KR102194283B1 - Recombinant vector for promoting plant length growth and volumetric growth and uses thereof - Google Patents

Abstract

The present invention is a recombinant vector for transformation to promote length and volume growth of plants; A composition for promoting length and volume growth of plants comprising the vector; Plants transformed with the vector; Transformed seeds of the plant; And a method of promoting volume growth of ginseng roots using the vector. According to the present invention, when a gibberellin receptor gene (PgGID1A-D) derived from ginseng is introduced into a mutant plant having a dwarf phenotype, it is confirmed that the shoot length and the silk length of the plant recover close to the wild type. As a result, the use of the gene can effectively enhance the length and volume growth of plants. In particular, the gene and the vector containing the same can be usefully used to promote the volume growth of ginseng roots.

Description

Recombinant vector for promoting plant length growth and volumetric growth and uses thereof

The present invention is a recombinant vector for transformation to promote length and volume growth of plants; A composition for promoting length and volume growth of plants comprising the vector; Plants transformed with the vector; Transformed seeds of the plant; And a method of promoting volume growth of ginseng roots using the vector.

The vascular bundle of a plant consists of three layers. The outer phloem cells, the cambium cells, which are stem cells continuously dividing in the middle, and the inner water tube cells, differentiate from the cambium cells in a direction and form each layer. These cell layers gradually thicken through secondary growth and allow plants to grow in volume. This secondary growth occurs due to the differentiation of the cambium, and the differentiation of the cambium has a close correlation with the volume growth of plants.

Plant hormones are important regulators that regulate the growth and metabolism of various plants to proceed normally. Among them, the hormone gibberellin has a long history of research and has been used in agricultural fields for a long time. Recently, it has been found that various stresses and gibererin signaling are related, and the relationship between cell elongation and microtubule formation is being studied. In particular, as research on promoting cell division is underway, it is expected that it can be associated with increase in yield through volume growth of plants. Therefore, functional studies of related genes are necessary.

The present inventors first identified the ginseng gibberellin receptor gene, and confirmed that the plant transformed with the recombinant vector into which the ginseng gibberellin receptor gene was introduced not only promotes length growth but also promotes volume growth through cell division of the cambium. Completed.

Korean Patent Registration No. 10-1153463

Accordingly, it is an object of the present invention to provide a recombinant vector for transformation that can effectively promote length and volume growth of plants.

Another object of the present invention is to provide a composition for promoting length and volume growth of plants comprising the recombinant vector for transformation.

Another object of the present invention is to provide a plant transformed with the recombinant vector for transformation.

Another object of the present invention is to provide a transformed seed of the plant.

Another object of the present invention is to provide a method for effectively promoting the volume growth of ginseng roots using the recombinant vector for transformation.

In order to achieve the object of the present invention as described above, the present invention provides a recombinant vector for transformation comprising at least one gene of the genes represented by SEQ ID NOs: 1 to 4, promoting length and volume growth of plants. do.

In addition, the present invention provides a composition for promoting length and volume growth of plants comprising the recombinant vector for transformation.

In addition, the present invention provides a transgenic plant transformed with the recombinant vector for transformation and promoted length and volume growth.

In one embodiment of the present invention, the plant may be a monocotyledonous or dicotyledonous plant.

In one embodiment of the present invention, the dicotyledonous plant may be ginseng.

In addition, the present invention provides a transformed seed of the plant.

In addition, the present invention provides a method for promoting volume growth of ginseng roots, comprising the step of overexpressing one or more genes of the genes represented by SEQ ID NOs: 1 to 4 by transforming the recombinant vector for transformation into ginseng cells. to provide.

According to the present invention, when a gibberellin receptor gene (PgGID1A-D) derived from ginseng is introduced into a mutant plant having a dwarf phenotype, it is confirmed that the shoot length and the silk length of the plant recover close to the wild type. As a result, the use of the gene can effectively enhance the length and volume growth of plants. In particular, the gene and the vector containing the same can be usefully used to promote the volume growth of ginseng roots.

Figure 1a is a phylogenetic tree analysis result of the ginseng gibberellin receptor protein (PgGID1A-D) of the present invention, which is a schematic diagram confirming the relationship between the giverelin receptor genes (Pg, Panax ginseng; At, Arabidopsis thaliana; Os, Oryza sativa).
1B is a topology diagram based on a two-dimensional structure predicted through a gibberellin receptor protein of rice.
Figure 1c is to determine the biological functionality of the ginseng gibberellin receptor protein (PgGID1A-D) of the present invention, together with ginseng gibberellin receptor protein (PgGID1A-D), a homologous protein sequence analysis of Arabidopsis and rice plants to confirm homology It is the result.
Figure 2a shows the pGFP vector map used in the experiment of the present invention.
Figure 2b is a result of confirming the intracellular location of the ginseng gibberellin receptor protein (PgGID1A-D) of the present invention in the Arabidopsis protoplast (separated from the leaves of a 30-day-old plant). The first column is visualized by fusing the full-length coding region of PgGID1A-D with the GFP reporter gene, the second column is the image of the cell nucleus by 35S::AtARR2-RFP, and the third column is GFP and RFP fluorescence. It is an image that combines.
2C and 2D show pGADT7 and pGBKT7 vector maps used in the experiment of the present invention.
2E is a result of analyzing the interaction between the ginseng gibberellin receptor protein (PgGID1A-D) and PgRGAs of the present invention through yeast hybrid analysis (Yesst two-hybrid assay, Y2H).
Figure 3 shows the molecular docking between giverelin and gibberellin receptor proteins in the core domain (HGGS) in a three-dimensional predictive structure (Pg, Panax ginseng; At, Arabidopsis thaliana).
Figure 4a is a result of overexpressing a vector containing the giverelin receptor gene (PgGID1A-D) of ginseng of the present invention in Atgid1a/c mutant Arabidopsis plants showing a dwarf phenotype that is not susceptible to gibberellin. Photographs, Figures 4b and 4c are the phenotypes of the above-ground chute (shoot, n = 12) and silk (silique, n = 16) lengths of plants for each experimental group are measured and quantified using the GraphPad Prism6 program. Atgid1a/c represents a mutant Arabidopsis thaliana with a dwarf phenotype; Atgid1a/c, 35S:PgGID1A#1 represents a mutant Arabidopsis plant into which the PgGID1A gene has been introduced; Atgid1a/c, 35S:PgGID1B#1 represents a mutant Arabidopsis plant into which the PgGID1B gene has been introduced; Atgid1a/c, 35S:PgGID1C#2 represents a mutant Arabidopsis plant into which the PgGID1C gene has been introduced; Atgid1a/c, 35S:PgGID1D#2 represents a mutant Arabidopsis plant into which the PgGID1D gene has been introduced.
5A is a cross-sectional photograph of ginseng roots grown by treatment with DMSO and gibberellin (GA) for 50 days in a laboratory. Red arrows point to the cambium. In the case of ginseng roots grown by treatment with gibberellin (GA), cells of a certain size appear to be long listed below the cambium, and it is predicted that cell division was promoted in ginseng roots treated with gibberellin (GA) than in the DMSO-treated group. I can.
Figure 5b is a graph showing the measurement of the circumference of ginseng roots grown by treatment with DMSO and gibberellin (GA) for 50 days in a laboratory.
5C is a photograph of in situ hybridization of ginseng at 8 weeks.

The present invention provides a gibberellin receptor protein derived from Panax ginseng that promotes plant length and volume growth, consisting of one amino acid sequence among the amino acid sequences of SEQ ID NOs: 5 to 8.

In the present invention, the amino acid sequence represented by SEQ ID NOs: 5 to 8 is a polypeptide derived from Panax ginseng, and was first identified as a gibberellin receptor protein in ginseng through phylogenetic tree analysis and protein sequence alignment, respectively, "PgGID1A", It was named “PgGID1B”, “PgGID1C”, and “PgGID1D”.

