition comprises a basic compound containing a hydroxyl group (-OH), and the purification is performed under heating conditions. Is to do.

Another object of the present invention is to provide a kit for detecting nucleic acids comprising a composition for purifying and extracting nucleic acids according to an embodiment of the present invention.

Another object of the present invention is the step of mixing a composition for purifying and extracting nucleic acids according to an embodiment of the present invention with a biological sample; Heating the biological sample at 70° C. for 5 to 10 minutes; And it provides a nucleic acid detection method comprising the step of detecting the nucleic acid in the biological sample.

One aspect of the present invention provides a composition for purifying and extracting nucleic acids, wherein the composition comprises a basic compound containing a hydroxyl group (-OH), and the purification is performed under heating conditions. .

Since the composition of the present invention can be used to remove impurities contained in a sample and to extract nucleic acids from infectious bacteria, the efficiency of amplifying nucleic acids of infectious bacteria present in the sample is excellent, and thus can be usefully used for detection of infectious bacteria.

The term "nucleic acid purification" used in the present invention refers to removing impurities (eg, red blood cells and white blood cells) contained in a sample (eg, whole blood) in addition to the nucleic acid to be amplified by precipitation or the like.

The term "nucleic acid extraction" used in the present invention refers to separating a nucleic acid to be amplified contained in a sample from an infectious organism to facilitate amplification, which may be caused by lysis of cells and removal of impurities such as proteins.

As used herein, the term "direct buffer" refers to a sample (eg, whole blood) by extracting a nucleic acid to be amplified (eg, RNA of an infectious bacteria) and purifying the impurities contained in the sample. It refers to a reagent that can be used to amplify nucleic acids without the washing step of

The "basic compound containing a hydroxyl group (-OH)" of the present invention may be an inorganic alkali hydroxide compound or an ammonium hydroxide compound. For example, it may be a hydroxide compound formed with alkali metals such as potassium (K) and sodium (Na), alkaline earth metals such as magnesium (Mg) and calcium (Ca), or ammonium (NH4 ⁺ ), preferably hydroxide It may be sodium (NaOH).

According to an embodiment of the present invention, the composition may further include polyethylene glycol (PEG) 200, PEG 8000, or a mixture of PEG 200 and PEG 8000.

The composition for purifying and extracting nucleic acids according to an embodiment of the present invention further includes PEG 200 and/or PEG 8000, thereby further improving the amplification efficiency of nucleic acids.

According to an embodiment of the present invention, according to an embodiment of the present invention, the composition comprises 0 to 1.25% by volume of PEG 200; 0-10% by volume of PEG 8000; And 10 to 80mM of NaOH may be included.

0 to 1.25 vol% PEG 200; 0-10% by volume of PEG 8000; And the nucleic acid recovery rate of the direct buffer having a composition ratio of 10 to 80 mM NaOH is excellent, in particular, 1.25 vol% of PEG 200; 10% by volume PEG 8000; And since the nucleic acid recovery rate of the direct buffer having a composition ratio of 50 mM NaOH is the best, it can be usefully used in a kit for rapid and simple detection of infectious bacteria from biological samples.

According to an embodiment of the present invention, the nucleic acid may be included in a biological sample.

According to an embodiment of the present invention, the biological sample may be any one selected from the group consisting of whole blood, plasma, and feces.

Since the nucleic acid purification and extraction composition of the present invention can remove impurities contained in a biological sample such as whole blood without a separate washing process, by using the nucleic acid purification and extraction composition of the present invention, even a non-expert can use a simple process from a biological sample. Infectious bacteria can be detected.

According to an embodiment of the present invention, the heating may be performed at 40 to 70° C. for 1 to 10 minutes.

When only the nucleic acid purification and extraction composition according to an embodiment of the present invention is used, or when only heating without using the nucleic acid purification and extraction composition according to an embodiment of the present invention, purification is not sufficiently performed, The amplification efficiency can be reduced. On the other hand, after mixing the biological sample with the composition for nucleic acid purification and extraction according to an embodiment of the present invention, by heating at 40 to 70°C for 1 to 10 minutes, the purification efficiency of impurities contained in the biological sample can be significantly increased. . If heated in less than 1 minute, purification of impurities is not sufficient. On the other hand, even if it is heated for more than 10 minutes, since the effect on the amplification efficiency is insignificant, the heating efficiency is low.

Another aspect of the present invention provides a nucleic acid detection kit comprising a nucleic acid purification and extraction composition according to an embodiment of the present invention.

