KR102184911B1 - Preventing or treating composition for preterm birth containing miR-548 - Google Patents

Preventing or treating composition for preterm birth containing miR-548 Download PDF

Info

Publication number
KR102184911B1
KR102184911B1 KR1020190067159A KR20190067159A KR102184911B1 KR 102184911 B1 KR102184911 B1 KR 102184911B1 KR 1020190067159 A KR1020190067159 A KR 1020190067159A KR 20190067159 A KR20190067159 A KR 20190067159A KR 102184911 B1 KR102184911 B1 KR 102184911B1
Authority
KR
South Korea
Prior art keywords
mir
hmgb1
amniotic
inflammation
amnion
Prior art date
Application number
KR1020190067159A
Other languages
Korean (ko)
Inventor
손가현
김영미
박성택
이근영
이재준
Original Assignee
한림대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한림대학교 산학협력단 filed Critical 한림대학교 산학협력단
Priority to KR1020190067159A priority Critical patent/KR102184911B1/en
Application granted granted Critical
Publication of KR102184911B1 publication Critical patent/KR102184911B1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/06—Antiabortive agents; Labour repressants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Abstract

The present invention relates to a premature birth prevention or treatment composition containing miR-548. The composition is a composition for the treatment of inflammation in the amnion, and contains one kind of miRNA selected from SEQ ID NOs: 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, 19, 20, 21, 22, and 23. In addition, the miRNA is coupled to a 3′ non-translation region of high mobility group box 1 protein (HMGB1). According to the present invention, inflammation in the amnion and premature birth can be prevented or treated.

Description

miR-548을 함유하는 조산 예방 또는 치료제 조성물 {Preventing or treating composition for preterm birth containing miR-548}Composition for preventing or treating preterm birth containing miR-548 {Preventing or treating composition for preterm birth containing miR-548}

본 발명은 miR-548 또는 miR-548 모조물을 함유하는 조산 또는 양막 내 염증 예방 또는 치료제 조성물에 관한 것으로서, miR-548 또는 miR-548 모조물을 투여하는 경우 양막 내 염증 및/또는 조산을 예방 또는 치료할 수 있음을 밝혔다.The present invention relates to a composition for preventing or treating premature birth or inflammation in the amniotic membrane containing a miR-548 or miR-548 replica, wherein the administration of miR-548 or miR-548 replica prevents inflammation and/or premature birth in the amniotic membrane Or revealed that it can be cured.

임신 중 태아의 양막은 태아의 수용 및 보호, 분만, 양막 내 감염에 대한 반응과 같은 다양한 생리학적 및 병리학적 과정에 관여한다 [1]. 양막강의 감염과 염증은 종종 조직학적 융모양막염 (chorioamnionitis)에 동반되며 조산 및 불량한 주산기 결과와 관련이 있다 [2]. 양막 내 염증은 양막강의 미생물 침범이나 다른 기전으로 인해 발생할 수 있는데, 다른 기전이라 함은 괴사 또는 세포성 스트레스가 내재적 면역계를 활성화하는 매개인자의 유리를 유도하는 것을 말한다 [3-5]. S100 칼슘 결합 단백질 B (S100B) [6], 열충격 단백질 [7], 인터류킨 (IL)-1α [7-9] 및 HMGB1 (high mobility group box 1 protein) [10,11]을 포함하는 손상 관련 분자 패턴 (Damage associated molecular patterns; DAMPs)은 내생적 친염증성 및 친산화 스트레스 분자들로서, 환자에게 명백한 감염 없이 염증 반응 (멸균 염증)을 일으킬 수 있다 [7,10,11]. DAMPs는 TLR2와 TLR4, 그리고 진보된 당화 최종 산물에 대한 수용체 (RAGE)에 결합하여 작용하며 수용체에 결합하면 염증 세포를 모으고, 이들은 내재적 면역 반응을 증폭시켜 사이토카인 활성화를 촉진한다 [12]. 보고에 의하면 RAGE-DAMP 시스템은 조산 및 양막 내 염증이 있는 여성에게 존재한다. RAGE-DAMP 시스템의 활성화는 양막 상피 세포, 탈락막 세포 및 융모막외 영양세포에서 염증 및 산화 스트레스 손상의 정도와 관련이 있다 [13].During pregnancy, the fetal amniotic membrane is involved in a variety of physiological and pathological processes, such as acceptance and protection of the fetus, delivery, and response to intraamniotic infection [1]. Infection and inflammation of the amniotic cavity are often accompanied by histological chorioamnionitis and are associated with preterm birth and poor perinatal outcome [2]. Inflammation in the amnion can occur due to microbial invasion or other mechanisms in the amniotic cavity. Another mechanism is that necrosis or cellular stress induces the release of mediators that activate the intrinsic immune system [3-5]. Damage-related molecules including S100 calcium binding protein B (S100B) [6], heat shock protein [7], interleukin (IL)-1α [7-9], and high mobility group box 1 protein (HMGB1) [10,11] Damage associated molecular patterns (DAMPs) are endogenous pro-inflammatory and pro-oxidative stress molecules that can induce an inflammatory response (sterile inflammation) without obvious infection in patients [7,10,11]. DAMPs act by binding to receptors for TLR2, TLR4, and advanced glycosylation end products (RAGE). When bound to the receptor, DAMPs gather inflammatory cells, which amplify the intrinsic immune response and promote cytokine activation [12]. Reportedly, the RAGE-DAMP system is present in women with preterm birth and inflammation in the amnion. Activation of the RAGE-DAMP system is associated with the extent of inflammation and oxidative stress damage in amniotic epithelial cells, deciduous cells and epichondrial feeder cells [13].