The scope of the ginseng gibberellin receptor protein according to the present invention includes a protein having at least one amino acid sequence among amino acid sequences represented by SEQ ID NOs: 5 to 8 isolated from Panax ginseng and functional equivalents of the protein. The term "functional equivalent" is at least 70% or more, preferably 80% or more, more preferably, with at least one amino acid sequence among the amino acid sequences represented by SEQ ID NOs: 5 to 8 as a result of the addition, substitution or deletion of amino acids. It refers to a protein having a sequence homology of 90% or more, more preferably 95% or more, and exhibiting substantially the same physiological activity as the protein represented by SEQ ID NOs: 5 to 8.

In addition, the present invention provides a PgGID1A-D gene encoding the ginseng gibberellin receptor protein.

The gene of the present invention includes both genomic DNA and cDNA encoding the ginseng gibberellin receptor protein. Preferably, the gene of the present invention may include at least one nucleotide sequence among the nucleotide sequences represented by SEQ ID NOs: 1 to 4. In addition, homologs of the nucleotide sequence are included within the scope of the present invention. Specifically, the gene is at least one nucleotide sequence of the nucleotide sequences represented by SEQ ID NOs: 1 to 4 and 70% or more, more preferably 80% or more, even more preferably 90% or more, most preferably 95 It may include a base sequence having a sequence homology of% or more. The "% of sequence homology" for a polynucleotide is identified by comparing two optimally aligned sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include additions or deletions (ie, gaps) compared to (not including).

In addition, the present invention provides a recombinant vector for transformation comprising at least one gene of the genes represented by SEQ ID NOs: 1 to 4, which promotes length and volume growth of plants.

In the present invention, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide, or a polypeptide encoded by a heterologous nucleic acid. Recombinant cells may express genes or gene segments that are not found in the wild-type form of the cell in either a sense or antisense form. In addition, the recombinant cell may express a gene found in cells in a wild-type state, but the gene is modified and reintroduced into the cell by artificial means.

In the present invention, the ginseng-derived gibberellin receptor gene (PgGID1A-D) sequence may be inserted into a recombinant vector. The term "vector" of the present invention is used to refer to a DNA fragment(s) or nucleic acid molecule to be delivered into a cell. Vectors replicate DNA and can be reproduced independently in host cells. Recombinant vector means a bacterial plasmid, phage, yeast plasmid, plant cell virus, mammalian cell virus vector, or other vector. In general, any plasmid and vector can be used as long as they can replicate and stabilize in the host. An important characteristic of the expression vector is that it has an origin of replication, a promoter, a marker gene and a translation control element.

Expression vectors containing the sequences of each of the ginseng-derived gibberellin receptor genes (PgGID1A-D) and appropriate transcription/translational control signals can be constructed by methods well known to those skilled in the art. The method includes in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombinant technology. The DNA sequence can be effectively linked to an appropriate promoter in the expression vector to guide mRNA synthesis. In addition, the expression vector may include a ribosome binding site and a transcription terminator as a translation initiation site.

A preferred example of the recombinant vector of the present invention is a Ti-plasmid vector capable of transferring a part of itself, a so-called T-region, to plant cells when present in a suitable host such as Agrobacterium tumerfaciens. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences into plant cells, or protoplasts from which new plants can be produced that properly insert hybrid DNA into the plant's genome. have. A particularly preferred form of Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and in US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host are viral vectors such as those that can be derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, gemini viruses, etc. For example, it can be selected from incomplete plant viral vectors. The use of such vectors can be advantageous especially when it is difficult to properly transform a plant host.

In the recombinant expression vector of the present invention, the promoter may be a promoter suitable for transformation, preferably a CaMV 35S promoter, an actin promoter, a ubiquitin promoter, a pEMU promoter, a MAS promoter, a histone promoter, or a Clp promoter, but is not limited thereto. . The term "promoter" of the present invention refers to a region above DNA from a structural gene, and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A “plant promoter” is a promoter capable of initiating transcription in a plant cell. The "constitutive promoter" is a promoter that is active under most environmental conditions and developmental states or cell differentiation, and the use of a constitutive promoter may be preferred in the present invention. Thus, constitutive promoters do not limit the possibility of selection.

In the recombinant vector of the present invention, a conventional terminator can be used, examples of which include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, and the octopine gene of Agrobacterium tumefaciens. Terminator, phaseoline terminator, rrnB1/B2 terminator of E. coli, and the like, but are not limited thereto. Regarding the need for terminators, it is generally known that terminator regions increase the certainty and efficiency of gene transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

The recombinant vector may preferably contain one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by a chemical method, and all genes capable of distinguishing a transformed cell from a non-transgenic cell correspond to this. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, hygromycin, chloramphenicol, G418, and bleomycin. Resistance gene, aadA gene, and the like, but are not limited thereto.

The recombinant vector used in the present invention may be pCB302ES, pCXSN, pINDEX3, pBI121, or pgR106, but is not limited thereto.

In addition, the present invention provides a composition or transformant for promoting length and volume growth of a plant comprising a recombinant vector for transformation comprising at least one gene of the genes represented by SEQ ID NO: 1 to 4.

In the present invention, the term "transformation" means that the traits of an individual or cell are genetically changed by DNA, which is a genetic material given from the outside. In the present invention, among the genes represented by SEQ ID NOs: 1 to 4 It means that the length and volume growth of the transformed plant is promoted by the introduction of one or more genes.

In the present invention, transformation with the recombinant expression vector of the present invention can be performed by transformation techniques known to those skilled in the art. For example, microprojectile bombardment, particle gun bombardment, silicon carbide whiskers, sonication, electroporation, PEG-mediated fusion method ( PEG-mediated fusion), microinjection, liposome-mediated method, In planta transformation, Vacuum infiltration method, floral meristem dipping method), or a method mediated by Agrobacterium sp., and the like, but is not limited thereto.

In the present invention, the term "transformant" refers to a host cell transformed with a recombinant expression vector containing at least one of the genes represented by SEQ ID NOs: 1 to 4, which promotes the length and volume growth of the plant of the present invention. Means.

The transformant is preferably a microorganism, but is not limited thereto, Escherichiacoli, Bacillus subtilis, Streptomyces, Pseudomonas, Proteus mirabilis, It may be Staphylococcus (Staphylococcus) and Agrobacterium tumefaciens (Agrobacterium tumefaciens), more preferably Agrobacterium tumefaciens (Agrobacterium tumefaciens).

In addition, the present invention provides a transgenic plant transformed with a recombinant vector for transformation comprising at least one gene of the genes represented by SEQ ID NOs: 1 to 4 and promoted length and volume growth.

The term "plant" of the present invention refers to a body of a plant, and may include the whole plant, a part of the plant, seeds or plant cells.

The plants include monocotyledonous plants such as rice, barley, wheat, rye, corn, sugar cane, oats, onions, or ginseng, Arabidopsis, potato, eggplant, tobacco, pepper, tomato, burdock, garland chrysanthemum, lettuce, bellflower, spinach, chard , Sweet potato, celery, carrot, parsley, parsley, cabbage, cabbage, radish, watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney beans, peas, and other dicotyledons, and preferably ginseng have.

In addition, the present invention is compared to the wild-type plant length growth and volume growth comprising the step of overexpressing the gene by transforming a recombinant vector containing at least one gene of the genes represented by SEQ ID NO: 1 to 4 in plant cells Provides a way to promote

The method for transforming the plant cell is as described above.

In addition, the present invention is compared to the wild-type plant length growth and volume growth comprising the step of overexpressing the gene by transforming a recombinant vector containing at least one gene of the genes represented by SEQ ID NO: 1 to 4 in plant cells It provides a method for producing this enhanced transgenic plant.

The method for transforming the plant cell is as described above, and the method of the present invention includes the step of regenerating a transformed plant from the transformed plant cell. Any method known in the art may be used as a method for regenerating a transgenic plant. Techniques for the regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989 Momillan, N.Y.).

In addition, the present invention provides the seed of the transgenic plant.