The nucleic acid detection kit of the present invention may further include a primer set and reagents generally used in amplification reactions of nucleic acids in the art, in addition to the composition for purifying and extracting nucleic acids according to an embodiment of the present invention.

According to an embodiment of the present invention, the kit may include a bead-beating part.

As used herein, the term "bead-beating" is a method of crushing a solid material in a sample with a physical force, and may be performed by shaking a sample solution containing beads by hand or using an automatic vibrator, but an automatic vibrator It is preferred that this is performed using. The material of the "bead" is not limited, but may preferably be a micro glass bead.

The kit of the present invention may be manufactured in the form of a microfluidic chip, and specifically, may be composed of three parts: a microfluidic chamber part, a sample preparation chamber part, and an amplification and detection chamber part. Meanwhile, the microfluidic chamber portion may include a sample input portion filled with a sample and a microfluidic channel through which the processed sample and the direct buffer are transferred from the sample preparation chamber to the amplification and detection chamber. The sample preparation chamber includes a direct buffer of the present invention, a bead, and a magnetic bar, and corresponds to a bead-beating part in which bead-beating is performed. The amplification and detection chamber portion contains reagents used for nucleic acid amplification.

In addition, when a biological sample is put in the kit of the present invention, the motor part of the device is operated to rotate the bead, and thus the nucleic acid extraction process may proceed. At this time, after the direct buffer and the sample are mixed, the heater of the kit is After the operation is performed to purify impurities, and after the sample is moved to the amplification and detection chamber part, the nucleic acid can be amplified. The nucleic acid amplified in this way can be detected using a fluorescent device or the like.

Mixing the composition for purifying and extracting nucleic acids according to an embodiment of the present invention with a biological sample; Heating the biological sample at 40 to 70° C. for 1 to 10 minutes; And it provides a nucleic acid detection method comprising the step of detecting the nucleic acid in the biological sample.

According to the method of the present invention, since the pretreatment of the biological sample to the amplification of the nucleic acid of the infectious bacteria can be performed at one time, infectious bacteria present in the biological sample can be detected quickly and simply.

According to one embodiment of the present invention, the nucleic acid may be a nucleic acid derived from an infectious bacteria.

According to one embodiment of the present invention, the infectious bacteria may be bacteria or viruses.

According to an embodiment of the present invention, the virus may be an adenovirus, dengue virus, or influenza A virus (H1N1).

According to the method of the present invention, since it is possible to easily and quickly detect 10 ² pfu/100 μl level of adenovirus, 10 ³ pfu/ml level of dengue virus, and influenza A virus (H1N1), the infectious bacteria can be detected in the field with high sensitivity. Detection is possible.

According to an embodiment of the present invention, the bacteria may be Escherichia coli , Staphylococcus aureus , or Salmonella typhimurium .

According to the method of the present invention, since it is possible to easily and quickly detect E. coli at a level of 10 ³ pfu/ml and Salmonella at a level of 10 ⁵ cfu/ml, it is possible to detect infectious bacteria with high sensitivity even in the field.

According to one embodiment of the present invention, the dengue virus may be one or more dengue virus serotypes selected from the group consisting of dengue virus serotype 1, dengue virus serotype 2, dengue virus serotype 3, and dengue virus serotype 4. .

According to the method of the present invention, it is possible to distinguish between serotypes 1, 2, 3 and 4 of dengue virus.

According to one embodiment of the present invention, the detection may be a polymerase chain reaction (PCR) or loop-mediated isothermal amplification (LAMP).

The step of detecting the nucleic acid of the present invention may be performed by a PCR method. In this case, a nucleic acid amplification reaction may be performed using a primer set for detection of a nucleic acid, and reagents commonly used in PCR reactions in the art, for example, dNTP and polymerases such as Taq and Q5.

The step of detecting the nucleic acid of the present invention may be performed by the LAMP method. In this case, a set of ring-mediated isothermal amplification primers for detection of nucleic acids, and reagents commonly used in LAMP reactions in the art, for example, Isothermal Amplification Buffer II, MgSO4, dNTP Mix, Bst polymerase, and AMV Reverse Transcriptase, etc. Nucleic acid amplification reaction can be carried out using.

According to the nucleic acid purification and extraction composition and the nucleic acid detection kit and method using the same, it is possible to effectively purify impurities contained in a biological sample and at the same time amplify nucleic acids such as infectious bacteria contained in a biological sample, so a simple and simple process As a result, it can be usefully used for detecting nucleic acids such as infectious bacteria present in biological samples.

