KR102192846B1 - Transgenic avian producing improved monoclonal antibodies specific to human cd20 and a method for producing the same - Google Patents

Abstract

The present invention relates to a transgenic algae producing human CD20 specific monoclonal antibody and a method for producing the same. The method for producing a transgenic algae according to the present invention can produce a transgenic individual that produces a human CD20-specific monoclonal antibody with improved efficacy with high efficiency, and thus can be presented as a new model suitable for biobetter production. . The human CD20-specific monoclonal antibody produced from the transgenic bird according to the present invention is afucosylated as a result of sugar chain structure analysis, and has a higher CDC (complement dependent cytotoxicity, complement-mediated immune response) than the commercial CD20 monoclonal antibody, In the case of ADCC (antibody dependent cell-mediated cytotoxicity, antibody-mediated immune response), it is expected to be widely used as an economical and stable antibody manufacturing method as it is about 8-16 times more efficient than the reference drug.

Description

Transgenic algae producing a human CD20-specific monoclonal antibody with improved efficacy and its manufacturing method {TRANSGENIC AVIAN PRODUCING IMPROVED MONOCLONAL ANTIBODIES SPECIFIC TO HUMAN CD20 AND A METHOD FOR PRODUCING THE SAME}

The present invention relates to a transgenic algae producing a human CD20-specific monoclonal antibody with improved efficacy and a method for producing the same.

The production of transgenic animals using a combination of biotechnology technology using various stem cells and embryos and high-efficiency gene expression control technology is attracting attention as a key technology for the treatment of incurable diseases faced by mankind and the improvement of healthy lifespan.

In the case of chickens, the number of livestock is higher than that of mammalian livestock, and mass production of proteins is possible through eggs, and in the case of eggs (eggs), only 10 kinds of egg proteins are used to separate desired substances from proteins produced through eggs. Because of its ease of purification, it is considered an ideal bioreactor animal. However, the development of technology specialized for birds and the introduction of related technologies were relatively lagging compared to mammals, so there was a limit to the development of practical technologies.

As such, it is well known through existing studies that transgenic chickens have excellent advantages in the production of therapeutic antibodies or functional substances, but due to technical limitations, studies on the production of high-efficiency transgenic algae and production of pharmaceutical proteins through eggs have been conducted. There are few bars.

M.J. Glennie, R.R. French, M.S. Cragg, R.P. Taylor, Mechanisms of killing by anti-CD20 monoclonal antibodies, Mol. Immunol. 44 (2007) 3823-3837. A.J. Harvey, G. Speksnijder, L.R. Baugh, J.A. Morris, R. Ivarie, Expression of exogenous protein in the egg white of transgenic chickens, Nat. Biotechnol. 20 (2002) 396-399.

Accordingly, the present inventors transformed chicken primordial germ cells (PGCs) using a piggyBac transposon containing an Ovalbumin (OV) promoter for specific expression of oviduct in chickens, and thereby It is possible to produce transgenic progeny with high efficiency, and CDC (complement dependent cytotoxicity, complement-mediated immune response) is high, and ADCC (antibody dependent cell-mediated cytotoxicity, antibody-mediated immune response) is high. It was confirmed that the human CD20 specific monoclonal antibody was produced with high efficiency, and the present invention was completed.

Accordingly, an object of the present invention is (a) 5'and 3'piggyBac transposon specific inverted terminal repeats (Terminal Repeat, TR); And (b) an ovalbumin promoter positioned between the 5'TR and the 3'TR, and a gene encoding a human CD20 specific monoclonal antibody operably linked to the ovalbumin promoter. have.

In addition, an object of the present invention is to provide a donor germ cell line transformed with the recombinant vector.

In addition, it is an object of the present invention to provide a method for producing a transgenic avian model producing a human CD20-specific monoclonal antibody comprising the step of transplanting the donor germ cell line into an embryo of a recipient bird.

In addition, an object of the present invention is a transgenic avian model producing a human CD20-specific monoclonal antibody prepared by the above method, and a human CD20-specific comprising the step of obtaining a human CD20-specific monoclonal antibody from the transgenic avian model. It is to provide a method for producing an enemy monoclonal antibody.

In order to achieve the above object, the present invention (a) 5'and 3'piggyBac transposon (piggyBac transposon) specific inverted terminal repeat (Terminal Repeat, TR); And (b) an ovalbumin (OV) promoter positioned between the 5'TR and the 3'TR, and a recombinant vector comprising a gene encoding a human CD20 specific monoclonal antibody operably linked to the ovalbumin promoter. Provides.

In addition, the present invention provides a donor germ cell line transformed with the recombinant vector.

In addition, the present invention provides a method for producing a transgenic avian model producing a human CD20-specific monoclonal antibody comprising the step of transplanting the donor germ cell line into an embryo of a recipient bird.

In addition, the present invention provides a transgenic bird model for producing a human CD20-specific monoclonal antibody prepared by the above method.

In addition, the present invention provides a method for producing a human CD20-specific monoclonal antibody comprising the step of obtaining a human CD20-specific monoclonal antibody from the transgenic avian model.

In addition, the present invention provides a human CD20 specific monoclonal antibody produced by the above method.

The method for producing a transgenic algae according to the present invention can produce a transgenic individual that produces a human CD20-specific monoclonal antibody with improved efficacy with high efficiency, and thus can be presented as a new model suitable for biobetter production. . The human CD20-specific monoclonal antibody produced from the transgenic bird according to the present invention is afucosylated as a result of sugar chain structure analysis, and has a higher CDC (complement dependent cytotoxicity, complement-mediated immune response) than the commercial CD20 monoclonal antibody, In the case of ADCC (antibody dependent cell-mediated cytotoxicity, antibody-mediated immune response), it is expected to be widely used as an economical and stable antibody manufacturing method as it is about 8-16 times more efficient than the reference drug.

1 is a diagram showing a cleavage map of a recombinant vector according to the present invention and a result of confirming whether or not a chicken into which the recombinant vector was transformed. 1a: piggyBac The cleavage map of the cCD20 mAb recombinant vector, b of FIG. 1: a schematic diagram of a transgenic chicken with a transgene (exogenous gene) from G0 to G3, and the result of analyzing the genome of each generation transgenic chicken with a transgene. Figure 1 c: a schematic diagram of a transgene-specific primer set for detecting wild-type and transgenic loci, Fig. 1 d: Heterozygous transgenic chicken using a transgene-specific primer in G2 PCR results of [Tg33(he)4(he)] and homozygous transgenic chicken [Tg33(ho)4(ho)].
FIG. 2 is a diagram showing the results of verification of expression of a transgene specific to the oviduct magnum using a cCD20 mAb-specific primer for tissues of a transgenic chicken.
3 is a diagram showing the result of verifying the gene insertion location of the cCD20 mAb transgene through DNA walking.
FIG. 4 is a diagram showing the confirmation and quantification of cCD20 mAb produced from transgenic chickens by ELISA and Western blot. Figure 4a: The result of measuring the concentration of purified cCD20 mAb through ELISA using an anti-human IgG antibody isolated from G2 Tg4 (he) and G2 Tg33 (he), Figure 4 b: G2 Tg4 (he) and G2 Western blot results of anti-human IgG antibodies expressed in egg whites obtained from Tg33(he) transgenic chickens, Figure 4c: G2 Tg33(he)Tg4(he) and G2 Tg33(ho)4 after SDS-PAGE (ho) Results of Coomassie blue staining to confirm cCD20 mAb in transgenic chickens, Fig.4 d: Quantification results of cCD20 mAb purified from G3 91ho/87ho transgenic chickens through ELISA using anti-human IgG antibody ( ***p <0.001, **p <0.01).
5 is a diagram showing the results of analysis of the N-glycan sugar chain content of cCD20 mAb produced from a transgenic chicken. Figure 5 a: the sugar chain structure of the analysis sample (cCD20 mAb), Figure 5 b: 14 N-glycan profile analysis results through ion extraction chromatography (XIC).
Figure 6 is a diagram showing the results of analyzing the binding force and apoptosis ability of cCD20 mAb produced from a transgenic chicken. Figure 6 a: results of flow cytometry for CD20 binding affinity after treatment with 0.01, 0.05, 0.1, 0.5, 1, 5 or 10 μg/ml of cCD20 mAb, Figure 6 b: 0.01, 0.1, 1, 5 or Analysis of the average fluorescence intensity (MFI) value for each concentration to confirm the binding affinity of cCD20 mAb and rituximab after 10 μg/ml antibody treatment, c in FIG. 6: After 5 μg/ml cCD20 mAb treatment, flow cytometry Results of apoptotic cell analysis in Raji cells by (Rituximab used as a positive control), Fig.6 d: Results of apoptotic cell analysis after treatment with 0.1, 1, or 5㎍/ml antibody (Rituximab used as a positive control, negative control) As the cCD20 mAb untreated group; ***p<0.001, p>0.05 no significant difference).
7 is a diagram showing the results of analysis of CDC activity of cCD20 mAb produced from transgenic chickens (***p<0.001).
Figure 8 is a diagram showing the ADCC activity analysis results of cCD20 mAb produced from a transgenic chicken (***p<0.001).

Hereinafter, the present invention will be described in detail.

The present invention includes (a) 5'and 3'piggyBac transposon-specific inverted terminal repeats (Terminal Repeat, TR); And (b) an ovalbumin (OV) promoter positioned between the 5'TR and the 3'TR, and a recombinant vector comprising a gene encoding a human CD20 specific monoclonal antibody operably linked to the ovalbumin promoter. Provides.