In addition, the present invention provides a method for promoting volume growth of ginseng roots, comprising the step of overexpressing one or more genes of the genes represented by SEQ ID NOs: 1 to 4 by transforming the recombinant vector for transformation into ginseng cells. to provide.

In an embodiment of the present invention, a vector containing a ginseng-derived giverelin receptor gene (PgGID1A-D) of the present invention is overexpressed in Atgid1a/c mutant Arabidopsis plants showing a dwarf phenotype that is not susceptible to gibberellin. As a result, it was confirmed that the lengths of the above-ground shoot and the silique were effectively grown.

In another embodiment of the present invention, when ginseng is treated with gibberellin, it was confirmed that the cell differentiation of the cambium cells of the ginseng root is promoted and the circumference of the root is enhanced, the ginseng-derived gibberellin receptor gene (PgGID1A- In the case of transformation with a vector containing D), the sensitivity of gibberellin increases, so that the volume growth of ginseng roots can occur effectively.

Hereinafter, the present invention will be described in more detail through examples. These examples are for explaining the present invention more specifically, and the scope of the present invention is not limited to these examples.

< Example 1>

Of ginseng through phylogenetic tree analysis and protein sequence alignment Gibberellin Receptor-related gene identification

The protein sequence of the gibberellin receptor-associated gene was selected in previous studies (GID1A: AT3G05120.1, GID1B: AT3G63010.1, GID1C: AT5G27320.1). Protein sequences were aligned using the online program SMS (http: // Bioinformatics.org). Phylogenetic tree analysis can be performed using MEGA7.0 software for mediation such as the neighbor-joining method, pairwise deletion, and p-distance model. This was done using variables. Bootstrap analysis performed 1000 replicates. The percentage of sequences that must be matched for identity or similarity is 70%. In this experiment, four gibberellin receptor proteins were identified from ginseng, and they were named “PgGID1A”, “PgGID1B”, “PgGID1C” and “PgGID1D”, respectively.

As a result, as shown in FIG. 1, the degree of similarity between the giverelin receptor gene identified through the existing model plant and the gibberellin receptor gene of ginseng identified in the present invention was confirmed.

1A is a schematic diagram showing the relationship between GID1s genes as a result of phylogenetic tree analysis of homologues and PgGID1A-D proteins, and the horizontal branch length is proportional to the estimated number of amino acid substitutions per residue (Pg, Panax ginseng; At, Arabidopsis) thaliana; Os, Oryza sativa). Figure 1b is a topology diagram based on a two-dimensional structure predicted through GID1 of rice, showing major domains and residues (blue circles are important residues for OsGID1-SLR1 interaction, and red circles are OsGID1- Important residue for GA and OsGID1-SLR1 interaction The red star is an essential residue for enzymatic activity, just like the HSL protein, colored regions indicate the lid (yellow) and binding pocket (red)). 1C is a result of confirming homology by performing a sequence analysis of homologous proteins of Arabidopsis and rice plants together with PgGID1A-D protein in order to find out the biological functionality of the PgGID1A-D protein. It can be seen from FIG. 1c that the sequence of the giverelin receptor protein of ginseng has high overall similarity with the giverelin receptor proteins of the existing plant.

Through the above results, it was determined that the PgGID1A-D gene identified in this experiment could function as a gibberellin receptor in ginseng.

< Example 2>

Of the present invention PgGID1A -D protein expression site analysis

<2-1> PgGID1A -D transient expression analysis

In this experiment, the full-length cDNA of PgGID1A-D was cloned into a plant expression vector containing a GFP DNA sequence tag at the C-terminus induced by the 35S::C4PPDK promoter (see FIG. 2A).

In detail, in order to construct an expression vector for the PgGID1A-D gene derived from ginseng, the PgGID1A-D gene was first isolated. The PgGID1A-D gene was amplified by PCR using a primer set specific to each of the PgGID1A-D genes (see Table 1 below) using cDNA from Panax ginseng as a substrate. For PCR amplification, make 50μl of a total PCR mixture in a PCR tube with 1μl of DNA with a density of 20ng/μl, 5μl of 10x Pfu buffer, 5μl of dNTP (each 2mmole), 1μl of each primer, 0.5μl of Pfu-X DNA polymerase, and 36.5μl of distilled water. After pre-denaturing at 94°C for 2 minutes, denaturation at 94°C for 20 seconds, annealing at 52°C for 30 seconds, extension at 72°C for 1 minute and 15 seconds were performed for 34 cycles, and finally at 72°C for 2 minutes. . After confirming the base sequence of the amplified PgGID1A-D gene, as shown in FIG. 2A, the isolated PgGID1A-D gene was inserted into a plant expression vector containing a GFP DNA sequence tag at the C-terminus induced by the C4PPDK promoter, and pGFP. -PgGID1A, pGFP-PgGID1B, pGFP-PgGID1C, pGFP-PgGID1D expression vectors were prepared, respectively. The PCR amplification product of the ginseng-derived PgGID1A-D gene was cut with BamHI restriction enzyme, and then PgGID1A-D gene was linked to the BamHI restriction enzyme site downstream of the 35S::C4PPDK promoter so that the PgGID1A-D gene could be expressed in plants. An expression vector was constructed, and at this time, an ampicillin (amp) resistance gene was used as an antibiotic resistance marker.

Thereafter, for transient expression assay, about 4×10 ⁴ protoplasts isolated from the leaves of 30-day-old Arabidopsis plants were 20 μg of the plasmid vectors (pGFP-PgGID1A, pGFP-PgGID1B, pGFP-PgGID1C, pGFP). -PgGID1D) and then incubated at 20°C for 6 hours under constant conditions. ARR2-RFP was used as a nuclear marker (ARR2 corresponds to one of the transcription factors expressed in the nucleus). GFP and RFP fluorescence were observed with a fluorescence microscope (Nikon).

As a result, as shown in FIG. 2B, it was found that PgGID1A-D was mainly expressed in the nucleus, and some were expressed in the cytoplasm.

Primer sequence used for PCR amplification gene Primer sequence PgGID1A Forward CGGGATCCATGGCTGGAAGTAGTGGTATTA Reverse AAGGCCTACAGTCAGAACCCACAAAGC PgGID1B Forward CGGGATCCATGGCTGGAAGTAATGGAATTAATC Reverse AAGGCCTACAGTCAGAACCCACAAAGC PgGID1C Forward AGATCTATGGCTGGGAGTAATGAAATTAATC Reverse AGGCCTGTAGGAACATACAAAACTTTTTATCTC PgGID1D Forward GGATCCATGGCTGGTAGTAATGAAGTTAACG Reverse CCCGGGACAGTTAGGATTCACAAAGTTTTTTA

<2-2> Yeast hybrid analysis ( Yesst two-hybrid assay, Y2H )

In this experiment, yeast strain AH109 was transformed with pGADT7 vector and pGBKT7 vector for interaction between PgGID1A-D and PgRGAs (see Figs. 2c and 2d).

The cDNA of PgRGA1-3 was cloned into the vector pGADT7 (prey) containing the GAL4-activation domain, and the cDNA of PgGID1A-D was cloned into the vector pGBKT7 (bait) containing the GAL4 DNA binding domain. The cDNA of PgRGA1-3 and the cDNA of PgGID1A-D were prepared through the same PCR amplification procedure described in Example <2-1>. Transformed cells did not contain Leu and Trp / Leu, Trp and His / Leu, Trp and His, but were grown in synthetic medium containing 1 mM 3-aminotriazole or 100 nM gibberellin (GA ₃ , Sigma-Aldrich). .

For reference, RGA is one of the gibberellin signaling factors and is a major inhibitor of gibberellin signaling. RGA normally suppresses the zeberellin signal, and when gibberellin binds to GID1, the RGA decomposes and the giverelin signal is generated. GID1/RGA can interact weakly with each other, but it is well known that the presence of gibberellin strengthens the interaction. In addition, RGA is well known as a plant growth inhibitory factor. PgRGA1-3 used in the present invention is an RGA gene derived from ginseng and can be represented by the nucleotide sequences of SEQ ID NOs: 9 to 11.