1 is a diagram showing a microfluidic chip for detection of dengue virus from whole blood.
2 is a schematic diagram showing the detection process of viral RNA from whole blood.
3 is a photograph showing a process of detecting a dengue virus using a microfluidic chip according to an embodiment of the present invention.
4 is a graph showing the effect of inhibiting PCR according to the concentration of direct buffer constituents.
5 is a graph showing the results of confirming the main effects of direct buffer constituents on PCR efficiency in direct sample PCR (a) and diluted sample PCR (b).
6 is a graph showing the result of confirming the combination effect of two substances among the substances constituting the direct buffer on PCR efficiency in direct sample PCR.
7 is a graph showing the result of confirming the combination effect between two substances among the substances constituting the direct buffer on PCR efficiency in diluted sample PCR.
8 is a graph (a) and a photograph (b) showing the effect of each concentration of PEG 8000 on DNA that can be used for PCR in whole blood samples.
9 is a graph comparing the adenovirus detection performance of a direct buffer according to an embodiment of the present invention compared to commercial products Qiagen and direct buffer (Nex).
10 is a graph showing dengue virus lysis efficiency and RNA stability according to bead size (a), bead amount (b), and bead-beating time (c).
11 is a graph showing the amplification efficiency of dengue virus RNA according to heating time of whole blood and/or direct buffer.
12 is a graph showing gel electrophoresis and fluorescence intensity of LAMP products of dengue virus serotype 1 (a), dengue virus serotype 4 (b), and dengue virus serotype 3 and 4 (c).
13 is a graph comparing the detection performance of dengue virus serotype 3 of a microfluidic chip according to an embodiment of the present invention compared to commercial products Qiagen and direct buffer (Nex).
14 is an amplification curve for Salmonella (a), adenovirus (b), and influenza A virus (H1N1) (c) contained in whole blood.
15 is an amplification curve for Escherichia coli (a), adenovirus (b) and influenza A virus (H1N1) (c) contained in the stool.

Hereinafter, the present invention will be described in more detail through one or more examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1. Direct buffer optimal composition ratio and virus detection efficiency analysis method

1-1. Virus culture and whole blood samples

10% Fetal Bovine Serum (FBS) (Gibco, Grand Island, NY, USA) with human adenovirus 5 and HEK 293 cells provided by Daewoo Seol (College of Pharmacy, Chung-Ang University, Korea) It was cultured using DMEM (Dulbecco's Modified Eagle's Medium) containing. After infecting HEK 293 cells with virus for 2 days, virus was obtained by freeze-thaw cycling. Dengue virus was provided at Korea University Guro Hospital, and influenza A virus (H1N1) was purchased at BioNano Health-Guard Research Center. In order to confirm the stability of the RNA, the spiked RNA was extracted using the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany).

Whole blood was collected from 5 healthy volunteers (3 males and 2 females). The collected blood was put in a tube (Vacutainer tube k2 EDTA, Becton Dickinson and Company, NJ, USA), stored at 4°C, and used within one week.

1-2. Direct sample PCR and diluted sample PCR

Genomic DNA of Salmonella typhimurium (ATCC 14028) cultured with 3% TBS (Tryptic soy broth) (Becton, France) in a shaking incubator (Biofree, Seoul, Korea) at 37° C. and 150 rpm was spiked into whole blood. Whole blood and direct buffer were mixed in a volume ratio of 1:2. Direct buffers include surfactants (SDS (sodium dodecyl sulfate) and Triton X-100), PEG (polyethylene glycol) 200, PEG 8000, chaotropic salts guanidiium thiocyanate (GuSCN), The cosmotropic salt was composed of sodium sulfate (Na ₂ SO ₄ ), NaOH and/or MgCl ₂ in various composition ratios.