The term “monoclonal antibody” as used herein refers to a highly specific antibody directed against a single antigenic site as a term known in the art. Typically, unlike polyclonal antibodies, which contain different antibodies directed against different epitopes (antigen determinants), monoclonal antibodies are directed against a single determinant on the antigen. Monoclonal antibodies have the advantage of improving the selectivity and specificity of diagnostic and analytical assays using antigen-antibody binding, and have the advantage of not being contaminated by other immunoglobulins because they are synthesized by hybridoma culture. Human CD20 specific monoclonal antibodies of the present specification include functional fragments of antibody molecules as well as whole antibody forms. The whole antibody is a structure having two full-length light chains and two full-length heavy chains, and each light chain is connected to a heavy chain by a disulfide bond. The heavy chain constant region has gamma (γ), mu (μ), alpha (α), delta (δ), and epsilon (ε) types, and subclasses gamma 1 (γ1), gamma 2 (γ2), and gamma 3 (γ3). ), gamma4(γ4), alpha1(α1) and alpha2(α2). The constant region of the light chain has kappa (κ) and lambda (λ) types.

The functional fragment of the antibody molecule means a fragment having an antigen-binding function, and includes Fab, F(ab'), F(ab')2, Fv, and the like. Among antibody fragments, Fab has a structure having a light chain and a heavy chain variable region, a light chain constant region, and a heavy chain first constant region (CH1), and has one antigen-binding site. Fab' differs from Fab in that it has a hinge region containing at least one cysteine residue at the C-terminus of the heavy chain CH1 domain. In the F(ab')2 antibody, a cysteine residue in the hinge region of Fab' forms a disulfide bond. Fv refers to the smallest antibody fragment having only the heavy and light chain variable regions, dsFv (double chain Fv) is a non-covalent bond between the heavy chain variable region and the light chain variable region, and scFv (single chain Fv) is generally a peptide linker. Through this, the variable region of the heavy chain and the variable region of the short chain are connected by covalent bonds or are directly connected at the C-terminus, thereby forming a dimer-like structure such as dsFv.

As used herein, the term'vector' refers to any nucleic acid molecule, preferably a DNA sequence, which causes the promoter to induce the expression of foreign DNA sequences, ie, transcription and translation.

In the present invention, the gene encoding the human CD20 specific monoclonal antibody may be characterized in that it contains an internal ribosome entry site (IRS).

In the present invention, the recombinant vector may be characterized in that it further comprises one or more estrogen response elements (estrogen response element, ERE) located between the 5'TR and 3'TR.

In addition, in the present invention, the recombinant vector may be characterized in that it further comprises a 3'UTR of the ovalbumin gene.

In addition, in the present invention, the recombinant vector may be characterized in that it further comprises a polyadenylation site (poly A).

The estrogen response element is for overexpressing the gene of the present invention, and when it reacts with estrogen, gene expression increases. In addition, ovalbumin is a protein having the highest expression in the oviduct of birds, and the promoter allows it to be specifically expressed in the oviduct (ovalbumin promoter or oviduct specific promoter). In one embodiment of the present invention, the ovalbumin promoter is located between 5'TR and 3'TR, and comprises a sequence encoding OV 5'UTR.

The term'promoter' as used herein refers to a DNA sequence that controls the expression of a coding sequence or functional RNA.

The vector of the present invention may include an antibiotic resistance gene in order to identify the transduced cells, and the antibiotic may be preferably neomycin.

In one embodiment of the present invention, 5'TR and 3'TR are characterized in that they consist of nucleotide sequences represented by SEQ ID NOs: 3 and 11, respectively. In addition, the promoter of ovalbumin (foliar specific promoter) including the 5'UTR of the OV gene is characterized by consisting of a nucleotide sequence represented by SEQ ID NO: 7, and the 3'UTR of the OV gene is represented by SEQ ID NO: 10. It is characterized by consisting of a base sequence. Furthermore, the recombinant vector of the present invention includes a neomycin resistance gene consisting of the nucleotide sequence represented by SEQ ID NO: 5.

Variants of the above nucleotide sequences are considered to be included within the scope of the present invention. Specifically, the gene according to the present invention may include a nucleotide sequence having 70% or more, 80% or more, 90% or more, or 95% or more sequence homology with the nucleotide sequence, respectively.

In the present invention, the gene encoding the human CD20 specific monoclonal antibody is a gene encoding the light chain region of the human CD20 specific monoclonal antibody represented by SEQ ID NO: 1 and a human CD20 specific single antibody represented by SEQ ID NO: 2 It may be characterized by including a gene encoding the heavy chain region of the clonal antibody.

More specifically, the gene encoding the light chain region of the human CD20-specific monoclonal antibody represented by SEQ ID NO: 1 is an antibody expression site gene sequence that expresses the kappa light chain of an antibody that binds to the human CD20 antigen. It is a sequence that encodes both the light chain variable region and the light chain constant region of the mAb (V _L + hIg kappa region), and the amino acids translated by the sequence constitute the kappa of the light chain variable region and constitute a part of the Fab fragment. In addition, the gene encoding the heavy chain region of the human CD20 specific monoclonal antibody represented by SEQ ID NO: 2 encodes both the heavy chain variable region (CDR) and the heavy chain constant region (CH1, CH2, CH3) of the anti-CD20 mAb. Sequence (V _H + hIgG constant region), and the amino acids translated by that sequence constitute part of the Fab fragment and the Fc fragment of the antibody. Using this, immune cells can recognize the antibody and induce an antibody-mediated immune response (Antobody dependent cell cytotoxicity, ADCC).

In addition to SEQ ID NO: 1 or 2, variants of the above sequences are considered to be included within the scope of the present invention. Variant refers to a polynucleotide consisting of a nucleotide sequence that has a functional property similar to that of SEQ ID NO: 1 or 2, ie, a light chain region or a heavy chain region of a human CD20 specific monoclonal antibody, although the nucleotide sequence is changed. . Specifically, the gene encoding the human CD20-specific monoclonal antibody according to the present invention is a base having 70% or more, 80% or more, 90% or more, or 95% or more sequence homology with the nucleotide sequence of SEQ ID NO: 1 or 2, respectively. Sequence.

In the present invention, the gene encoding the human CD20 specific monoclonal antibody may be characterized by codon-optimized for efficient expression in chickens.

The term'codon optimization' as used herein refers to converting the nucleotide sequence of a gene so that when a specific gene is expressed in another individual, the gene can express a protein having the same amino acid sequence. When the gene encoding the codon-optimized human CD20-specific monoclonal antibody of the present invention is expressed in birds, it can produce a protein having the same amino acid sequence as when expressed in humans, and in the present specification c (chickenized) It is used in combination with CD20.

In addition, the recombinant vector according to the present invention is a gene encoding the light chain region of the human CD20-specific monoclonal antibody represented by SEQ ID NO: 1 and the heavy chain region of the human CD20-specific monoclonal antibody represented by SEQ ID NO: 2 It may include pIRES intron and IRES between genes. The pIRES intron is an intron sequence of IRES that enables gene translation by IRES to occur efficiently, and an internal ribosome entry site (IRS) is a site to which ribosomes bind during protein translation and exists between the genes to efficiently translate Make it happen. In one embodiment of the present invention, the IRES is present between the gene expressing the V _L + hIg kappa region and the gene expressing the V _H + hIgG constant region, so that the intact form of the human CD20 mAb in the protein translation process after transcription By expression, the expression of the desired antibody can be induced by transduction of one expression vector.

In one embodiment of the present invention, the recombinant vector is 5'TR, poly A, neomycin resistance gene (Neo ^R ), SV40, OV promoter (OV 3.5), human CD20 specific chickenized monoclonal antibody (cCD20 mAb) , 3'UTR of the OV gene (OV 3'UTR) and a gene encoding 3'TR. In addition, the human CD20 specific monoclonal antibody may include a gene encoding a V _L + hIg kappa region, pIRES intron, IRES and V _H + hIgG constant region.

In addition, the present invention provides a donor germ cell line transformed with the recombinant vector.

In the present invention, the donor germ cell line may be characterized in that the donor algal primordial germ cells (PGCs). In addition, the primitive germ cells may be characterized in that it is derived from the primitive reproductive organs of a 1-10 day old embryo of the donor bird.

In the present invention, the donor bird includes chicken, quail, turkey, duck, goose, pheasant and pigeon, and may be characterized in that it is preferably a chicken.

In addition, in the present invention, the donor germline cell line may be characterized in that the accession number is KCLRF-BP-00431.

In addition, the present invention provides a method for producing a transgenic avian model producing a human CD20 specific monoclonal antibody comprising the step of transplanting the donor germ cell line according to the present invention into an embryo of a recipient bird. In a preferred embodiment of the present invention, the transgenic bird model of the present invention may be transformed with a vector for transformation having a cleavage map of FIG. 1 a. The transgenic avian model can produce a human CD20 specific monoclonal antibody.

In addition, the present invention provides a method for producing a human CD20-specific monoclonal antibody comprising the step of obtaining a human CD20-specific monoclonal antibody from the transgenic avian model, and a human CD20-specific monoclonal antibody produced by the method. to provide.

The monoclonal antibody of the present invention may be used without purification, but may be purified and used according to a method commonly used in the art. Examples of such purification methods include dialysis, salt precipitation, ion exchange chromatography, size exclusion chromatography, and affinity chromatography, but the antibody purification method of the present invention is not limited by the above examples.