As a result, as shown in Figure 2e, it was confirmed that the physical binding between the giverelin receptor and DELLA (gibberellin signaling inhibitor), and when the presence of gibberellin, the interaction between the two proteins is strong. Through this, it was confirmed that the gibberellin receptor PgGID1A-D of ginseng of the present invention is functionally well preserved.

< Example 3>

Arabidopsis Gibberellil Receptors and ginseng Gibberellin Receptor Gibberellin 3D prediction structure to determine if it can be combined

The crystallographic structure of Arabidopsis gibberellin receptor protein GID1a (PDB: 2ZSH)1 was retrieved from Protein Data Bank (https://www.rcsb.org/). This structure was used as a template to predict the key domains of AtGID1a, PgGID1a, PgGID1c and PgGID1d, respectively, using PHYRE II analysis and PyMOL structure visualization software. This included the separation of co-crystallized ligands and proteins, as well as hydrogenation of proteins that were omitted from the protein data bank file. Proteins were calculated using MOE 2016.0802 with force-field Amber10:EHT and termination set to 0.001 kcal/mol for structural inspection and docking.

As a result, as shown in Fig. 3, it was confirmed that the gibberellin receptors of ginseng can bind similarly to Arabidopsis thaliana, and the binding structure is also similar. Through this, it was determined that the gibberellin receptor of ginseng could bind to gibberellin and perform its function.

In Figure 3A, the model based on GA ₃ (Gibberellic acid, Sigma-Aldrich) was shown to bind to the AtGID1A structure (PDB ID: 2ZSH). 3B-3D show the docking results of GA _{3 in} the core domains PgGID1A, PgGID1C, and PgGID1D. Figure 3E shows that the GA-PgGID1A _three docking poses and crystallographic pose of AtGID1A _GA-3 overlap in 2ZSH. 3F shows that the docking pose of PgGID1C-GA _{3 and} the crystallographic pose of AtGID1A-GA ₃ overlap in 2ZSH. Figure 3G shows that the GA-PgGID1D _three docking poses and crystallographic pose of AtGID1A _GA-3 overlap in 2ZSH.

< Example 4>

Functionally preserved ginseng of the present invention Gibberellin Receptor( PgGID1A -D) ultimately within the plant Function Confirm

To generate transgenic plants overexpressing the HA-tagged ginseng gibberellin receptor (PgGID1A-D) in the Atgid1a/c mutant Arabidopsis (GID1 lost mutation) background, PgGID1A-D cDNA contains 35S promoter and HA tag sequence It was cloned into a vector for plant transformation (pCB302ES) (Ryu et al., 2014). Atgid1a/c mutant Arabidopsis thaliana was pre-sold from RIKEN Research Institute (https://epd.brc.riken.jp/en/seed) in Japan.

The cDNA of PgGID1A-D was prepared through the same PCR amplification procedure described in Example <2-1>. The prepared cDNA of PgGID1A-D was digested using BamHI and StuI, and cloned into the vector pCB302ES, and the vector was regulated by the coding site of PgGID1A-D promoter 35SC4PPDK (Hwang and Sheen, Nature 413, 383-389 (2001)) It was obtained by modifying the vector pCB302-2 (Xiang et al., Plant Mol Biol 40, 711-717 (1999)) to be placed under The obtained vector was named pCB302ES::(35S::PgGID1A-D).

Electroporation was used to introduce the pCB302ES::(35S::PgGID1A-D) vector into the Agrobacterium tumefaciens strain GV3101. All transgenic lines were generated by the Agrobacterium mediated floral dip method. Transgene expression was confirmed by immunoblotting. Total protein was extracted with protein extraction buffer (50mM Tris-HCl (pH 7.5), 75mM NaCl, 5mM EDTA, 1mM dithiothreitol, 1× protease inhibition cocktail (Roche) and 1% Triton X-100). Total protein (3-20 μg) was separated by SDS-PAGE (10% polyacrylamide), transferred to a polyvinylidene difluoride membrane, and 1/2,000 of peroxidase-bound high affinity anti-HA (Roche) Immunodetection was performed using the diluted solution. On the other hand, in this experiment, the phenotypes of the above-ground shoot (n = 12) and silique (n = 16) lengths of plants for each experimental group were measured and quantified using the GraphPad Prism6 program.

As a result, as shown in FIG. 4, as a result of overexpressing the gibberellin receptor gene of ginseng in the Atgid1a/c mutant showing the dwarf phenotype, it was observed that the dwarf mutant plant recovered close to the wild type (see FIG. 4A). It can be seen that not only the length of the plant but also the length of the silk is recovered to some extent (see Figs. 4b and 4c). Based on these contents, it was confirmed that gibberellin signaling in the ginseng of the present invention is well preserved in evolution and can function in plants.

< Example 5>

From ginseng Gibberellin Volume growth by treatment

In this experiment, two-year-old ginseng was treated with DMSO and Gibberellic acid (GA _3, Gibberellic acid) for 50 days, and the cross section was cut and observed.

The results are shown in detail in FIGS. 5A to 5C.

In FIG. 5A, the red arrow indicates cambium cells. Unlike DMSO-treated ginseng, in the case of gibberellin-treated ginseng, cells under the cambium were arranged in a similar size and arranged in a row. Through the results as described above, it could be predicted that cell division was promoted as cells of a certain size were arranged long under the cambium layer by the treatment of gibberellin in ginseng.

In Figure 5b, it was shown by measuring the circumference of ginseng treated with DMSO and gibberellin during the growth process for 50 days, and it was confirmed that the circumference of ginseng treated with gibberellin increased, indicating that the volume of ginseng increased.

Figure 5c is a result of confirming the expression of PgGID1D of the present invention in the ginseng root tissue using in situ hybridization. As a result of in situ hybridization of ginseng at the 8th week, it was confirmed that PgGID1D was expressed in the cambium (the part predicted to be / part stained with purple).

For in situ hybridization, cross sections of ginseng roots with a diameter of 0.5 cm were cut and treated in FAA solution (50% ethanol, 5% acetic acid, 3.7% formaldehyde) at 4℃ for 10 days, and the samples were continuously increased in ethanol. After dehydration with a furnace (50, 60, 70, 80, 90, 95, 100%) for 30 minutes each, they were embedded in paraffin for 5 days and sectioned to a thickness of 10 μm. The section was subjected to a series of treatments (hydration, proteinase K treatment, acetylation, dehydration) and then treated with xylene. PgGID1D probe was fabricated for in situ hybridization. After that, prehybridization was performed in a humid chamber at 42°C for 2 hours, and hybridization buffer including PgGID1D sense and antisense probe was added to perform hybridization in a humid chamber at 42°C for 16 hours. Immumological detection was performed using an anti-DIGbody (Roche, Germany) bound with alkaline phosphatase. The purple colored slide was photographed with an optical microscope (OLYMPUS BX51, Japan).

The manufacturing process of the PgGID1D probe is as follows.

end. PCR of the gene cloned into the T vector with T7+SP6 primer

For PCR amplification, a total of 30 μl of PCR mixture was made in a PCR tube with 20 ng/μl of DNA 1μl, 10x Pfu buffer 3μl, dNTP (each 2mmole) 3μl, each primer 1μl, Pfu-X DNA polymerase 0.3μl, DEPC treated distilled water 21.7μl. After that, it was first pre-denatured at 94°C for 2 minutes, then denatured at 94°C for 20 seconds, annealing at 58°C for 30 seconds, extended at 72°C for 1 minute and 15 seconds, 38 cycles, and finally extended at 72°C for 2 minutes. Implemented.

I. ELution by electrophoresis of PCR product

All. probe synthesis

With 5x RNA polymerase buffer 5ul, RNase inhibitor 1ul, 10x Dig RNA labeling mix 2.5ul, eluted DNA 15ul, (T7 or SP6) RNA polymerase 2.5ul, react a total of 25ul mixture in an oven at 37℃ for 20 hours or more.