Direct sample PCR used spiked whole blood and direct buffer mixtures directly as samples. Diluted sample PCR was used by diluting the whole blood sample 1000 times with TE buffer. The primers used are shown in Table 1. Real time PCR was performed using the LightCycler® 480 System (Roche, Basel, Switzerland) to quantify the recovery and purification rate of DNA from the blood supernatant.

primer Primer sequence
(5'→3') Sequence number Salmonella typhimurium forward CTCACGGGACGCGAAAAGACGA SEQ ID NO: 1 reverse CGACGCCGGATTCCCCTACCAG SEQ ID NO: 2

1-3. PCR efficiency analysis and comparison

The amount of adenovirus DNA of Example 1-1 extracted using the QIAamp DNA mini kit was compared with a positive control (PC) to confirm dissolution efficiency. In addition, as a control, a commercially available direct buffer, Nexamp ^TM Direct PCR Buffer Kit (Genes Laboratories, Gyeongido, Korea) was used. Microbeads (diameter 50 to 70 μm, DAIHAN Scientific, Kangwon-do, Korea) were washed with a piranha solution consisting of 35% hydrogen peroxide and 98% sulfuric acid for 30 minutes. Adenovirus was dissolved by putting 0.4 g of microbeads and direct buffer into the sample. Whole blood (200 µl) spiked with adenovirus was mixed with a double volume of direct buffer (400 µl) and micro beads, followed by bead-beating. After bead-beating at a frequency of 30 Hz for 1 minute, it was allowed to stand at room temperature for 4 minutes, and real-time PCR was performed directly using the sample.

1-4. Analysis of major effects and combination effects of direct buffer components

The Minitab ^™ program was used to analyze the optimal ratio for the constituents of the direct buffer. PEG 200, PEG 8000, GuSCN, Na ₂ SO ₄ and MgCl ₂ were purchased from Sigma-Aldrich (St. Louis, Mo, USA), and NaOH was purchased from Junsei-Chemical (Tokyo, Japan). One-half factorial experiment was designed with 2 repetitions and 4 blocks. Experiments were performed sequentially by the order of execution of a design of experiment (DOE).

1-5. Reverse transcription-PCR and LAMP

Using one step RT-PCR set (Bioassay, South Korea) and SuperScript® II Reverse Transcriptase (Invitrogen/Thermo Fisher Scientific, MA, USA)/TB Green Premix Ex Taq II (Takara Bio Inc., Shiga, Japan), respectively. One-step and two-step reverse transcription (RT)-PCR (LightCycler® 480 II, Roche, Basel, Switzerland) was performed.

Loop-mediated isothermal amplification (LAMP) is a mixture of 23 µl of each type master mixture of Mmiso®Dengue Detection Kit (Real-Time) (Mmonitor, South Korea) and 2 µl of RNA samples prepared at 58°C. After running for a minute, fluorescence was read from the FAM channel and performed.

1-6. Virus lysis efficiency and RNA stability analysis

To investigate the viral lysis efficiency according to the bead-beating conditions in direct buffer (1.25% (v/v) PEG 200, 10% (v/v) PEG 8000 and 50 mM NaOH), dengue instead of whole blood Water to which virus was added was used and measured by RT-PCR. Pure RNA extracted from H1N1 was also added to direct buffer to investigate RNA stability during lysis preparation. Then, the quantitative PCR results for whole blood samples containing pure dengue virus RNA were compared with the quantitative PCR results for water containing pure dengue virus RNA.

1-7. Microfluidic chip construction and dengue virus detection

The microfluidic chip is composed of three parts: a microfluidic chamber part, a sample preparation chamber part, and a LAMP chamber part (FIG. 1). The microfluidic chamber part is composed of a sample input part filled with a whole blood sample and a microfluidic channel through which the processed sample and the direct buffer are transferred from the sample preparation chamber to the LAMP chamber. The sample preparation chamber contains 0.8 g of glass microbeads (50 to 70 μm) and magnetic bars (8 mm and 3 mm) in 0.4 ml of direct buffer. There are 6 commercial standard microtubes containing 23 μl of the master mixture in the LAMP chamber section. In order to perform the microbead-beating process for dissolving the dengue virus in the microfluidic chip, four baffles were used in the sample preparation chamber to improve the turbulence effect to increase the bead-beating efficiency.

The detection process of the microfluidic chip is performed by stirring (dissolving), heating (blocking and LAMP), and fluorescence detection (Fig. 2).

Specifically, when whole blood is added to the chip, the motor part of the device is operated to rotate the bead, and thus the nucleic acid extraction process proceeds. The stirring process consists of dissolving the virus by agitation of a magnet bar that induces bead-beating of the virus in the whole blood for 90 seconds after putting the whole blood into the sample preparation chamber and mixing it with the direct buffer. The heating process is performed by cooling to room temperature after impurities are purified as the heater is operated and heated at 70° C. for 5 to 10 minutes.