In addition, as long as the monoclonal antibody of the present invention recognizes a specific epitope of an antigen and has the binding properties of an antigen-antibody complex, not only the complete form having two full-length light chains and two full-length heavy chains, but also the antibody molecule Includes functional fragments. The functional fragment of an antibody molecule refers to a fragment having at least an antigen-binding function, and may be Fab, F(ab'), F(ab')2, Fv, and the like.

In the transgenic avian model of the present invention, a human CD20-specific monoclonal antibody is specifically expressed in the fallopian tube and accumulated in the egg white to produce a human CD20-specific monoclonal antibody with high efficiency.

The human CD20 specific monoclonal antibody may be characterized by afucosylation. Furthermore, as a result of non-fucosylation, it may be characterized in that the cellular immune function by the Fc domain is improved. Specifically, in an embodiment of the present invention, the human CD20-specific monoclonal antibody produced according to the present invention has a higher CDC (complement dependent cytotoxicity, complement-mediated immune response) than a commercial CD20 monoclonal antibody as a result of non-fucosylation. , In the case of ADCC (antibody dependent cell-mediated cytotoxicity, antibody-mediated immune response), it is confirmed that the efficiency is about 8-16 times higher than that of the reference drug. In the above example, rituximab was used as a reference drug.

The term "non-fucosylated" as used herein refers to an antibody in which fucose residues have been removed. In addition to galactosylation, non-fucosylation is widely known as an important sugar chain modification method that has a great influence on ADCC and CDC of antibodies.

Furthermore, the human CD20-specific monoclonal antibody is characterized in that it can exhibit a therapeutic effect on CD20-expressing cancers according to an increased ADCC (antibody-mediated immune response).

The term'CD20 expression' as used herein refers to a significant expression level of CD20 on the cell surface of a tumor or a cell from a cancer, preferably a non-solid tumor, preferably a T or B cell, more preferably a B cell. It is intended to represent an antigen.

The term'CD20 expressing cancer' as used herein refers to all cancers in which cancer cells express the CD20 antigen. Such CD20 expressing cancers are, for example, lymphoma, lymphocytic leukemia, lung cancer, non-small cell lung (NSCL) cancer, bronchoalveolar lung cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, Ovarian cancer, rectal cancer, anal cancer, gastric cancer, gastrointestinal cancer, colon cancer, breast cancer, uterine cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, Parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, bladder cancer, kidney or ureter cancer, kidney cell carcinoma, renal pelvic carcinoma, mesothelioma, hepatocellular carcinoma, bile duct cancer, neoplasms of the central nervous system (CNS), spine It may be a tumor, cerebral stem glioma, glioblastoma polymorphic, astrocytoma, schwannoma, ventricular cell tumor, medulloblastoma, meningioma, squamous cell carcinoma, pituitary adenoma, including refractory types of any of the above cancers, or one of the above cancers It may be a combination of the above. Patients with'CD20 expressing cancer' can be determined by standard assays known in the art. For example, CD20 antigen expression can be measured via immunohistochemistry (IHC) detection, FACS, or PCR-based detection of the corresponding mRNA.

Therefore, the transgenic algal model of the present invention and the human CD20-specific monoclonal antibody produced through it can be usefully used in related fields, including pharmaceuticals, such as pharmaceutical compositions.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

Example 1. Experimental animal model

All animal experiments were performed under the approval of the Seoul National University Animal Testing Center (SNU-150827-1). The chickens used in the experiment were maintained and managed according to the standard management program of the animal farm of Seoul National University, and the management, reproduction, and embryo manipulation of animals were carried out in accordance with the standard protocol of the Department of Animal Genetics Engineering, Seoul National University.

Example 2. piggyBac Anti-CD20 mAb Expression recombinant vector construction

The piggyBac OV anti-CD20 mAb expression recombinant vector was constructed using piggyBac transposon. Wherein -CD20 mAb (monoclonal antibody, monoclonal antibody) gene Gallus gallus Codon Usage database: was codon optimized for using (https //www.kazusa.or.jp/codon) suitable for expression in the hen. The codon optimized chickenized CD20 mAb (cCD20 mAb) gene contains a chicken lysozyme signal peptide sequence with a V _L + hIg kappa region corresponding to the light chain and a V _H hIgG constant region corresponding to the heavy chain. It was connected to an internal ribosome entry site (IRS). The expression cassette was used as a 1.4 kb OV promoter and a 1.6 kb OV 5'UTR region; It was ligated to a piggyBac backbone containing a 1.6 kb OV 3'UTR region containing a poly-A tail sequence. The cleavage map of the recombinant vector is shown in FIG. 1A. Sequence information of all used genes, 3'UTR, 5'TR, 3'TR and promoters is shown in Table 1 below.