All. Add 1ul of DNase and react in an oven at 37℃ for 30 minutes.

hemp. RNA precipitation

Add 1ul of 0.5M EDTA pH8, 4ul of 6M LiCl, and 100ul of 100% EtOH (-20℃) and react in a refrigerator at -20℃ for at least 20 hours.

bar. Centrifuse at 4℃ 13000rpm for 15 minutes / discard supernatant, add 500ul of 75% ethanol, centrifuse at 4℃ 13000rpm for 10 minutes / discard supernatant, and dissolve RNA in 15ul of DEPC treated DW.

Those of ordinary skill in the art to which the present invention pertains so far will be able to understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative point of view rather than a limiting point of view. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Recombinant vector for promoting plant length growth and volumetric growth and uses thereof <130> NPDC-77374 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 1032 <212> DNA <213> Artificial Sequence <220> <223> PgGID1A polynucleotide sequence <400> 1 atggctggaa gtagtggtat taatcttagt gagtccaaga tggtggttcc actcaataca 60 tgggtcctca tctccaattt caagctggca tacaatcttc tccgtcgtcc tgatgggtct 120 tttaaccgcc acttggctga gttccttgac cgcaaagtcc tggccaatgc aaatcctgtt 180 aatggggttt tctcctttga tgtcattatt gaccgtagaa ccaacctcct tacccgaatc 240 tatcgaccag caaatgctga attggttcga cctagtattg cggaacttga gaatcctttg 300 agcgtggatg ttgtccctgt catagtcttc ttccatggtg gaagctttgc acattcctct 360 gcaaacagtg ctatctatga cactctatgt cgacgtctag tgggcctttg taatgctgtt 420 gtgatttcag taaattatcg gcgtgctccc gaggaccctt atccctgtgc ctataatgat 480 ggctggactg cgcttgagtg ggttaattcg aggacatggc ttcaaagtcg aaaggactct 540 aaagttcata tatacttggc tggtgatagc tctggtggca atattgttca taatgttgct 600 ttgagggcag tagaatcagg aattgaagtg ttgggaaata tacttctgaa tccaatgttt 660 ggtgggcaag agagaactga atcagagaag cggctggatg ggaaatattt tgtcactgtt 720 caagaccgag actggtattg gagagcattt ctccctgagg gggaagatag ggaccatcca 780 gcctgtaatc ctttcggtcc caaggctata agcatagacg gaatgaattt tccaaagagt 840 cttgtagttg tggctggttt ggaccttatc caggactggc agatggctta cgcggaaggg 900 ctcaagaacg ccggcaaaga ggttaaactt ctatatttgg agaaggcaac aattgggttc 960 tacttgttgc ccaacaatga ccacttctac actgtaatgg atgagataaa aagctttgtg 1020 ggttctgact gt 1032 <210> 2 <211> 1038 <212> DNA <213> Artificial Sequence <220> <223> PgGID1B polynucleotide sequence <400> 2 atggctggaa gtaatggaat taatcttagt gagtccaaga tggtggttcc actcaataca 60 tgggtcctca tctccaattt caagctggca tacaatcttc ttcgtcgtcc tgatgggtct 120 tttaaccgcc acttggctga gttccttgac cgcaaagtcc tggccaatgc aaatcctgtt 180 aatggggttt tctcctttga tgtcattatt gaccgtagaa ccaacctcct tacccgaatc 240 tatcgaccgg caaatgctga attggttcga cctagtattg tggaacttga gaatcctttg 300 agcgctgatg ttgtccctgt catagtcttc ttccatggtg gaagctttgc acattcctct 360 gcaaacagtg ctatctatga cactctatgt cgacgtctgg tgggcctttg taatgctgtt 420 gtgatttcag taaattatcg gcgtgctccc gaggaccctt atccctgtgc ctatgatgat 480 ggctggactg cacttgagtg ggttaattcg aggacatggc ttcaaagtcg aaaggactct 540 aaagttcata tatacttggc tggtgatagc tctggtggca atattgttca taatgttgct 600 ttgagggcag tagaatcagg aattgaagtg ttgggaaata tacttctgaa tccaatgttt 660 ggtgggcaag agagaactga atcagagaag cggctggatg ggaaatattt tgtcactgtt 720 caagaccgag actggtattg gagagcattt ctccctgagg gggaagatag ggaccatcca 780 gcctgtaatc ctttcggtcc caaggctata agcataagca tagaaggaat gaattttccg 840 aagagtcttg tagttgtggc tggtttggac cttatccagg actggcagat ggcttacgcg 900 gaagggctta agaacgccgg caaagaggtt aaacttctat atttggagaa ggcaacaatt 960 gggttctact tgttgcccaa caatgaccac ttctacactg taatggatga aataaaaagc 1020 tttgtgggtt ctgactgt 1038 <210> 3 <211> 1035 <212> DNA <213> Artificial Sequence <220> <223> PgGID1C polynucleotide sequence <400> 3 atggctggga gtaatgaaat taatcttaat gactccaaga tggtggttcc actgaataca 60 tggatcctca tctccaattt caagctggca tataatcttc ttcgtcgccc tgatgggact 120 tttaaccgcc acttggctga gttccttgac cgcaaagtcc aggccaatgc aaatcctgtt 180 gacggggttt tctcttttga tgtcattatc gaccgtggaa ccagcctact tattcgagtt 240 tatcggccag caaatgctga cgagggtatg cctagtattg ctgaccttga gaaacccttg 300 aactctgatg ttgtccctgt cataatcttc ttccatggtg gaagctttgc acattcctct 360 gcaaacagtg ctatctatga cactctatgt cgtcgactag tgggcctttg taaggctgtt 420 gtaatttcag taaattatcg gcgtgctcct gagtaccctt acccctgtgc ctatgaagat 480 ggctggactg cgcttaagtg ggttagttca aggacatggc ttcaaagtca gaaggactct 540 aaagttcaca tatacttagc tggtgatagc tctggtggta atattgttca taatgtttct 600 ttgagggcta tagaatcagg aacaggaatt gaagtgttag gaaatatact actcaatcca 660 atgtttggcg ggaaagagag aactgaatca gagaagcgac tagatgggaa atattttgtc 720 actgttcaag atcgagactg gtattggaaa gcctttctcc cagaagggga agatagggac 780 catgctgcat gtaatccttt tggtcttaag gcaataagca ttgaaggaat gaatttccct 840 aagagtcttg ttgtcgtggc tggtttggac cttgtccagg actggcagtt ggcttatgcg 900 gaagggctta agaaggcagg ccaagaggtg aaacttctat atttagagca ggcaacaatt 960 gggttctact tgttgcccaa caatgaccac ttctacactg tgatgaatga gataaaaagt 1020 tttgtatgtt cctac 1035 <210> 4 <211> 1035 <212> DNA <213> Artificial Sequence <220> <223> PgGID1D polynucleotide sequence <400> 4 atggctggta gtaatgaagt taacgttaat gacgccaaga gggttgttcc actgaataca 60 tggattttga tatctaattt caaactagct tacaacatgc agcgtcgtcc tgatggaaca 120 atcaatcgcg atttggcaga gtttcttgac aggaaagtcc ctgccaacac cattccggtt 180 gatggggttt actcttttga tgttgttgat cgggtcacca