Thereafter, the pretreated whole blood samples were 5 microtube chambers (dengue virus serotypes 1, 2, 3 and 4 in chambers 1, 2, 3 and 4, and positive control in chamber 5, negative control in chamber 6 Moving to (negative control: NC) and meeting with the LAMP reagent, RNA is amplified, and the amplified RNA is detected by fluorescence (Fig. 3).

Example 2. Identification of major effects of direct buffer constituents on PCR efficiency

In order to confirm the effect of the direct buffer constituents on the PCR efficiency, each concentration of Triton X-100, SDS, PEG 200, PEG 8000, Na ₂ SO ₄ , GuSCN, NaOH and MgCl ₂ by performing Example 1-3 PCR efficiency according to was analyzed.

As a result, as for the surfactant, it was confirmed that Triton X-100 did not inhibit the PCR reaction to a concentration of 1%, while SDS acts as a strong inhibitor of the PCR reaction at a concentration of 0.01% or more. This is because SDS exhibits a strong anionic property, so it is adsorbed on the surface of the polymerase used in PCR to inhibit the enzyme reaction (FIG. 4A).

In addition, PEG is known to have very different properties depending on the length, and it was confirmed that the PCR inhibition result also varies according to the length. Short-length PEG 200 strongly inhibited the PCR reaction compared to long-length PEG 8000, and although the reaction was inhibited at high concentration, it was confirmed that PEG 8000 exhibited 10% PCR efficiency even in 100% PEG 8000 samples (Fig. 4b).

In general, chaotropic salts, which increase the solubility of proteins by changing the three-dimensional structure of proteins, are known as powerful inhibitors of PCR, and kosmotropic salts promote protein aggregation to lower the solubility. It is known. However, it was confirmed that sodium sulfate (Na ₂ SO ₄ ), which is a cosmotropic salt, exhibits higher PCR inhibitory ability than GuSCN, which is a chaotropic salt (FIG. 4C).

On the other hand, NaOH is closely related to pH. 50mM NaOH has a pH of about 13, and when it is included in the PCR buffer, the pH is 9 to 10, so by increasing the concentration of the PCR buffer, the inhibitory effect of the PCR reaction can be eliminated. In the case of MgCl ₂ , inhibition of the polymerase reaction is due to the properties of Mg ²⁺ . However, the effect of inhibiting PCR by Mg ²⁺ can also be solved by changing the composition of the PCR buffer (FIG. 4D).

Through the above results, it was confirmed that the appropriate concentration range of each chemical substance for confirming the main effect and combination effect on the DNA recovery rate and PCR efficiency for whole blood is shown in Table 2.

division Allowable concentration range Triton X-100 0 to 1.0% SDS 0 to 0.01% PEG 200 0 to 1.25% PEG 8000 0 to 20% GuSCN 0-100mM Na ₂ SO ₄ 0-50mM NaOH 0-50mM MgCl ₂ 0-10mM

Example 3. Identification of major effects of direct buffer constituents on PCR efficiency

When developing direct buffers, the most important goal is to obtain free nucleic acids. The presence of free nucleic acids can be confirmed by two methods of measurement. One is to measure the efficiency of direct sample PCR, and the other is to remove the effect of the inhibitor and measure the PCR efficiency (diluted sample PCR). The amount of nucleic acid and the amount of impurities contained in the PCR sample can be derived by comparing the direct sample PCR result (depending on both the amount of nucleic acid and impurity) and the diluted sample PCR result (depending on the amount of nucleic acid).

Therefore, in order to confirm the main effect of the constituents on the PCR efficacy, ANOVA-based DOE according to Example 1-4 (FIG. 5A) and diluted sample PCR (FIG. 5B) of Example 1-2 ( Design of Experiment) was performed.

As a result, it was confirmed that PEG 200 increased the direct sample PCR efficiency (decrease of Ct), but did not affect the diluted sample PCR efficiency. Through these results, it was confirmed that PEG 200 did not affect the nucleic acids involved in PCR, and the effect of reducing PCR inhibition of whole blood was confirmed, which is a variety of ions (such as heme) and proteins (such as immunoglobulins) of PEG 200 on nucleic acids. It was confirmed that this was due to the adsorption preventing effect.

In addition, PCR efficiency increased when PEG 8000 was present in the buffer, but PCR efficiency decreased when the amount of nucleic acid decreased. According to the diluted sample PCR results, it was confirmed that the amount of nucleic acid in the solution decreased, but the impurities of whole blood were further reduced or the PCR inhibition of whole blood was reduced.