name Sequence (5'-3') Sequence number Light chain of human CD20 mAb (V _L + hIg Kappa) ATGGATTTTCAGGTGCAGATTATCAGCTTCCTGCTAATCAGTGCTTCAGTCATAATGTCCAGAGGACAAATTGTTCTCTCCCAGTCTCCAGCAATCCTGTCTGCATCTCCAGGGGAGAAGGTCACAATGACTTGCAGGGCCAGCTCAAGTGTAAGTTACATCCACTGGTTCCAGCAGAAGCCAGGATCCTCCCCCAAACCCTGGATTTATGCCACATCCAACCTGGCTTCTGGAGTCCCTGTTCGCTTCAGTGGCAGTGGGTCTGGGACTTCTTACTCTCTCACCATCAGCAGAGTGGAGGCTGAAGATGCTGCCACTTATTACTGCCAGCAGTGGACTAGTAACCCACCCACGTTCGGAGGGGGGACCAAGCTGGAAATCAAACGAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGTTAG One Heavy chain of human CD20 mAb (V _H hIgG constant) ATGGGTTGGAGCCTCATCTTGCTCTTCCTTGTCGCTGTTGCTACGCGTGTCCTGTCCCAGGTACAACTGCAGCAGCCTGGGGCTGAGCTGGTGAAGCCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACATTTACCAGTTACAATATGCACTGGGTAAAACAGACACCTGGTCGGGGCCTGGAATGGATTGGAGCTATTTATCCCGGAAATGGTGATACTTCCTACAATCAGAAGTTCAAAGGCAAGGCCACATTGACTGCAGACAAATCCTCCAGCACAGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCGGTCTATTACTGTGCAAGATCGACTTACTACGGCGGTGACTGGTACTTCAATGTCTGGGGCGCAGGGACCACGGTCACCGTCTCTGCAGCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTACTTCCCCGAACCGGTGACGGTGTCGTGGAACTCAGGCGCCCTGACCAGCGGCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTCAGCAGCGTGGTGACCGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACATCTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTGGACAAGAGAGTTGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACC AGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGAGGAGATGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTATAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCCCCGGGTAAATGAGG 2 5'TR ATGCGTCAATTTTACGCAGACTATCTTTCTAGGG 3 Poly A GAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTG 4 Neomycin-resistance gene ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGTGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGA 5 SV40 GGGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCG 6 3.5kb OV promoter TGACACCAGATGACAGAGAAGTGCATCTGAGAAAACCTATTCCCAATCTCCTTTCTCTTTCTGCAGACTGACATGCATTTCATAGGTAGAGATAACATTTACTGGGAAGCACATCTATCATCACAAAAAGCAGGCAAGATTTTCAGACTTTCTTAGTGGCTGAAATAGAAGCAAAAGACGTGATTAAAAACAAAATGAAACAAAAAAAATCAGTTGATACCTGTGGTGTAGACATCCAGCAAAAAAATATTATTTGCACTACCATCTTGTCTTAAGTCCTCAGACTTGGCAAGGAGAATGTAGATTTCCACAGTATATATGTTTTCACAAAAGGAAGGAGAGAAACAAAAGAAAATGGCACTGACTAAACTTCAGCTAGTGGTATAGGAAAGTAATTCTGCTTAACAGAGATTGCAGTGATCTCTATGTATGTCCTGAAGAATTATGTTGTACTTTTTTCCCCCATTTTTAAATCAAACAGTGCTTTACAGAGGTCAGAATGGTTTCTTTACTGTTTGTCAATTCTATTATTTCAATACAGAACAATAGCTTCTATAACTGAAATATATTTGCTATTGTATATTATGACTGTCCCTCGAACCATGAACACTCCTCCAGCTGAATTTCACAATTCCTCTGTCATCTGCCAGGCCATTAAGTTATTCATGGAAGATCTTTGAGGAACACTGCAAGTTCATATCATAAACACATTTGAAATTGAGTATTGTTTTGCATTGTATGGAGCTATGTTTTGCTGTATCCTCAGAATAAAAGTTTGTTATAAAGCATTCACACCCATAAAAAGATAGATTTAAATATTCCAACTATAGGAAAGAAAGTGTGTCTGCTCTTCACTCTAGTCTCAGTTGGCTCCTTCACATGCACGCTTCTTTATTTCTCCTATTTTGTCAAGAAAATAATAGGTCAAGTCTTGTTCTCATTTATGTCCTGTCTAGCGTGGCTCAGATGCACATTGTACATACAAGAAGGATCAAATGAA ACAGACTTCTGGTCTGTTACTACAACCATAGTAATAAGCACACTAACTAATAATTGCTAATTATGTTTTCCATCTCCAAGGTTCCCACATTTTTCTGTTTTCTTAAAGATCCCATTATCTGGTTGTAATTGAAGCTCAATGGAACATGAGCAATATTTCCCAGTCTTCTCTCCCATCCAACAGTCCCGATGGATTAGCAGAACAGGCAGAAAACACATTGTTACCCAGAATTAAAAACTAATATTTGCTCTCCATTCAATCCAAAATGGACCTATTGAAACTAAAATCTAACCCAATCCCATTAAATGATTTCTATGGTGTCAAAGGTCAAACTTCTGAAGGGAACCTGTGGGTGGGTCACAATTCAGACTATATATTCCCCAGGGCTCAGCCAGTGTCTGTACATACAGCTAGAAAGCTGTATTGCCTTTAGCAGTCAAGCTCGAAAGGTAAGCAACTCTCTGGAATTACCTTCTCTCTATATTAGCTCTTACTTGCACCTAAACTTTAAAAAATTAACAATTATTGTGCTATGTGTTGTATCTTTAAGGGTGAAGTACCTGCGTGATACCCCCTATAAAAACTTCTCACCTGTGTATGCATTCTGCACTATTTTATTATGTGTAAAAGCTTTGTGTTTGTTTTCAGGAGGCTTATTCTTTGTGCTTAAAATATGTTTTTAATTTCAGAACATCTTATCCTGTCGTTCACTATCTGATATGCTTTGCAGTTTGCTTGATTAACTTCTAGCCCTACGGAGTGCACAGAGAGCAAAATCATGGTGTTCAGTGAATTCTGGGGAGTTATTTTAATGTGAAAATTCTCTAGAAGTTTAATTCCTGCAAAGTGCAGCTGCTGATCACTACACAAGATAAAAATGTGGGGGGTGCATAAACGTATATTCTTACAATAATAGATACATGTGAACTTATATACAGAAAAGAAAATGAGAAAAATGTGTGTGTGTATACTCACACACGTGGTCAGTAAAAACTTTTGA GGGGTTTAATACAGAAAATCCAATCCTGAGGCCCCAGCACTCAGTACGCATATAAAGGGCTGGGCTCTGAAGGACTTCTGACTTTCACAGATTATATAAATCTCAGGAAAGCAACTAGATTCATGCTGGCTCCAAAAGCTGTGCTTTATATAAGCACACTGGCTATACAATAGTTGTACAGTTCAGCTCTTTATAATAGAAACAGACAGAACAAGTATAAATCTTCTATTGGTCTATGTCATGAACAAGAATTCATTCAGTGGCTCTGTTTTATAGTAAACATTGCTATTTTATCATGTCTGCATTTCTCTTCTGTCTGAATGTCACCACTAAAATTTAACTCCACAGAAAGTTTATACTACAGTACACATGCATATCTTTGAGCAAAGCAAACCATACCTGAAGGTGCAATAGAGCAGAATATGAATTACATGCGTGTCTTTCTCCTAGACTACATGACCCCATATAAATTACATTCCTTATCTATTCTGCCATCACCAAAACAAAGGTAAAAATACTTTTGAAGATCTACTCATAGCAAGTAGTGTGCAACAAACAGATATTTCTCTACATTTATTTTTAGGGAATAAAAATAAGAAATAAAATAGTCAGCAAGCCTCTGCTTTCTCATATATCTGTCCAAACCTAAAGTTTACTGAAATTTGCTCTTTGAATTTCCAGTTTTGCAAGCCTATCAGATTGTGTTTTAATCAGAGGTACTGAAAAGTATCAATGAATTCTAGCTTTCACTGAACAAAAATATGTAGAGGCAACTGGCTTCTGGGACAGTTTGCTACCCAAAAGACAACTGAATGCAAATACATAAATAGATTTATGAATATGGTTTTGAACATGCACATGAGAGGTGGATATAGCAACAGACACATTACCACAGAATTACTTTAAAACTACTTGTTAACATTTAATTGCCTAAAAACTGCTCGTAATTTACTGTTGTAGCCTACCATAGAGTACCCTGCATGGTACTATGTACAGCATT CCATCCTTACATTTTCACTGTTCTGCTGTTTGCTCTAGACAACTCAGAGTTCACC 7 pIRES intron GTTGGGGTGAGTACTCCCTCTCAAAAGCGGGCATGACTTCTCTGCGCTAAGCTCAGGCTACACTGCACACTGCACACTCCGCACTCCGCAAAAACGAGGAGGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGGCCGCGTCCATCTGGTCAGAAAAGACAATCTCTTTTTGTTGTCTCAAGCTTGAGGTGTGGCAGGCCCTCGATGATCGGCACACT 8 IRES GCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACG 9 3'UTR AAAGAAGAAAGCTGAAAAACTCTGTCCCTTCCAACAAGACCCAGAGCACTGTAGTATCAGGGGTAAAATGAAAAGTATGTTATCTGCTGCATCCAGACTTCATAAAAGCTGGAGCTTAATCTAGAAAAAAAATCAGAAAGAAATTACACTGTGAGAACAGGTGCAATTCACTTTTCCTTTACACAGAGTAATACTGGTAACTCATGGATGAAGGCTTAAGGGAATGAAATTGGACTCACAGTACTGAGTCATCACACTGAAAAATGCAACCTGATACATCAGCAGAAGGTTTATGGGGGAAAAATGCAGCCTTCCAATTAAGCCAGATATCTGTATGACCAAGCTGCTCCAGAATTAGTCACTCAAAATCTCTCAGATTAAATTATCAACTGTCACCAACCATTCCTATGCTGTCAAGGCAATTGCTTGTTCTCTGTGTTCCTGATACTACAAGGCTCTTCCTGACTTCCTAAAGATGCATTATAAAAATCTTATAATTCACATTTCTCCCTAAACTTTGACTCAATCATGGTATGTTGGCAAATATGGTATATTACTATTCAAATTGTTTTCCTTGTACCCATATGTAATGGGTCTTGTGAATGTGCTCTTTTGTTCCTTTAATCATAATAAAAACATGTTTAAGCAAACACTTTTCACTTGTAGTATTTGAAGTACAGCAAGGTTGTGTAGCAGGGAAAGAATGACATGCAGAGGAATAAGTATGGACACACAGGCTAGCAGCGACTGTAGAACAAGTACTAATGGGTGAGAAGTTGAACAAGAGTCCCCTACAGCAACTTAATCTAATAAGCTAGTGGTCTACATCAGCTAAAAGAGCATAGTGAGGGATGAAATTGGTTCTCCTTTCTAAGCATCACCTGGGACAACTCATCTGGAGCAGTGTGTCCAACCTGCCGCTGCCCTGATCCTGGCTGGGGTGATGGGACAGACCTTGGCTGCCACTGAGACATCTGAGACACTGAGATCTGTCTCAACT CAGATTTACCCAAGAACAGCTCATTGCCAACAGAACAAAATCTCAAACTTATGGCTAGTGATGACAGCAGTCAGTTGTCCCATCTGTGACCCACCAAGGCTGGCATGCTGGAATGAGCAGGCTTTGGTGGCTTGTAGTTACTGGACAGCACCACTGACATGGGCAGGGGAAAAACTGAGCATGGTGTAAATCACTGCCTCAAAGCCACTTCTCTGTGCCTGCACCATGCTTGAAAGCTCTTCTACAGGAGCTGGGTTTGTTCAAGAAAGCTTCTGTTTCTCCCATCTGCTTCTTGTACCTTCACAGGGACAGAGTTAGAAGGGTACAGCCATGGCTGGAAGGGGCTGACTTTCAAATGTGCCTAATTTTCCTTTGGTTGCTGCTGCAGCTGCAGAAGAAGGGGTTCAGAAGCCAAGAGCTTTGAGATAAGGATGCCTAACCTATGTTGAAGACATTTGTGCTGACACCTCAGGCCCCAGGATAGGACAACTGCTGGATTGTGGCTAACCCACTAGCTACAGAACCTAATTTATATTACCAGATTAGGAAGAGCAAAAGAACATGTATTTATAACAGGAGGTCTTCTGTGCTTCTCTACTAAAAGGTGCTGTGAAGGAGCCCACAGTGC 10 3'TR CATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCACAATATGATTATCTTTCTAGGG 11

Example 3. Transfection and through G418 Of primitive germ cells (PGCs) Selection

A male primitive germ cell (gPGC) line was established from the embryonic gonad of a 6-day-old (stage 28) White Leghorn (WL) embryo. The primitive germ cells were treated with 60-70% relative humidity, 5% carbon dioxide, and 20% (v/v) fetal bovine serum (FBS; Invitrogen, Life Technologies), 2% (v/v) chicken serum ( Sigma-Aldrich, St.Louis, MO, USA), 13 nucleoside mix (EMD Millipore, Temecula, CA, USA), 2 mM L-glutamine, 13 non-essential amino acid mix, 2-ME, 10 mM sodium pyruvate ) And Knockout DMEM ((Invitrogen, Life Technologies, Carlsbad, CA, USA) supplemented with 1x antibiotic-antimycotic (Invitrogen, LifeTechnologies). Maintained in medium. To activate primitive germ cell proliferation For this purpose, human basic fibroblast growth factor (10 ng/ml; Koma Biotech, Seoul, Korea) was used, and the cultured primitive germ cells were mitomycin-inactivated mice every 5-6 days. It was subcultured on embryonic fibroblasts The cCD20 mAb expression vector and CAGG-PBase (pCyL43) prepared in Example 2 were mixed with Lipofectamine 2000 reagent (Invitrogen, Life Technologies) and introduced into a primitive germ cell line to co-transfect One day after the transformation was performed, G418 (300 µg/ml) was added to the culture medium to select 2xERE-OV anti-CD20 mAB colonies, which took up to 3 weeks. .