gccttctcaa tcgtgtttat 240 cgatcagccc cggaaaatga agctcagtgg ggcctcgttg aactcgaaca tcctttgagc 300 accactgaaa ttgtgcctgt cattattttc ttccacggtg gaagcttcgc ccattcctct 360 gccaatagtg ctatatatga tacattctgc cgccgccttg ttggaatttg caaggctgtt 420 gtggtgtccg ttaactatcg gcgatcgcct gaacatcgat acccctgtgc atacgatgat 480 ggatgggcag ctcttaaatg ggttcattca agatcatggc ttcaaagtgg gaaggattct 540 aaagtccgtg tctatttggc cggtgatagt tcgggtggaa acattgttca ccatgttgct 600 gtgagggctg ctgaatcagg agttgaagta ttgggtaata tacttcttca tccatttttt 660 ggggggcaag agcgaaagga gtcagagacg agattggatg ggaagtactt tgtgacaatt 720 caagataggg actggtattg gagagcttac ttaccggaag gtgaagatag agaccatccg 780 gcatgtaata tatttggccc gagggccaaa agaattgaag gactagtaaa gtttccgaaa 840 agtcttgttt gtgtggctgg tttggatctt gttcaggatt ggcagttggc ttatgtagaa 900 ggcctggagg aagccgggca agaggtgcaa ctcctatacc taaaggaggc aacgataggt 960 ttctacttct tgccgaataa tgaccatttc tataacctca tggagcagat aaaaaacttt 1020 gtgaatccta actgt 1035 <210> 5 <211> 344 <212> PRT <213> Artificial Sequence <220> <223> PgGID1A polypeptide sequence <400> 5 Met Ala Gly Ser Ser Gly Ile Asn Leu Ser Glu Ser Lys Met Val Val 1 5 10 15 Pro Leu Asn Thr Trp Val Leu Ile Ser Asn Phe Lys Leu Ala Tyr Asn 20 25 30 Leu Leu Arg Arg Pro Asp Gly Ser Phe Asn Arg His Leu Ala Glu Phe 35 40 45 Leu Asp Arg Lys Val Leu Ala Asn Ala Asn Pro Val Asn Gly Val Phe 50 55 60 Ser Phe Asp Val Ile Ile Asp Arg Arg Thr Asn Leu Leu Thr Arg Ile 65 70 75 80 Tyr Arg Pro Ala Asn Ala Glu Leu Val Arg Pro Ser Ile Ala Glu Leu 85 90 95 Glu Asn Pro Leu Ser Val Asp Val Val Pro Val Ile Val Phe Phe His 100 105 110 Gly Gly Ser Phe Ala His Ser Ser Ala Asn Ser Ala Ile Tyr Asp Thr 115 120 125 Leu Cys Arg Arg Leu Val Gly Leu Cys Asn Ala Val Val Ile Ser Val 130 135 140 Asn Tyr Arg Arg Ala Pro Glu Asp Pro Tyr Pro Cys Ala Tyr Asn Asp 145 150 155 160 Gly Trp Thr Ala Leu Glu Trp Val Asn Ser Arg Thr Trp Leu Gln Ser 165 170 175 Arg Lys Asp Ser Lys Val His Ile Tyr Leu Ala Gly Asp Ser Ser Gly 180 185 190 Gly Asn Ile Val His Asn Val Ala Leu Arg Ala Val Glu Ser Gly Ile 195 200 205 Glu Val Leu Gly Asn Ile Leu Leu Asn Pro Met Phe Gly Gly Gln Glu 210 215 220 Arg Thr Glu Ser Glu Lys Arg Leu Asp Gly Lys Tyr Phe Val Thr Val 225 230 235 240 Gln Asp Arg Asp Trp Tyr Trp Arg Ala Phe Leu Pro Glu Gly Glu Asp 245 250 255 Arg Asp His Pro Ala Cys Asn Pro Phe Gly Pro Lys Ala Ile Ser Ile 260 265 270 Asp Gly Met Asn Phe Pro Lys Ser Leu Val Val Val Ala Gly Leu Asp 275 280 285 Leu Ile Gln Asp Trp Gln Met Ala Tyr Ala Glu Gly Leu Lys Asn Ala 290 295 300 Gly Lys Glu Val Lys Leu Leu Tyr Leu Glu Lys Ala Thr Ile Gly Phe 305 310 315 320 Tyr Leu Leu Pro Asn Asn Asp His Phe Tyr Thr Val Met Asp Glu Ile 325 330 335 Lys Ser Phe Val Gly Ser Asp Cys 340 <210> 6 <211> 346 <212> PRT <213> Artificial Sequence <220> <223> PgGID1B polypeptide sequence <400> 6 Met Ala Gly Ser Asn Gly Ile Asn Leu Ser Glu Ser Lys Met Val Val 1 5 10 15 Pro Leu Asn Thr Trp Val Leu Ile Ser Asn Phe Lys Leu Ala Tyr Asn 20 25 30 Leu Leu Arg Arg Pro Asp Gly Ser Phe Asn Arg His Leu Ala Glu Phe 35 40 45 Leu Asp Arg Lys Val Leu Ala Asn Ala Asn Pro Val Asn Gly Val Phe 50 55 60 Ser Phe Asp Val Ile Ile Asp Arg Arg Thr Asn Leu Leu Thr Arg Ile 65 70 75 80 Tyr Arg Pro Ala Asn Ala Glu Leu Val Arg Pro Ser Ile Val Glu Leu 85 90 95 Glu Asn Pro Leu Ser Ala Asp Val Val Pro Val Ile Val Phe Phe His 100 105 110 Gly Gly Ser Phe Ala His Ser Ser Ala Asn Ser Ala Ile Tyr Asp Thr 115 120 125 Leu Cys Arg Arg Leu Val Gly Leu Cys Asn Ala Val Val Ile Ser Val 130 135 140 Asn Tyr Arg Arg Ala Pro Glu Asp Pro Tyr Pro Cys Ala Tyr Asp Asp 145 150 155 160 Gly Trp Thr Ala Leu Glu Trp Val Asn Ser Arg Thr Trp Leu Gln Ser 165 170 175 Arg Lys Asp Ser Lys Val His Ile Tyr Leu Ala Gly Asp Ser Ser Gly 180 185 190 Gly Asn Ile Val His Asn Val Ala Leu Arg Ala Val Glu Ser Gly Ile 195 200 205 Glu Val Leu Gly Asn Ile Leu Leu Asn Pro Met Phe Gly Gly Gln Glu 210 215 220 Arg Thr Glu Ser Glu Lys Arg Leu Asp Gly Lys Tyr Phe Val Thr Val 225 230 235 240 Gln Asp Arg Asp Trp Tyr Trp Arg Ala Phe Leu Pro Glu Gly Glu Asp 245 250 255 Arg Asp His Pro Ala Cys Asn Pro Phe Gly Pro Lys Ala Ile Ser Ile 260 265 270 Ser Ile Glu Gly Met Asn Phe Pro Lys Ser Leu Val Val Val Ala Gly 275 280 285 Leu Asp Leu Ile Gln Asp Trp Gln Met Ala Tyr Ala Glu Gly Leu Lys 290 295 300 Asn Ala Gly Lys Glu Val Lys Leu Leu Tyr Leu Glu Lys Ala Thr Ile 305 310 315 320 Gly Phe Tyr Leu Leu Pro Asn Asn Asp His Phe Tyr Thr Val Met Asp 325 330 335 Glu Ile Lys Ser Phe Val Gly Ser Asp Cys 340 345 <210> 7 <211> 392 <212> PRT <213> Artificial Sequence <220> <223> PgGID1C polypeptide sequence <400> 7 Met Ala Gly Ser Asn Glu Ile Asn Leu Asn Asp Ser Lys Met Val Val 1 5 10 15 Pro Leu Asn Thr Trp Ile Leu Ile Ser Asn Phe Lys Leu Ala Tyr Asn 20 25 30 Leu Leu Arg Arg Pro Asp Gly Thr Phe Asn Arg His Leu Ala Glu Phe 35 40 45 Leu Asp Arg Lys Val Gln Ala Asn Ala Asn Pro Val Asp Gly Val Phe 50 55 60 Ser Phe Asp Val Ile Ile Asp Arg Gly Thr Ser Leu Leu Ile Arg Val 65 70 75 80 Tyr Arg Pro Ala Asn Ala Asp Glu Gly Met Pro Ser Ile Ala Asp Leu 85 90 95 Glu Lys Pro Leu Asn Ser Asp Val Val Pro Val Ile Ile Phe Phe His 100 105 110 Gly Gly Ser Phe Ala His Ser Ser Ala Asn Ser Ala Ile Tyr Asp Thr 115 120 125 Leu Cys Arg Arg Leu