On the other hand, had Mg ²⁺ did not significantly affect the efficiency of PCR, it was confirmed that due to impurities or too low concentration of Mg ²⁺ is used to concentrate the nucleic acids. Likewise, it was confirmed that the concentration of the chaotropic salt GuSCN and the cosmotropic salt Na ₂ SO ₄ did not significantly affect the PCR efficiency. However, in the case of GuSCN, despite the use of a concentration (50 mM) that does not affect PCR, it was confirmed that the PCR efficiency decreased when GuSCN was present. This suggests that the chaotropic salt, GuSCN, increases the PCR inhibitory ability of whole blood (diluted sample PCR results do not decrease the amount of nucleic acids involved in PCR).

The PCR efficiency decreased with the addition of the surfactant SDS or Triton-X, which was confirmed not because the amount of nucleic acid decreased, but because the surfactant and all substances in whole blood reacted or bound as in the case of GuSCN.

In terms of pH, NaOH has been shown to play a positive role in PCR efficiency. Specifically, according to the direct sample PCR results, the effect of increasing the PCR efficiency of NaOH was hardly observed, but according to the diluted sample PCR results, the PCR efficiency was greatly increased. Through this result, although NaOH does not remove impurities from whole blood, it increases the amount of nucleic acids that can participate in the PCR reaction, which increases the pH of the sample and increases the pH of the sample by adding NaOH to the buffer. It was confirmed that this is because the biological material exhibits a high negative charge and interferes with adsorption between various biological materials. In addition, it was confirmed that the PCR reaction of whole blood was inhibited by the presence of inhibitors such as heme or immunoglobulin as well as binding to nucleic acids. Therefore, it was confirmed that NaOH is an essential component for direct buffer composition.

Example 4. Confirmation of Combination Effect of Direct Buffer Constituent Materials on PCR Efficiency

In order to confirm the interaction between the two substances among the direct buffer constituents, for the direct sample PCR (Fig. 6) and the diluted sample PCR (Fig. 7) of Example 1-2, ANOVA-based DOE ( Design of Experiment) was performed.

As a result, in most cases, there is no difference from the main effect, but it was confirmed that the properties of some substances such as PEG 8000, surfactant, and GuSCN change depending on the substance to be bound. Specifically, in the absence of PEG 200 in direct sample PCR, the effect of NaOH can be neglected, but according to the results of diluted sample PCR, it was confirmed that the effect of NaOH was very high regardless of the presence of PEG 200. This suggests that PEG 200 has an effect of purifying impurities. The amount of nucleic acid that can be involved in PCR is increased by NaOH (diluted sample PCR result), but the effect is very low in the absence of PEG 200 (direct sample PCR result). In other words, PEG 200 means that it is one of the core materials of direct buffer such as NaOH.

In addition, PEG 8000 was shown to have a positive effect on direct sample PCR. However, the pH change of the PEG 8000 characteristic is quite opposite to the results of direct sample PCR and diluted sample PCR. Specifically, according to the PCR results of samples diluted with PEG 8000 and NaOH, it was found that the PCR efficiency of diluted samples with NaOH increased in a concentration-dependent manner with PEG 8000. On the other hand, according to the direct sample PCR results, when PEG 8000 is present, it was found that NaOH negatively affects PCR, and in the presence of PEG 8000, the efficiency of diluted sample PCR was lowered. Accordingly, it was confirmed that PEG 8000 exhibits an effect of purifying impurities, but also has an effect of reducing the concentration of nucleic acids in the solution (nucleic acid precipitation). In addition, the standardized PCR results show that the amount of nucleic acid remaining in the solution decreases as the concentration and reaction time of PEG 8000 increases. Therefore, PEG 8000 precipitates or coagulates nucleic acids and impurities that affect PCR. And, when the concentration of PEG 8000 was 10%, it was confirmed that the optimal effect appeared (Fig. 8).

Through these results, it was confirmed that the nucleic acid recovery rate of the direct buffer having a composition ratio of 1.25% (v/v) PEG 200, 10% (v/v) PEG 8000 and 50 mM NaOH was the best.

Example 5. Viral nucleic acid detection in whole blood

In order to confirm whether it is possible to detect the nucleic acid of the virus in whole blood, the direct buffer (1.25% (v/v) PEG 200, 10% (v/v) PEG 8000 and 50 mM NaOH) having the optimal composition ratio identified in Example 4 Was used in whole blood spiked with adenovirus, and adenovirus was detected according to Example 1-3.