Example 4. Injection of germ cells into recipient embryos and screening of transgenic chickens

In order to inject the transfected primitive germ cells selected in Example 3 into the receptor embryo, a small window was created at the tip of the receptor Ogye (KO) egg (HH stage 14-17), and at least 3000 primitive reproductions 2 μL of the cell suspension containing cells was injected into the dorsal aorta of the recipient embryo (microinjection). The window formed on each egg was sealed with a paraffin film, and the tip was kept downward until screening and hatching. After sex maturation, between a transformed chicken with a pigmentation inhibitory dominant gene ( I/I ) and a wild-type chicken with a pigmentation inhibitory recessive gene ( i/i ) to obtain progeny from donor primitive germ cells. Testcrossing was performed. As a result, 46 chicks hatched from 104 embryos used (44.2%).

Additionally, PCR was performed to confirm tissue-specific expression of transgenic chickens. Gene sites including wild-type and transformed target sites were amplified using primers specific to the cCD20 mAb sequence. PCR was performed using 10x PCR buffer (CoreBioSystem, Seoul, Korea), 1.6ml dNTPs (10mM each), 5pmol of each primer and 0.5 U Taq polymerase (CoreBioSystem) for a total of 20ml of 100ng genomic DNA under the following conditions. The first denaturation was repeated once at 94° C. for 5 minutes, and then the steps of denaturing at 94° C. for 30 seconds, annealing at 60° C. for 30 seconds, and extending at 72° C. for 30 seconds were repeated 30 times. And finally, the post-extension was repeated once at 72° C. for 10 minutes. 2 shows the results of the PCR. All primers used are shown in Table 2 below, and wild-type (WT) DNA was used as a negative control.

primer Sequence (5'→3') Size (bp) location Sequence number Ch33 F GTC GGG GCT CAT CTC TCC CT 431 Ch33 wild-type locus 12 Ch33 wild-type locus R GCG CCA AGT GAC GAT CTG GT 13 Ch33 F GTC GGG GCT CAT CTC TCC CT 610 Ch33 transgene locus 14 Ch33 transgene locus R CCG CTA GCC AAC AAG CTC GT (vector seq) 15 Ch4 F AGA AGC ACA ATA GAG CAA AGG ATG GAA 315 Ch4 wild-type locus 16 Ch4 wild-type locus R TCC TGT GAT GCT CCA GGC CT 17 Ch4 F AGA AGC ACA ATA GAG CAA AGG ATG GAA 480 Ch4 transgene locus 18 Ch4 transgene locus R AGC TCG TCA TCG CTT TGC AGA (vector seq) 19 piggyBac TSP1 ^* GGATCTCATGCTGGAGTTCT - Integration site 20 piggyBac TSP2 GGCGTAATCATGGTCATAGCT - Integration site 21 piggyBac TSP3 GAGCCGGAAGCATAAAGTGT - Integration site 22 cCD20 transgene F ACCCCTGAGGTCACATGCGT 423 cCD20 transgene 23 cCD20 transgene R GGGAGGCGTGGTCTTGTAGT 24

As shown in FIG. 2, cDNA obtained from untransformed chickens was negative for cCD20 specific primer, and cDNA of oviduct magnum obtained from transformed chickens was positive for cCD20 specific primers. Was confirmed.

Example 5. According to DNA walking Transgene ( transgene ) Check the insertion site

DNA Walking SpeedUp Premix Kit-II (Seegene, Seoul, Korea) was used according to the manufacturer's protocol to identify the transgene (foreign gene) insertion site. The PCR product subjected to DNA walking 3 times was extracted from the agarose gel, purified using Power Gel Extraction Kit (Promega, Madison, WI, USA), and cloned into pGEM-T Easy Vector (Promega). The cloned PCR products were sequenced using an ABI Prism 3730 XL DNA Analyzer (Applied Biosystems, Foster City, CA, USA). BLAST Assembled Genome database ( http://blast.ncbi.nlm.nih.gov/BLAST.cgi ) and UCSC Genome Bioinformatics' browser (http://www.genome) to identify the transgene insertion site in transformed chickens .ucsc.edu) was used to analyze the 5'flanking region. The results are shown in FIG. 3.

As shown in Figure 3, it was confirmed that 4 males (#9107, #9187, #9615, and #9643) and 2 females (#9191 and #9184) possessed the cCD20 mAb transgene. Among them, male #9187 with a transgene inserted into chromosome 4 and female #9191 with a transgene inserted into chromosome 33 were used for later experiments.

Example 6. Transgene Genomic Analysis ( genotyping )

To produce a homozygous chicken with two cCD20 mAb transgenes (transgenes) at the same location, a Tg4 (G1) transgenic male with a cCD20 mAb transgene on chromosome 4 and a cCD20 mAb on chromosome 33 Tg33 (G1) transgenic females carrying the transgene were assay-crossed with wild-type chickens of different sexes. Subsequently, the transgenic progeny (G2) produced from the G1 chicken was crossed with a transgenic chicken having a transgene in another locus. In order to produce 4 copies of a homozygous chicken carrying a homozygous transgene on both chromosome 4 and chromosome 33, a Tg33 type transgenic male (G2) and a Tg4 type transgenic female were crossed. A pedigree of rooster Tg33 and hen Tg4 from G0 to G3 produced through the above process is shown in b of FIG. 1.

Gene sites including wild type and transformed target sites were amplified using specific primer sets. A schematic diagram of a transgene-specific primer set for detecting the wild-type and transgenic loci is shown in FIG. 1C. When the transformed target site is present, the forward primer binds to the chicken genome, and the reverse primer binds to the chicken genome or transgene. PCR was carried out under the following conditions: the primary denaturation was repeated once at 94° C. for 5 minutes, and then denaturation at 94° C. for 30 seconds, annealing at 60° C. for 30 seconds, and 72° C. for 30 seconds. The step of extending from was repeated 35 times, and finally, post-extending was repeated once at 72° C. for 7 minutes. The results are shown in FIG. 1D.

Hereinafter, the G2 descendant having one copy at the same position as the Tg33 G1 transgenic chicken is Tg33(he), the G2 descendant having one copy at the same position as the Tg4 G1 transgenic chicken is Tg4(he), and two positions. G2 descendants with 2 copies in all were expressed as Tg33(he)4(he). For example, in Tg33(he)4(he), 431bp, 610bp, 315bp, and 480bp amplicons were all obtained, confirming that the transgene was expressed in both chromosome 33 and 4 locus. Furthermore, when a transgenic chicken (91he/87he) with two copies of the transgene is crossed with a transgenic chicken with the same genome, 4 copies of the homozygous transgene on both chromosomes 4 and 33 are homozygous. It was confirmed that conjugated chickens [Tg33(ho)4(ho)] were produced.

Example 7. Extraction and purification of human antibodies from egg whites of transgenic hens

The egg white obtained from the transgenic chicken prepared in Example 4 was sheared at 25° C. for 30 minutes and homogenized. 3 volumes of reverse osmosis water were added to the egg white suspension and stirred for 30 minutes. The egg white suspension was adjusted to pH 6.0 with 0.5M phosphoric acid, and centrifuged at 12,100 x g for 20 minutes to remove most of the egg white proteins including ovomucin. Next, the supernatant was adjusted to pH 7.4 using 0.5M dibasic sodium phosphate, and the sample was filtered using a 0.2 μM syringe filter, and then a Protein A column (5 ml; GE Healthcare) Was used to purify human IgG. For equilibration, the Protein A column was washed with a 5 column volume loading buffer (20 mM sodium phosphate, pH 7.4), and 200 ml of a sample was loaded onto the column, followed by washing with a 16 column volume loading buffer. Here, a human IgG protein was obtained using an elution buffer (100 mM sodium citrate, pH 3.0) of 3 times the column volume.

Western blot was performed by loading the purified cCD20 mAb on a 10% SDS-PAGE gel. The dissolved protein was transferred to Hybond 0.45 PVDF membrane (GE Healthcare Life Sciences, Little Chalfont, UK) and blocked with 5% skimmed milk at room temperature for 1 hour. Chemiluminescence was detected using the ECL kit (GE Healthcare Life Sciences), and the antibodies used were as follows: goat anti-Human IgG (H+L) primary antibody (1:1000) diluted with blocking buffer ( Alpha diagnostic), horseradish peroxidase-conjugated secondary antibody diluted 1:10000 (Thermo Fisher Scientific). The results are shown in a to d of FIG. 4.

As shown in Fig. 4a, the concentration of mAb was an average of 2.04 μg/ml in the case of Tg4(he) and 2.21 μg/ml in the case of Tg33(he), and there was no statistically significant difference. Confirmed. In addition, as shown in FIG. 4B, as a result of Western blot, both light and heavy chains corresponding to anti-human IgG antibodies were detected in the purified egg whites of both transgenic hens, and through this, cCD20 mAb was successfully performed in chicken individuals. It was confirmed that it was expressed and produced through egg white.

As shown in c of FIG. 4, the mAb in the non-reduced form purified through SDS-PAGE showed a size of 150 kDa, and in the case of the reduced mAb, two heavy chains (H, about 50 kDa) and light chains (L, about 25 kDa) ).