Val Gly Leu Cys Lys Ala Val Val Ile Ser Val 130 135 140 Asn Tyr Arg Arg Ala Pro Glu Tyr Pro Tyr Pro Cys Ala Tyr Glu Asp 145 150 155 160 Gly Trp Thr Ala Leu Lys Trp Val Ser Ser Arg Thr Trp Leu Gln Ser 165 170 175 Gln Lys Asp Ser Lys Val His Ile Tyr Leu Ala Gly Asp Ser Ser Gly 180 185 190 Gly Asn Ile Val His Asn Val Ser Leu Arg Ala Ile Glu Ser Gly Thr 195 200 205 Gly Ile Glu Val Leu Gly Asn Ile Leu Leu Asn Pro Met Phe Gly Gly 210 215 220 Lys Glu Arg Thr Glu Ser Glu Lys Arg Leu Asp Gly Lys Tyr Phe Val 225 230 235 240 Thr Val Gln Asp Arg Asp Trp Tyr Trp Lys Ala Phe Leu Pro Glu Gly 245 250 255 Glu Asp Arg Asp His Ala Ala Cys Asn Pro Phe Gly Leu Lys Ala Ile 260 265 270 Ser Ile Glu Gly Met Asn Phe Pro Lys Ser Leu Val Val Val Ala Gly 275 280 285 Leu Asp Leu Val Gln Asp Trp Gln Leu Ala Tyr Ala Glu Gly Leu Lys 290 295 300 Lys Ala Gly Gln Glu Val Lys Leu Leu Tyr Leu Glu Gln Ala Thr Ile 305 310 315 320 Gly Phe Tyr Leu Leu Pro Asn Asn Asp His Phe Tyr Thr Val Met Asn 325 330 335 Glu Ile Lys Ser Phe Gln Phe Lys Ile Thr Leu Ser Asp Phe Leu Pro 340 345 350 Arg Arg Arg Glu Arg Gln Glu Asn Val Gly Thr Ile Pro Gly Pro Phe 355 360 365 Asn Leu Gly Ser Glu Leu Ala Trp Leu Met Leu Asn Val Asp Val Ile 370 375 380 Val Asp Pro Leu Ala Pro Ile Ile 385 390 <210> 8 <211> 345 <212> PRT <213> Artificial Sequence <220> <223> PgGID1D polypeptide sequence <400> 8 Met Ala Gly Ser Asn Glu Val Asn Val Asn Asp Ala Lys Arg Val Val 1 5 10 15 Pro Leu Asn Thr Trp Ile Leu Ile Ser Asn Phe Lys Leu Ala Tyr Asn 20 25 30 Met Gln Arg Arg Pro Asp Gly Thr Ile Asn Arg Asp Leu Ala Glu Phe 35 40 45 Leu Asp Arg Lys Val Pro Ala Asn Thr Ile Pro Val Asp Gly Val Tyr 50 55 60 Ser Phe Asp Val Val Asp Arg Val Thr Ser Leu Leu Asn Arg Val Tyr 65 70 75 80 Arg Ser Ala Pro Glu Asn Glu Ala Gln Trp Gly Leu Val Glu Leu Glu 85 90 95 His Pro Leu Ser Thr Thr Glu Ile Val Pro Val Ile Ile Phe Phe His 100 105 110 Gly Gly Ser Phe Ala His Ser Ser Ala Asn Ser Ala Ile Tyr Asp Thr 115 120 125 Phe Cys Arg Arg Leu Val Gly Ile Cys Lys Ala Val Val Val Ser Val 130 135 140 Asn Tyr Arg Arg Ser Pro Glu His Arg Tyr Pro Cys Ala Tyr Asp Asp 145 150 155 160 Gly Trp Ala Ala Leu Lys Trp Val His Ser Arg Ser Trp Leu Gln Ser 165 170 175 Gly Lys Asp Ser Lys Val Arg Val Tyr Leu Ala Gly Asp Ser Ser Gly 180 185 190 Gly Asn Ile Val His His Val Ala Val Arg Ala Ala Glu Ser Gly Val 195 200 205 Glu Val Leu Gly Asn Ile Leu Leu His Pro Phe Phe Gly Gly Gln Glu 210 215 220 Arg Lys Glu Ser Glu Thr Arg Leu Asp Gly Lys Tyr Phe Val Thr Ile 225 230 235 240 Gln Asp Arg Asp Trp Tyr Trp Arg Ala Tyr Leu Pro Glu Gly Glu Asp 245 250 255 Arg Asp His Pro Ala Cys Asn Ile Phe Gly Pro Arg Ala Lys Arg Ile 260 265 270 Glu Gly Leu Val Lys Phe Pro Lys Ser Leu Val Cys Val Ala Gly Leu 275 280 285 Asp Leu Val Gln Asp Trp Gln Leu Ala Tyr Val Glu Gly Leu Glu Glu 290 295 300 Ala Gly Gln Glu Val Gln Leu Leu Tyr Leu Lys Glu Ala Thr Ile Gly 305 310 315 320 Phe Tyr Phe Leu Pro Asn Asn Asp His Phe Tyr Asn Leu Met Glu Gln 325 330 335 Ile Lys Asn Phe Val Asn Pro Asn Cys 340 345 <210> 9 <211> 1728 <212> DNA <213> Artificial Sequence <220> <223> PgRGA1 polynucleotide sequence <400> 9 atgaagagag actacccaca acctaatcat agcaccttct ccacagactg tggtactggc 60 accggtggta gctcctccgt taacaatagc ggcgtgtatt caaatgggaa atctaagatg 120 tgggaggaaa ctgaacaaga cgccggagtt gacgagcttt tggctgttct gggctataaa 180 gtccggtcat ctgacatggc ggatgttgcc cagaaactcg agcacctcga agaagtgatg 240 ggccaagctc aagaagatgg cctttctcat ctcgcttgcg ataccgttca ctacaatccc 300 tccgatctat cgtcttggct cgaattaatg atttctgagc tcgacccacc accaccggga 360 acggatccat ttctcgccca tgcagaattg tctactagca agataatctt tgatgattca 420 tcttcttccg attacgatct taaagcaatc ccaggtaaag ccgtttaccc cacaactatt 480 caatcaccac ttcctccacc aaacaaaaaa ttgaaaatca cgatctcagc ggctccatct 540 gtttggccaa ctccagccca atctcaacta cagccaaaag aacactctca gtcagtagtt 600 ttagtggatt ctcaagaaaa cggagtccga ttagtccaca ctttgatggc ttgtgcggaa 660 gctgtgcaac acgataatct aaagctagcg gaagtccttg tcaaacagat cgcattccta 720 gccgtatccc aaatcggagc gatgcgaaag gttgccactt attttgccga agctctggct 780 caacgaatct accgattata cccacaaaca cctcaagatt ctgcttttgc agatctactg 840 ctaatgcatt tttacgaaac atgcccgtat ttaaaatttg cccattttac tgctaatcaa 900 gctatactcg aagcttttga tgataagaaa agcgtacatg tgattgattt cagtatgaaa 960 caggggacgc agtggccggc tttgatgcag gctttggcct tgcggcctgg tgggccgcct 1020 actttccgat taaccgggat tggaccgccg tcccacgata acactgatca tttgcaagat 1080 gtgggttgga aattggctca atttgcggaa actattcatg tcaagttcga gtatagtggg 1140 tttgtggcga acagtttagc tgatctcgat gcttccatgc ttgatcttcg agagggtgaa 1200 accgtggcgg taaactccgt tttcgagttt catcagctgt tggctcgccc gggtgcaatc 1260 gagaaggtga tgtcggcggt gaaggagatg aagccggaaa tcgtgacggt ggtggagcag 1320 gaagctaatc ataacggtcc tgttttcttg gaccggttta ccgagtcttt gcattattat 1380 tcaaccttat ttgactcttt ggagagttgt ggcggcggtg gatcggcgag taatgaggac 1440 aaggtgatgt cggaggtgtt cttgggcagg cagatatgta acgtggtggc ttgtgaagga 1500 gttgaccgag ttgagaggca cgagactctg ggtcagtgga gaagccggtt cggaagtggc 1560 gggtttaagg cggttcacct ggggtccaat gcgtttaagc aggccagtat gctgctggca 1620 ctgtttgctg gtggggatgg gtacagagtg gaagagaacg aagggtgtct gatgctgggt 1680 tggcacactc ggcccctcat tgctacctcg gcgtggaaac tcagtggt 1728 <210> 10 <211> 1737 <212> DNA <213> Artificial Sequence <220> <223> PgRGA2 polynucleotide sequence <400> 10 atgaagcgag actatccaca acctaatcat atatccttct ctgactgcgg tggtggcacc 60 agcggcagct cttccgtcaa ccatagcggt gtgtattcaa acggaaagtc taagatgtgg 120 gaggaaactg aacaagatgc tggagtggac gagcttttgg cgcttttggg ctacaaagtc 180 cggtcctcag acatggcgga agtagctcaa aaactcgaac atctcgaaga agttatgggg 240 caagctcaag aagacggcct ttcgcatcta gcttgcgata ccgttcatta caacccgtct 300 gatttatctt cctggctcga atctatgatt acagagctca acccaccact ggcaaatgat 360 ctgtttctct ctccggcaga gtcgtctact aacaagataa tcttcgatga ttcatcttct 420 tgcgattatg atcttaaagc aattccggga aacgccgttt accctccgat tgttcaatca 480 cccgttcctc caccaaataa aagattcaaa accatgtgcc caacaaatcc atcaatttgg 540 caaactccgg ttcaatctca acaacaccca aatgaaccct ctcgttcagt agttttggtg 600 gattcccaag aaaacggagt ccgattagtt catactttaa tggcttgcgc tgaagcagtg 660 cagcaaaata agttaaaggt ggcagaagca cttgtcaaac aaatcggatt cctagccgtg 720 tcacaaatcg gagcaatgag aaaggtcgcc acctattttg ctgaagcatt ggctcggcga 780 atctaccgat tgtacccaca aaactctcag gattccgcct tcgctgatct acttgaaatg 840 catttctatg aaacctgtcc ttacctaaaa ttcgcccatt tcactgctaa tcaagctata 900 ctcgaagctt ttgctgataa gaaaagggtt cacgtgatag atttcagcat gaaacagggg 960 atgcagtggc cggctttgat gcaagctttg gctttgaggc caggtgggcc gcctactttc 1020 cggttaactg gtattggacc gccgtcgcac gataatacgg atcatttgca ggaagtgggt 1080 tggaaattag ctcaattggc ggaaactatt catgtagaat ttgagtatag agggttcgtg 1140 gcgaatagtt tagctgatct cgatgcatcc atgcttgatc ttcgagaggg tgaaactgtg 1200 gcggtgaact cggttttcga gattcatcag ctcttggctc gaccgggtgc aattgagaag 1260 gtgatggctg ccgttaagga gatgaagccg gagattgtga cggtggtgga gcaggaagct 1320 aatcacaacg gactggtatt cttggaccgg tttaccgagt ctttacatta ttactcgacc 1380 ctttttgact cgttggagag ctgtggtggc ggcgttgaag acggcggacc ggtgagtaac 1440 caggacaagg tgatgtcgga ggtgttcttg ggaaggcaga tctgtaacgt ggtgggttgt 1500 gaaggggttg accggtttga aaggcacgag actttgggtc agtggagaat ccggttcgac 1560 gcggccgggt ttgaggcggt tcacttgggg tctaacgctt ttaagcaggc tagcatgctg 1620 ctggcactgt ttgctggtgg ggatgggtac agagtggagg agaaggaagg gtgtctgatg 1680 ttgggttggc acactcgccc actcattact acctcagcct ggaaactcag tggttaa 1737 <210> 11 <211> 1728 <212> DNA <213> Artificial Sequence <220> <223> PgRGA3 polynucleotide sequence <400> 11 atgaagagag actacccaca acctaatcat agcaccttct ccacagactg tggtggtggc 60 accggtggta gctcctccgt aaataatagc ggcgtgtatt caaatgggaa atctaagatg 120 tgggaggaaa ctgaacaaga cgccggagtt gacgagcttt tggctgttct gggctataaa 180 gtccggtcat ctgacatggc ggatgttgcc cagaaactcg agcacctcga agaagtgatg 240 ggccaagctc aagaagatgg cctttctcat ctcgcttgcg ataccgttca ctacaacccg 300 tccgatctat cgtcttggct cgaatccatg atttctgagc tcgacccacc accaccggga 360 acggatccat ttctcgccca tgcagaattg tctactagca agataatctt tgatgattca 420 tcttcttccg attacgatct taaagcaatc ccaggtaaag ccgtttaccc cacaactatt 480 caatcaccac ttcctccacc aaacaaaaaa ttgaaaatca cgagctcagc ggctccatct 540 atttggccaa ctccagccca atctcaacta cagccaaaag aacactctca gtcagtagtt 600 ttagtggatt ctcaagaaaa cggagtccga ttagtccaca ctttgatggc ttgtgcggaa 660 gctgtgcaac acgataatct aaagctagcg gaagttcttg tcaaacagat cgcattccta 720 gccgtatccc aaatcggagc gatgcgaaag gttgccactt attttgccga agctctggct 780 cgacgaatct accgattata cccacaaaca cctcaagatt ctgcttttgc agatctactg 840 ctaatgcatt tttacgaaac ctgcccgtat ttaaaatttg cccattttac tgctaatcaa 900 gctatactcg aagcttttga tgataagaag agggtacatg tgattgattt tagtatgaaa 960 caggggacgc agtggccggc tttgatgcag gctttggcct tgcgacctgg tgggccgcct 1020 actttccgat taaccgggat tggaccgccg tcccacgata acactgatca tttgcaggat 1080 gtgggttgta aattggctca atttgcggaa actattcatg tcaagttcga gtatagtggg 1140 tttgtggcga acagtttagc tgatctcgat gcttccatgc ttgatcttcg agagggtgaa 1200 accgtggcgg ttaactccgt tttcgagttt catcagctgt tggctcaccc gggtgcaatc 1260 gagaaggtga tggcggcggt gaaggagatg aagccggaga tcgtgacggt ggtggagcag 1320 gaagctaatc ataacggtcc tgttttcttg caccggttta ccgagtcttt gcattattat 1380 tcaaccctat ttgactcttt ggagagttgt ggcggcggtg gaccggcgag taatcaggac 1440 aaggtgatgt cggaggtgtt cttgggcagg cagatatgta acgtggtggc ttgtgaagga 1500 gttgaccgag ttgagaggca cgagactctg ggtcagtgga gaagccggtt cggaagtggc 1560 gggttcgagg cggttcacct gggatccaat gcgtttaagc aggccagtat gctgctggca 1620 gtgtttgctg gtggggatgg gtacagagtg gaggagaacg aagggtgtct gatgctgggt 1680 tggcacactc ggcccctcat tgctacctcg gcgtggaaac tcagtggt 1728

Claims (7)

A recombinant vector for transformation comprising a gene represented by SEQ ID NO: 1, which promotes plant length and volume growth. A composition for promoting length and volume growth of plants comprising the recombinant vector for transformation of claim 1. A transgenic plant with promoted length and volume growth transformed with the recombinant vector for transformation of claim 1. The method of claim 3,
The plant is a transgenic plant, characterized in that the monocotyledonous or dicotyledonous plant. The method of claim 4,
Transgenic plant, characterized in that the dicotyledonous plant is ginseng. The transformed seed of the plant according to claim 3. A method of promoting volume growth of ginseng roots, comprising the step of overexpressing the gene represented by SEQ ID NO: 1 by transforming the recombinant vector for transformation of claim 1 into ginseng cells.

Images