HMGB1은 무균 염증 및 전염성 염증의 병인에 중심적인 역할을 하는 원형 알라민이다 [14-21]. HMGB1의 농도의 증가는 DAMP에 의한 염증의 정도를 반영한다. [14,17,20,22,23]. HMGB1은 세포핵에 주로 위치해 있지만, HMGB1은 병원성 산물에 대한 반응으로 내재하는 면역 세포에 의해 분비될 수 있으며 손상되거나 죽어가는 세포에 의해 유리될 수 있다 [24]. Buhimschi 등은 양막 내 염증 및 조산 여성의 양수에서 HMGB1 수치가 증가한다고 보고했다. 체외 배양조직 실험을 통하여 저자는 또한 양막 내 HMGB1이 손상된 양막융모막에서 유리될 수 있음을 보여 주었다 [25]. 또한, HMGB1의 양막 내 투여는 자연 조기 진통 및 조산을 유도하는 것으로 보고되었다 [26]. 이러한 결과는 태아막에서 분비된 양막 내 HMGB1이 조기 진통을 유도할 수 있고, 따라서 무균 양막 내 염증의 맥락에서 분만 신호 전달에 관련될 수 있음을 시사한다. 양막은 양막 내강의 가장 안쪽 층이다. 따라서 우리는 융모막보다는 양막이 양막 내 염증과 같은 양막강 내의 변화에 반응하는데 중요한 역할을 한다고 가정할 수 있다 [27]. 그러나, 양막 내 염증에 의해 결정된 조산에서 양막의 역할에 대해서는 알려진 바가 거의 없다.HMGB1 is a prototype alarmin that plays a central role in the pathogenesis of aseptic and infectious inflammation [14-21]. The increase in the concentration of HMGB1 reflects the degree of inflammation caused by DAMP. [14,17,20,22,23]. While HMGB1 is primarily located in the cell nucleus, HMGB1 can be secreted by intrinsic immune cells in response to pathogenic products and released by damaged or dying cells [24]. Buhimschi et al. reported increased levels of HMGB1 in amniotic fluid in amniotic fluid and in amniotic fluid in premature women. Through in vitro culture experiments, the authors also showed that HMGB1 in the amniotic membrane can be released from the damaged amniotic chorion [25]. In addition, it has been reported that intraamniotic administration of HMGB1 induces spontaneous premature labor and preterm labor [26]. These results suggest that HMGB1 in the amniotic membrane secreted from the fetal membrane can induce early analgesia and thus may be involved in delivery signaling in the context of inflammation in the sterile amniotic membrane. The amnion is the innermost layer of the lumen of the amnion. Therefore, we can assume that the amniotic membrane rather than the chorion plays an important role in responding to changes in the amniotic cavity such as inflammation in the amniotic membrane [27]. However, little is known about the role of the amnion in preterm delivery determined by inflammation in the amnion.