As a result, it was found that the PCR efficiency and linear range based on the Qiagen kit were superior to those of the direct buffer of the present invention, but this result was confirmed to be due to the impurity removal process of the Qiagen kit. Meanwhile, the direct buffer of the present invention was found to be capable of detecting viruses at a concentration of 10 ² pfu/100 μl of whole blood, and it was confirmed that the PCR efficiency and linear range were superior to those of commercially available Nexamp ^TM Direct PCR Buffer (FIG. 9 ).

Example 6. Confirmation of RNA extraction efficiency and stability according to bead-beating conditions

In order to confirm the optimal conditions for the size, amount and stirring time of the micro glass beads for RNA extraction efficiency and stability, the RNA extraction efficiency and stability for dengue virus serotype 3 were determined by the size of the beads (20, 30, 50㎛). , Amount (0.4, 0.6, 0.8g) and bead-beating time (30, 60, 90 seconds). The dissolution efficiency was defined as the amount (%) of RNA extracted from dengue virus serotype 3 according to the direct buffer method (Example 1-6) using bead-beating compared to the pure water method using the QIAamp viral RNA mini Kit. . RNA stability was defined as the amount (%) of RNA amplified by RT-PCR after bead-beating compared to before bead-beating.

As a result of confirming RNA stability under physical stress according to the bead-beating process, it was found that the larger beads more effectively dissolve the dengue virus (FIG. 10A). In addition, it was found that the dissolution efficiency increased as the amount of beads (FIG. 10b) and stirring time (FIG. 10c) increased. RNA extraction efficiency was found to be 90% or more when using 0.8 g of 50 μm glass beads and stirring at 1,500 rpm for 90 seconds (25 Hz). In addition, more than 80% of RNA was found to be stable under severe physical stress.

Example 7. Checking the effect of increasing RNA amplification efficiency by heating whole blood and direct buffer

After extracting RNA from the dengue virus, RNA in the sample was amplified by the method of Example 1-5. Whole blood was used by heating whole blood alone or a mixture of whole blood and direct buffer at 70°C. The amplification efficiency (%) was defined as (Ct of a specific RNA present in whole blood-Ct (NC) of a negative control)/(Ct of a specific RNA present in water-Ct of NC), and Ct (threshold cycle) ) Is shown according to the RT-PCR results.

As a result, when heating only whole blood, the RT-PCR efficiency was confirmed to be less than 50%. However, when heating the whole blood and direct buffer mixture, it was found that the RT-PCR amplification efficiency was improved up to 80% (FIG. 11). It was confirmed that this is because PEG 200 and NaOH, which provide high pH, prevent non-specific binding between enzymes such as polymerase and amplification inhibitors such as proteins. Since PEG 200 and NaOH inhibit the amplification reaction at high concentration, heating at 70° C. for 5 to 10 minutes is more preferable than increasing the concentration of PEG 200 or NaOH in order to increase the impurity purification efficiency in RNA amplification. Was confirmed.

Example 8. Confirmation of dengue virus serotype discrimination performance of microfluidic chips

In order to confirm whether the serotype of the dengue virus could be distinguished, 200 µl of whole blood samples to which various serotypes of dengue virus (10 ⁴ pfu) were added were analyzed using the microfluidic chip of Example 1-7.

As a result, as shown in Figs. 12a to 12c, it was confirmed that dengue virus serotypes 1 to 4 were effectively distinguished.

Example 9. Checking the sensitivity of the microfluidic chip for detection of dengue virus

Whether the microfluidic chip of Example 1-7 exhibits superior detection efficiency compared to a commercial direct buffer (NEXamp ^TM direct buffer kit, South Korea) and a normal guanidine-based column kit (QIAamp DNA mini Kit with whole blood protocol, Hilden, Germany) To confirm, the detection rates of dengue virus serotype 3 at concentrations of 10 ³ , 10 ⁴ and 10 ⁵ pfu/ml were compared.

As a result, when using the microfluidic chip of Examples 1-7, all dengue viruses were detected. On the other hand, for each 10 ³ , 10 ⁴ and 10 ⁵ pfu/ml sample, the NEXamp kit showed success rates of 0, 20 and 60%, respectively, and the Qiagen kit showed success rates of 60, 80 and 100%, respectively. (Fig. 13). That is, it was confirmed that the microfluidic chip of Examples 1-7 had better dengue virus detection sensitivity compared to the commercial direct buffer kit (NEXamp) and the normal DNA purification kit (Qiagen).