In addition, as shown in d of FIG. 4, as a result of ELISA analysis, Tg33(he)4(he) having two transgenes compared to Tg4(he) showed a significantly higher amount of antibody expression, and four transgenes were It was confirmed that a higher amount of antibody was expressed in the possessed Tg33(ho)4(ho).

Example 8. Anti-CD20 produced in transgenic chickens mAb Sugar chain Content analysis

In order to analyze the sugar chain content of the cCD20 mAb obtained in Example 7 above, antibody N-glycan analysis was performed. Specifically, for N-glycan analysis, PNGase F was treated in the antibody according to the LC/MS/MS test method to isolate only charged N-glycans and fluorescently label them to perform analysis. The results are shown in FIG. 5.

As shown in FIG. 5A, 14 kinds of N-glycans were identified in 200 μg of purified cCD20 mAb as a result of the analysis. As shown in FIG. 5B, cCD20 mAb produced from transgenic chicken egg whites contained galactose residues, whereas eight of the 14 major glycans (74.1%) were non-fucosylated in all glycans. I did.

Example 9. CD20 Fab Cohesion analysis

To evaluate the binding ability of cCD20 mAb produced from transgenic chickens to CD20 antigen, two types of cCD20 mAb Tg33(he)4(he) and Tg33(ho)4(ho) produced from transgenic chickens were used. Then, flow cytometry was performed. Specifically, the cCD20 mAb and rituximab (rituximab; MabThera, Roche) were treated with Raji cells, which are B lymphocyte cell lines expressing CD20. Cells were incubated with monoclonal antibodies at 0.01, 0.05, 0.1, 0.5, 1, 5 and 10 μg/ml concentrations for 30 minutes at room temperature, and conjugated using FITC-conjugated goat anti-human IgG (Invitrogen). Clonal antibodies were detected. Then, the cells were analyzed using FACSCalibur. The results are shown in FIG. 6.

As shown in FIG. 6A, the binding capacity of cCD20 mAb to Raji cells was similar to that of rituximab used as a control in all concentration ranges. On the other hand, as shown in b of FIG. 6, it was confirmed that the binding efficiencies of all the control and experimental groups were very similar at the concentrations of 0.01, 0.1, 1, 5 and 10 μg/ml. Through this, it was confirmed that the cCD20 mAb produced in the transgenic chicken has a Fab binding ability similar to that of the commercial CD20 mAb rituximab.

Example 10. Analysis of cell death ability

Apoptosis ability was measured by flow cytometry (FACSCalibur, BD Biosciences, San Jose, CA, USA) by staining Raji cells with Annexin V/PI (Thermo Fisher Scientific) together. Cells negative for Annexin V were considered survival, and cells positive for Annexin V were considered apoptosis. The results are shown in c and d of FIG. 6.

As shown in FIG. 6, it was confirmed that the experimental group treated with two types of cCD20 mAb Tg33(he)4(he) and Tg33(ho)4(ho) exhibited a higher level of apoptosis than the control group. Specifically, as shown in c of FIG. 6, it was confirmed that the amount of dead cells after mAb treatment (60.7% and 55.3%) was significantly increased compared to the commercial CD20 mAb rituximab treatment group (42.8%). In addition, as shown in FIG. 6D, in the case of apoptosis by concentration of the treated antibody, it was confirmed that the cCD20 mAb treatment group showed significantly higher efficiency compared to the rituximab treatment group. Through this, it was confirmed that the cCD20 mAb produced in the transgenic chicken has a significantly higher apoptosis ability than the commercial CD20 mAb rituximab.

Example 11. CDC analysis

Complement-dependent cytotoxicity (CDC) analysis was performed by modifying the previous study (Natsume, et al. 2009). Specifically, Raji cells were seeded in an opaque 96-well plate to be used as target cells, and anti-CD20 antibodies (rituximab or two types of cCD20 mAb Tg33(he)4(he) and Tg33(ho ) One of 4(ho)) was treated at different concentrations of 0.0001 μg/ml to 100 μg/ml, followed by treatment with a medium containing 16% of human serum (Sigma, St. Louis, MO, USA) as a source of complement I did. After reacting for 2 hours under the condition of 5% carbon dioxide and 37°C, WST-1 (Roche Diagnostic, Basel, Switzerland) was treated and incubated for 4 hours. % Cytotoxicity by antibody concentration was calculated using the following equation, and the results are shown in FIG. 7.

In this case, E is the absorbance of the well of the experimental group, S is the absorbance of the well without mAb (culture medium and cells cultured only with complement), and M is the absorbance of the culture medium and complement (no target cells and antibodies).

As shown in FIG. 7, it was confirmed that each cCD20 mAb showed a concentration-dependently high CDC activity compared to rituximab.

Example 12. ADCC analysis

Antibody-dependent cell-cytotoxicity assay (ADCC) analysis was performed using the ADCC Reporter Bioassay complete kit (Promega, Madison, WI). Specifically, in order to measure the ADCC activity of cCD20 mAb, immune-mediated effector cell function against WIL2-S, which is a B lymphocyte, was compared with Rituximab. CD20 positive WIL2-S cells were centrifuged and resuspended in RPMI 1640 + low IgG serum and seeded in opaque 96-well plates with effector cells (Jurkat cells). Control anti-CD20 antibody, rituximab, and chicken cCD20 mAb were sequentially diluted and reacted with WIL2-S cells at 5% carbon dioxide and 37°C for 6 hours, followed by Bio-Glo™ Luciferase analysis and microplate reader Cytotoxicity was measured using. The results are shown in FIG. 8.

As shown in FIG. 8, it was confirmed that the cCD20 mAb was higher in luminescence intensity compared to the control antibody and rituximab. Control CD20 mAb and Rituximab showed ADCC activity of 5.82 x 10 ^-9 EC ₅₀ and 1.05 x 10 ^-9 EC ₅₀ , whereas the two types of cCD20 mAb produced in transgenic chickens were Tg33(he)4 (he ) At 1.26 x 10 ^-10 EC ₅₀ and 6.77 x 10 ^-11 EC ₅₀ at Tg33(ho)4(ho), respectively, 8.3 times and 15.5 times higher for B lymphocytes than Rituximab. It was confirmed that it showed activity. In addition, the maximum ADCC activity of cCD20 mAb produced in transgenic chickens was 50% higher than that of rituximab, and it was confirmed that cCD20 mAb could increase ADCC activity more efficiently than rituximab produced in CHO cells.

A transformed cell line secreting a monoclonal antibody having the above characteristics was deposited with the Korean Cell Line Bank (KCLB) under the accession number KCLRF-BP-00431 on May 11, 2018. The transformed cell line is a primitive germ cell, and can be transplanted into an embryo of a recipient algae to produce cCD20 mAb with high efficiency. ) Can be used.

In the above, preferred embodiments of the present invention have been described in detail, but the technical scope of the present invention is not limited to the above-described embodiments and should be interpreted by the claims. At this time, those skilled in the art will have to consider that many modifications and variations are possible without departing from the scope of the present invention.