miRNA는 크기가 18~25 뉴클레오타이드에 이르는 비암호화 소형 RNA의 일종이며, mRNA 분해 또는 번역 억제에 의한 유전자 발현의 전사 후 조절에 관여한다. 억제는 표적 mRNA의 3'-비번역 부위 (3'UTR)의 상보 서열에 miRNA가 결합함으로써 일어난다 [28]. miRNA의 역할은 세포 성장, 발달, 기관 형성 및 세포 사멸과 같은 다양한 생리학적 및 병리학적 과정에서 중요하다 [29]. miRNA는 암 및 심혈관 질환을 비롯한 다양한 질병 상태에 관련되어 있으며 중요한 치료 표적으로 간주된다. 또한, miRNA는 대부분의 유형의 염증 반응에 관여하며, miRNA가 세포 발달 및 급성 세포 기능에 미치는 영향을 통해 염증 반응의 크기를 조절하는데 효과적이라는 증거가 증가하고 있다 [30]. 병원성 상태에서 miRNA의 중요성이 증가하고 있음에도 불구하고, 양막 내 염증 및 조산에 관여할 가능성이 있는 miRNA의 역할에 관해서는 거의 연구된 바 없다. 최근의 마이크로어레이 분석은 자연 조산 환자와 정상 분만인 간의 혈장에서 miRNAomes를 비교하였다. 조산군에서는 총 8종의 miRNA가 다르게 발현되었고, miR-302b, miR-1253 및 miR-548 miRNAs 클러스터는 정상 대조군과 비교하여 조산 환자에게서 현저히 낮게 발현되었다 [31]. 그러나, 조산에서 이러한 miRNA 들의 잠재적 역할은 알려져 있지 않다.miRNA is a type of non-coding small RNA ranging in size from 18 to 25 nucleotides, and is involved in post-transcriptional regulation of gene expression by mRNA degradation or translation inhibition. Inhibition occurs by binding of miRNA to the complementary sequence of the 3'-untranslated region (3'UTR) of the target mRNA [28]. The role of miRNAs is important in a variety of physiological and pathological processes such as cell growth, development, organ formation and cell death [29]. miRNAs are involved in a variety of disease states, including cancer and cardiovascular disease, and are considered important therapeutic targets. In addition, miRNAs are involved in most types of inflammatory responses, and there is increasing evidence that miRNAs are effective in regulating the magnitude of inflammatory responses through their effects on cell development and acute cellular function [30]. Despite the increasing importance of miRNAs in pathogenic conditions, little has been studied about the role of miRNAs that may be involved in inflammation and premature birth in the amnion. A recent microarray analysis compared miRNAomes in plasma between natural preterm and normal delivery. A total of 8 miRNAs were expressed differently in the preterm group, and the miR-302b, miR-1253 and miR-548 miRNAs clusters were significantly lower in preterm delivery patients compared to the normal control group [31]. However, the potential role of these miRNAs in preterm birth is unknown.

조산군에서 다르게 발현된 miRNA 중에서, miR-548 클러스터 및 miR-302b는 생물정보학적 분석을 통해 HMGB1 3'UTR에 결합할 것으로 예측되었다. Among the miRNAs expressed differently in the preterm birth group, the miR-548 cluster and miR-302b were predicted to bind to HMGB1 3'UTR through bioinformatics analysis.