Example 10. Confirmation of multiple detection effects of infectious bacteria contained in biological samples

10-1. Confirmation of multiple detection effects of infectious bacteria contained in whole blood

Salmonella typhimurium 10 ⁵ cfu/ml, DNA virus adenovirus 10 ⁵ pfu/ml and RNA virus Influenza A virus (H1N1) 10 ³ pfu/ml were spiked and mixed with 200 µl of distilled water And, 400 μl of direct buffer (1.25% (v/v) PEG 200, 10% (v/v) PEG 8000 and 50 mM NaOH) having the optimum composition ratio identified in Example 4 was mixed and bead-beating was performed. After heating at 70° C. for 5 minutes, a PCR reaction was performed.

As a result, by confirming the amplification curves for each of Salmonella (Fig. 14a), adenovirus (Fig. 14b), and influenza A virus (H1N1) (Fig. 14c), the nucleic acid extraction and purification process of the direct buffer of the present invention operates normally. Confirmed that.

10-2. Confirmation of multiple detection effects of infectious bacteria contained in stool

E. coli ( Escherichia coli ) 10 ³ cfu/ml, DNA virus adenovirus 10 ⁵ pfu/ml and RNA virus influenza A virus (H1N1) 10 ⁴ pfu/ml were spiked and mixed with 200 µl of distilled water, Direct buffer (1.25% (v/v) PEG 200, 10% (v/v) PEG 8000 and 50 mM NaOH) 400 μl of the direct buffer (1.25% (v/v) PEG 200, 10% (v/v) PEG 8000 and 50 mM NaOH) confirmed in Example 4 were mixed and bead-beating was performed, and then 70 After heating at °C for 5 minutes, PCR reaction was performed.

As a result, by checking the amplification curves for each of E. coli (Fig. 15a), adenovirus (Fig. 15b) and influenza A virus (H1N1) (Fig. 15c), the nucleic acid extraction and purification process of the direct buffer of the present invention operates normally. Was confirmed.

So far, the present invention has been looked at around the examples. Those of ordinary skill in the art to which the present invention pertains will be able to understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative point of view rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> CHUNG ANG University industry Academic Cooperation Foundation <120> Composition for Nucleic Acid Purification and Extraction and Nucleic Acid Detection Kit and Method using the same <130> PN180416 <160> 2 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Salmonella typhimurium_forward <400> 1 ctcacgggac gcgaaaagac ga 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Salmonella typhimurium_reverse <400> 2 cgacgccgga ttcccctacc ag 22

Claims (15)

In the composition for purification and extraction of nucleic acids,
The composition is
0.1 to 1.25% by volume of polyethylene glycol (PEG) 200;
0.1-10% by volume of PEG 8000; And
10 to 80 mM NaOH
Including,
The purification is made under heating conditions at 40 to 70° C. for 1 to 10 minutes,
The nucleic acid is contained in a biological sample,
The biological sample is any one selected from the group consisting of whole blood, plasma, and feces.
Composition for purification and extraction of nucleic acids.
delete delete delete delete delete A kit for detecting nucleic acids comprising the composition of claim 1.
The kit for detecting a nucleic acid according to claim 7, wherein the kit comprises a bead-beating part.
Mixing the composition of claim 1 with a biological sample;
Heating the biological sample at 40 to 70° C. for 1 to 10 minutes; And
Amplifying a nucleic acid in a biological sample
Nucleic acid amplification method comprising a.
The method of claim 9, wherein the nucleic acid is a nucleic acid derived from an infectious bacteria.
The method of claim 10, wherein the infectious bacteria are bacteria or viruses.
The method of claim 11, wherein the virus is an adenovirus, dengue virus, or influenza A virus (H1N1).
The method of claim 11, wherein the bacteria are Escherichia coli , Staphylococcus aureus , or Salmonella typhimurium .
The method of claim 12, wherein the dengue virus is at least one dengue virus serotype selected from the group consisting of dengue virus serotype 1, dengue virus serotype 2, dengue virus serotype 3, and dengue virus serotype 4. .
The nucleic acid amplification method according to claim 9, wherein the amplification is a polymerase chain reaction (PCR) or loop-mediated isothermal amplification (LAMP).

Images