Korea Cell Line Research Foundation KCLRFBP00431 20180425

<110> Seoul National University R&DB Foundation <120> TRANSGENIC AVIAN PRODUCING IMPROVED MONOCLONAL ANTIBODIES SPECIFIC TO HUMAN CD20 AND A METHOD FOR PRODUCING THE SAME <130> SNU1-141P-1 <150> KR 10-2018-0011888 <151> 2018-01-31 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 708 <212> DNA <213> Artificial Sequence <220> <223> CD20 mAb VL + hIg Kappa <400> 1 atggattttc aggtgcagat tatcagcttc ctgctaatca gtgcttcagt cataatgtcc 60 agaggacaaa ttgttctctc ccagtctcca gcaatcctgt ctgcatctcc aggggagaag 120 gtcacaatga cttgcagggc cagctcaagt gtaagttaca tccactggtt ccagcagaag 180 ccaggatcct cccccaaacc ctggatttat gccacatcca acctggcttc tggagtccct 240 gttcgcttca gtggcagtgg gtctgggact tcttactctc tcaccatcag cagagtggag 300 gctgaagatg ctgccactta ttactgccag cagtggacta gtaacccacc cacgttcgga 360 ggggggacca agctggaaat caaacgaact gtggctgcac catctgtctt catcttcccg 420 ccatctgatg agcagttgaa atctggaact gcctctgttg tgtgcctgct gaataacttc 480 tatcccagag aggccaaagt acagtggaag gtggataacg ccctccaatc gggtaactcc 540 caggagagtg tcacagagca ggacagcaag gacagcacct acagcctcag cagcaccctg 600 acgctgagca aagcagacta cgagaaacac aaagtctacg cctgcgaagt cacccatcag 660 ggcctgagct cgcccgtcac aaagagcttc aacaggggag agtgttag 708 <210> 2 <211> 1415 <212> DNA <213> Artificial Sequence <220> <223> CD20 mAb VH + hIgG constant <400> 2 atgggttgga gcctcatctt gctcttcctt gtcgctgttg ctacgcgtgt cctgtcccag 60 gtacaactgc agcagcctgg ggctgagctg gtgaagcctg gggcctcagt gaagatgtcc 120 tgcaaggctt ctggctacac atttaccagt tacaatatgc actgggtaaa acagacacct 180 ggtcggggcc tggaatggat tggagctatt tatcccggaa atggtgatac ttcctacaat 240 cagaagttca aaggcaaggc cacattgact gcagacaaat cctccagcac agcctacatg 300 cagctcagca gcctgacatc tgaggactct gcggtctatt actgtgcaag atcgacttac 360 tacggcggtg actggtactt caatgtctgg ggcgcaggga ccacggtcac cgtctctgca 420 gcctccacca agggcccatc ggtcttcccc ctggcaccct cctccaagag cacctctggg 480 ggcacagcgg ccctgggctg cctggtcaag gactacttcc ccgaaccggt gacggtgtcg 540 tggaactcag gcgccctgac cagcggcgtg cacaccttcc cggctgtcct acagtcctca 600 ggactctact ccctcagcag cgtggtgacc gtgccctcca gcagcttggg cacccagacc 660 tacatctgca acgtgaatca caagcccagc aacaccaagg tggacaagag agttgagccc 720 aaatcttgtg acaaaactca cacatgccca ccgtgcccag cacctgaact cctgggggga 780 ccgtcagtct tcctcttccc cccaaaaccc aaggacaccc tcatgatctc ccggacccct 840 gaggtcacat gcgtggtggt ggacgtgagc cacgaagacc ctgaggtcaa gttcaactgg 900 tacgtggacg gcgtggaggt gcataatgcc aagacaaagc cgcgggagga gcagtacaac 960 agcacgtacc gtgtggtcag cgtcctcacc gtcctgcacc aggactggct gaatggcaag 1020 gagtacaagt gcaaggtctc caacaaagcc ctcccagccc ccatcgagaa aaccatctcc 1080 aaagccaaag ggcagccccg agaaccacag gtgtacaccc tgcccccatc ccgggaggag 1140 atgaccaaga accaggtcag cctgacctgc ctggtcaaag gcttctatcc cagcgacatc 1200 gccgtggagt gggagagcaa tgggcagccg gagaacaact acaagaccac gcctcccgtg 1260 ctggactccg acggctcctt cttcctctat agcaagctca ccgtggacaa gagcaggtgg 1320 cagcagggga acgtcttctc atgctccgtg atgcatgagg ctctgcacaa ccactacacg 1380 cagaagagcc tctccctgtc cccgggtaaa tgagg 1415 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> 5'TR <400> 3 atgcgtcaat tttacgcaga ctatctttct aggg 34 <210> 4 <211> 373 <212> DNA <213> Artificial Sequence <220> <223> poly A <400> 4 gagatttcga ttccaccgcc gccttctatg aaaggttggg cttcggaatc gttttccggg 60 acgccggctg gatgatcctc cagcgcgggg atctcatgct ggagttcttc gcccacccca 120 acttgtttat tgcagcttat aatggttaca aataaagcaa tagcatcaca aatttcacaa 180 ataaagcatt tttttcactg cattctagtt gtggtttgtc caaactcatc aatgtatctt 240 atcatgtctg tataccgtcg acctctagct agagcttggc gtaatcatgg tcatagctgt 300 ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa 360 agtgtaaagc ctg 373 <210> 5 <211> 795 <212> DNA <213> Artificial Sequence <220> <223> Neomycin-resistance gene <400> 5 atgattgaac aagatggatt gcacgcaggt tctccggccg cttgggtggt gaggctattc 60 ggctatgact gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca 120 gcgcaggggc gcccggttct ttttgtcaag accgacctgt ccggtgccct gaatgaactg 180 caggacgagg cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg 240 ctcgacgttg tcactgaagc gggaagggac tggctgctat tgggcgaagt gccggggcag 300 gatctcctgt catctcacct tgctcctgcc gagaaagtat ccatcatggc tgatgcaatg 360 cggcggctgc atacgcttga tccggctacc tgcccattcg accaccaagc gaaacatcgc 420 atcgagcgag cacgtactcg gatggaagcc ggtcttgtcg atcaggatga tctggacgaa 480 gagcatcagg ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgcg catgcccgac 540 ggcgaggatc tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat ggtggaaaat 600 ggccgctttt ctggattcat cgactgtggc cggctgggtg tggcggaccg ctatcaggac 660 atagcgttgg ctacccgtga tattgctgaa gagcttggcg gcgaatgggc tgaccgcttc 720 ctcgtgcttt acggtatcgc cgctcccgat tcgcagcgca tcgccttcta tcgccttctt 780 gacgagttct tctga 795 <210> 6 <211> 433 <212> DNA <213> Artificial Sequence <220> <223> SV40 <400> 6 gggatttcgg cctattggtt aaaaaatgag ctgatttaac aaaaatttaa cgcgaattaa 60 ttctgtggaa tgtgtgtcag ttagggtgtg gaaagtcccc aggctcccca ggcaggcaga 120 agtatgcaaa gcatgcatct caattagtca gcaaccaggt gtggaaagtc cccaggctcc 180 ccagcaggca gaagtatgca aagcatgcat ctcaattagt cagcaaccat agtcccgccc 240 ctaactccgc ccatcccgcc cctaactccg cccagttccg cccattctcc gccccatggc 300 tgactaattt tttttattta tgcagaggcc gaggccgcct ctgcctctga gctattccag 360 aagtagtgag gaggcttttt tggaggccta ggcttttgca aaaagctccc gggagcttgt 420 atatccattt tcg 433 <210> 7 <211> 3055 <212> DNA <213> Artificial Sequence <220> <223> 3.5kb OV promoter <400> 7 tgacaccaga tgacagagaa gtgcatctga gaaaacctat tcccaatctc ctttctcttt 60 ctgcagactg acatgcattt cataggtaga gataacattt actgggaagc acatctatca 120 tcacaaaaag caggcaagat tttcagactt tcttagtggc tgaaatagaa gcaaaagacg 180 tgattaaaaa caaaatgaaa caaaaaaaat cagttgatac ctgtggtgta gacatccagc 240 aaaaaaatat tatttgcact accatcttgt cttaagtcct cagacttggc aaggagaatg 300 tagatttcca cagtatatat gttttcacaa aaggaaggag agaaacaaaa gaaaatggca 360 ctgactaaac ttcagctagt ggtataggaa agtaattctg cttaacagag attgcagtga 420 tctctatgta tgtcctgaag aattatgttg tacttttttc ccccattttt aaatcaaaca 480 gtgctttaca gaggtcagaa tggtttcttt actgtttgtc aattctatta tttcaataca 540 gaacaatagc ttctataact gaaatatatt tgctattgta tattatgact gtccctcgaa 600 ccatgaacac tcctccagct gaatttcaca attcctctgt catctgccag gccattaagt 660 tattcatgga agatctttga ggaacactgc aagttcatat cataaacaca tttgaaattg 720 agtattgttt tgcattgtat ggagctatgt tttgctgtat cctcagaata aaagtttgtt 780 ataaagcatt cacacccata aaaagataga tttaaatatt ccaactatag gaaagaaagt 840 gtgtctgctc ttcactctag tctcagttgg ctccttcaca tgcacgcttc tttatttctc 900 ctattttgtc aagaaaataa taggtcaagt cttgttctca tttatgtcct gtctagcgtg 960 gctcagatgc acattgtaca tacaagaagg atcaaatgaa acagacttct ggtctgttac 1020 tacaaccata gtaataagca cactaactaa taattgctaa ttatgttttc catctccaag 1080 gttcccacat ttttctgttt tcttaaagat cccattatct ggttgtaatt gaagctcaat 1140 ggaacatgag caatatttcc cagtcttctc tcccatccaa cagtcccgat ggattagcag 1200 aacaggcaga aaacacattg ttacccagaa ttaaaaacta atatttgctc tccattcaat 1260 ccaaaatgga cctattgaaa ctaaaatcta acccaatccc attaaatgat ttctatggtg 1320 tcaaaggtca aacttctgaa gggaacctgt gggtgggtca caattcagac tatatattcc 1380 ccagggctca gccagtgtct gtacatacag ctagaaagct gtattgcctt tagcagtcaa 1440 gctcgaaagg taagcaactc tctggaatta ccttctctct atattagctc ttacttgcac 1500 ctaaacttta aaaaattaac aattattgtg ctatgtgttg tatctttaag ggtgaagtac 1560 ctgcgtgata ccccctataa aaacttctca cctgtgtatg cattctgcac tattttatta 1620 tgtgtaaaag ctttgtgttt gttttcagga ggcttattct ttgtgcttaa aatatgtttt 1680 taatttcaga acatcttatc ctgtcgttca ctatctgata tgctttgcag tttgcttgat 1740 taacttctag ccctacggag tgcacagaga gcaaaatcat ggtgttcagt gaattctggg 1800 gagttatttt aatgtgaaaa ttctctagaa gtttaattcc tgcaaagtgc agctgctgat 1860 cactacacaa gataaaaatg tggggggtgc ataaacgtat attcttacaa taatagatac 1920 atgtgaactt atatacagaa aagaaaatga gaaaaatgtg tgtgtgtata ctcacacacg 1980 tggtcagtaa aaacttttga ggggtttaat acagaaaatc caatcctgag gccccagcac 2040 tcagtacgca tataaagggc tgggctctga aggacttctg actttcacag attatataaa 2100 tctcaggaaa gcaactagat tcatgctggc tccaaaagct gtgctttata taagcacact 2160 ggctatacaa tagttgtaca gttcagctct ttataataga aacagacaga acaagtataa 2220 atcttctatt ggtctatgtc atgaacaaga attcattcag tggctctgtt ttatagtaaa 2280 cattgctatt ttatcatgtc tgcatttctc ttctgtctga atgtcaccac taaaatttaa 2340 ctccacagaa agtttatact acagtacaca tgcatatctt tgagcaaagc aaaccatacc 2400 tgaaggtgca atagagcaga atatgaatta catgcgtgtc tttctcctag actacatgac 2460 cccatataaa ttacattcct tatctattct gccatcacca aaacaaaggt aaaaatactt 2520 ttgaagatct actcatagca agtagtgtgc aacaaacaga tatttctcta catttatttt 2580 tagggaataa aaataagaaa taaaatagtc agcaagcctc tgctttctca tatatctgtc 2640 caaacctaaa gtttactgaa atttgctctt tgaatttcca gttttgcaag cctatcagat 2700 tgtgttttaa tcagaggtac tgaaaagtat caatgaattc tagctttcac tgaacaaaaa 2760 tatgtagagg caactggctt ctgggacagt ttgctaccca aaagacaact gaatgcaaat 2820 acataaatag atttatgaat atggttttga acatgcacat gagaggtgga tatagcaaca 2880 gacacattac cacagaatta ctttaaaact acttgttaac atttaattgc ctaaaaactg 2940 ctcgtaattt actgttgtag cctaccatag agtaccctgc atggtactat gtacagcatt 3000 ccatccttac attttcactg ttctgctgtt tgctctagac aactcagagt tcacc 3055 <210> 8 <211> 295 <212> DNA <213> Artificial Sequence <220> <223> pIRES intron <400> 8 gttggggtga gtactccctc tcaaaagcgg gcatgacttc tgcgctaaga ttgtcagttt 60 ccaaaaacga ggaggatttg atattcacct ggcccgcggt gatgcctttg agggtggccg 120 cgtccatctg gtcagaaaag acaatctttt tgttgtcaag cttgaggtgt ggcaggcttg 180 agatctggcc atacacttga gtgacaatga catccacttt gcctttctct ccacaggtgt 240 ccactcccag gtccaactgc aggtcgatcg agcatgcatc tagggcggcc aattc 295 <210> 9 <211> 546 <212> DNA <213> Artificial Sequence <220> <223> IRES <400> 9 gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa taaggccggt 60 gtgcgtttgt ctatatgtta ttttccacca tattgccgtc ttttggcaat gtgagggccc 120 ggaaacctgg ccctgtcttc ttgacgagca ttcctagggg tctttcccct ctcgccaaag 180 gaatgcaagg tctgttgaat gtcgtgaagg aagcagttcc tctggaagct tcttgaagac 240 aaacaacgtc tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc 300 tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa ccccagtgcc 360 acgttgtgag ttggatagtt gtggaaagag tcaaatggct ctcctcaagc gtattcaaca 420 aggggctgaa ggatgcccag aaggtacccc attgtatggg atctgatctg gggcctcggt 480 gcacatgctt tacatgtgtt tagtcgaggt taaaaaaacg tctaggcccc ccgaaccacg 540 gggacg 546 <210> 10 <211> 1628 <212> DNA <213> Artificial Sequence <220> <223> 3'UTR <400> 10 aaagaagaaa gctgaaaaac tctgtccctt ccaacaagac ccagagcact gtagtatcag 60 gggtaaaatg aaaagtatgt tatctgctgc atccagactt cataaaagct ggagcttaat 120 ctagaaaaaa aatcagaaag aaattacact gtgagaacag gtgcaattca cttttccttt 180 acacagagta atactggtaa ctcatggatg aaggcttaag ggaatgaaat tggactcaca 240 gtactgagtc atcacactga aaaatgcaac ctgatacatc agcagaaggt ttatggggga 300 aaaatgcagc cttccaatta agccagatat ctgtatgacc aagctgctcc agaattagtc 360 actcaaaatc tctcagatta aattatcaac tgtcaccaac cattcctatg ctgtcaaggc 420 aattgcttgt tctctgtgtt cctgatacta caaggctctt cctgacttcc taaagatgca 480 ttataaaaat cttataattc acatttctcc ctaaactttg actcaatcat ggtatgttgg 540 caaatatggt atattactat tcaaattgtt ttccttgtac ccatatgtaa tgggtcttgt 600 gaatgtgctc ttttgttcct ttaatcataa taaaaacatg tttaagcaaa cacttttcac 660 ttgtagtatt tgaagtacag caaggttgtg tagcagggaa agaatgacat gcagaggaat 720 aagtatggac acacaggcta gcagcgactg tagaacaagt actaatgggt gagaagttga 780 acaagagtcc cctacagcaa cttaatctaa taagctagtg gtctacatca gctaaaagag 840 catagtgagg gatgaaattg gttctccttt ctaagcatca cctgggacaa ctcatctgga 900 gcagtgtgtc caacctgccg ctgccctgat cctggctggg gtgatgggac agaccttggc 960 tgccactgag acatctgaga cactgagatc tgtctcaact cagatttacc caagaacagc 1020 tcattgccaa cagaacaaaa tctcaaactt atggctagtg atgacagcag tcagttgtcc 1080 catctgtgac ccaccaaggc tggcatgctg gaatgagcag gctttggtgg cttgtagtta 1140 ctggacagca ccactgacat gggcagggga aaaactgagc atggtgtaaa tcactgcctc 1200 aaagccactt ctctgtgcct gcaccatgct tgaaagctct tctacaggag ctgggtttgt 1260 tcaagaaagc ttctgtttct cccatctgct tcttgtacct tcacagggac agagttagaa 1320 gggtacagcc atggctggaa ggggctgact ttcaaatgtg cctaattttc ctttggttgc 1380 tgctgcagct gcagaagaag gggttcagaa gccaagagct ttgagataag gatgcctaac 1440 ctatgttgaa gacatttgtg ctgacacctc aggccccagg ataggacaac tgctggattg 1500 tggctaaccc actagctaca gaacctaatt tatattacca gattaggaag agcaaaagaa 1560 catgtattta taacaggagg tcttctgtgc ttctctacta aaaggtgctg tgaaggagcc 1620 cacagtgc 1628 <210> 11 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> 3'TR <400> 11 catgcgtcaa ttttacgcat gattatcttt aacgtacgtc acaatatgat tatctttcta 60 ggg 63 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ch33 F <400> 12 gtcggggctc atctctccct 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ch33 wild-type locus R <400> 13 gcgccaagtg acgatctggt 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ch33 F <400> 14 gtcggggctc atctctccct 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ch33 transgene locus R <400> 15 ccgctagcca acaagctcgt 20 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Ch4 F <400> 16 agaagcacaa tagagcaaag gatggaa 27 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ch4 wild-type locus R <400> 17 tcctgtgatg ctccaggcct 20 <210> 18 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Ch4 F <400> 18 agaagcacaa tagagcaaag gatggaa 27 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Ch4 transgene locus R <400> 19 agctcgtcat cgctttgcag a 21 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> piggyBac TSP1* <400> 20 ggatctcatg ctggagttct 20 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> piggyBac TSP2 <400> 21 ggcgtaatca tggtcatagc t 21 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> piggyBac TSP3 <400> 22 gagccggaag cataaagtgt 20 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> cCD20 transgene F <400> 23 acccctgagg tcacatgcgt 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> cCD20 transgene R <400> 24 gggaggcgtg gtcttgtagt 20

Claims (17)

(a) 5'and 3'piggyBac transposon specific inverted terminal repeats (Terminal Repeat, TR); And
(b) Ovalbumin (OV) promoter positioned between the 5'TR and 3'TR, and a recombinant vector comprising a gene encoding a human CD20 specific monoclonal antibody operably linked to the ovalbumin promoter.
delete delete delete The method of claim 1, wherein the gene encoding the human CD20-specific monoclonal antibody is a gene encoding the light chain region of the human CD20-specific monoclonal antibody represented by SEQ ID NO: 1 and a human CD20 specific gene represented by SEQ ID NO: 2 A recombinant vector comprising a gene encoding a heavy chain region of a monoclonal antibody.
The recombinant vector of claim 1, wherein the gene encoding the human CD20 specific monoclonal antibody is optimized with a chicken codon.
A donor germline cell line excluding a human germ cell line transformed with the recombinant vector of claim 1.
The donor germ cell line according to claim 7, characterized in that the donor germ cells are primordial germ cells (PGCs) of a donor bird.
The donor germline cell line according to claim 8, wherein the primitive germ cell is derived from the primitive genitalia of a 1-10 day old embryo of the donor bird.
The donor germ cell line according to claim 9, wherein the donor bird is a chicken.
The donor germline cell line according to claim 7, characterized in that the accession number is KCLRF-BP-00431.
A method for producing a transgenic avian model for producing a human CD20-specific monoclonal antibody comprising the step of transplanting the donor germ cell line according to any one of claims 7 to 11 into an embryo of a recipient bird.
A transgenic bird model producing a human CD20-specific monoclonal antibody prepared by the method of claim 12.
A method for producing a human CD20-specific monoclonal antibody comprising the step of obtaining a human CD20-specific monoclonal antibody from the transgenic avian model of claim 12.
A human CD20 specific monoclonal antibody produced by the method of claim 14.
The method of claim 15, wherein the human CD20-specific monoclonal antibody is characterized in that afucosylated (afucosylation), human CD20-specific monoclonal antibody.
The human CD20 specific monoclonal antibody according to claim 16, wherein the human CD20 specific monoclonal antibody is characterized in that the cellular immunity function by the Fc domain is improved as a result of non-fucosylation.

Images