Romero R et al., Am J Obstet Gynecol 1992;166:1382-8Romero R et al., Am J Obstet Gynecol 1992;166:1382-8 Yoon BH et al., Am J Obstet Gynecol 1997;177:19-26Yoon BH et al., Am J Obstet Gynecol 1997;177:19-26 Romero R et al., Semin Reprod Med 2007;25:21-39Romero R et al., Semin Reprod Med 2007;25:21-39 Christiaens I et al., J Reprod Immunol 2008;79:50-7Christiaens I et al., J Reprod Immunol 2008;79:50-7 Vrachnis N et al., Ann N Y Acad Sci 2010;1205:118-22Vrachnis N et al., Ann N Y Acad Sci 2010;1205:118-22 Friel LA et al., J Perinat Med 2007;35:385-93Friel LA et al., J Perinat Med 2007;35:385-93 Chaiworapongsa T et al., J Matern Fetal Neonatal Med 2008;21:449-61Chaiworapongsa T et al., J Matern Fetal Neonatal Med 2008;21:449-61 Romero R et al., Prostaglandins 1989;37:13-22Romero R et al., Prostaglandins 1989;37:13-22 Romero R et al., Am J Reprod Immunol 1992;27:117-23Romero R et al., Am J Reprod Immunol 1992;27:117-23 Romero R et al., J Matern Fetal Neonatal Med 2011;24:1444-55Romero R et al., J Matern Fetal Neonatal Med 2011;24:1444-55 Romero R et al., J Matern Fetal Neonatal Med 2012;25:558-67Romero R et al., J Matern Fetal Neonatal Med 2012;25:558-67 Andersson U et al., Annu Rev Immunol 2011;29:139-62Andersson U et al., Annu Rev Immunol 2011;29:139-62 Buhimschi IA et al., Am J Obstet Gynecol 2007;196:181.e1-13Buhimschi IA et al., Am J Obstet Gynecol 2007;196:181.e1-13 Scaffidi P et al., Nature 2002;418:191-5Scaffidi P et al., Nature 2002;418:191-5 Rovere-Querini P et al., EMBO Rep 2004;5:825-30Rovere-Querini P et al., EMBO Rep 2004;5:825-30 Chen G et al., J Interferon Cytokine Res 2004;24:329-33Chen G et al., J Interferon Cytokine Res 2004;24:329-33 Lotze MT et al., Nat Rev Immunol 2005;5:331-42Lotze MT et al., Nat Rev Immunol 2005;5:331-42 Dumitriu IE et al., Trends Immunol 2005;26:381-7Dumitriu IE et al., Trends Immunol 2005;26:381-7 Bianchi ME et al., Immunol Rev 2007;220:35-46Bianchi ME et al., Immunol Rev 2007;220:35-46 Klune JR et al., Mol Med 2008;14:476-84Klune JR et al., Mol Med 2008;14:476-84 Castiglioni A et al., Cell Tissue Res 2011;343:189-99Castiglioni A et al., Cell Tissue Res 2011;343:189-99 Harris HE et al., Nat Rev Rheumatol 2012;8:195-202Harris HE et al., Nat Rev Rheumatol 2012;8:195-202 Diener KR et al., Immunol Cell Biol 2013;91:443-50Diener KR et al., Immunol Cell Biol 2013;91:443-50 Gauley J et al., Autoimmunity 2009;42:299-301Gauley J et al., Autoimmunity 2009;42:299-301 Baumbusch MA et al., Cytokine 2016;81:82-7Baumbusch MA et al., Cytokine 2016;81:82-7 Gomez-Lopez N et al., Am J Reprod Immunol 2016;75:3-7Gomez-Lopez N et al., Am J Reprod Immunol 2016;75:3-7 Menon R. Placenta 2016;44:1-5Menon R. Placenta 2016;44:1-5 Filipowicz W et al., Nat Rev Genet 2008;9:102-14Filipowicz W et al., Nat Rev Genet 2008;9:102-14 Ambros V. Nature 2004;431:350-5Ambros V. Nature 2004;431:350-5 Sonkoly E et al., Int Rev Immunol 2009;28:535-61Sonkoly E et al., Int Rev Immunol 2009;28:535-61 Gray C et al., Sci Rep. 2017;7:815Gray C et al., Sci Rep. 2017;7:815 Romero R et al., Am J Reprod Immunol 2014;72:458-74Romero R et al., Am J Reprod Immunol 2014;72:458-74 Behnia F et al., Am J Obstet Gynecol 2015;213:359.e1-16Behnia F et al., Am J Obstet Gynecol 2015;213:359.e1-16 Menon R et al., Am J Pathol 2014;184:1740-51Menon R et al., Am J Pathol 2014;184:1740-51 Menon R et al., PLoS One 2013;8:e83416Menon R et al., PLoS One 2013;8:e83416 Motedayyen H et al., BMC Res Notes 2017;10:552Motedayyen H et al., BMC Res Notes 2017;10:552 Kim Y et al., J Biol Chem 2010;285:25957-68Kim Y et al., J Biol Chem 2010;285:25957-68 Bianchi ME. J Leukoc Biol 2007;81:1-5Bianchi ME. J Leukoc Biol 2007;81:1-5 Ye D et al., Gastroenterology 2011;141:1323-33Ye D et al., Gastroenterology 2011;141:1323-33 Elovitz MA et al., Am J Obstet Gynecol 2014;210:221.e1-11Elovitz MA et al., Am J Obstet Gynecol 2014;210:221.e1-11 Shi Y et al., Biomed Pharmacother 2015;75:111-6Shi Y et al., Biomed Pharmacother 2015;75:111-6 Elovitz MA et al., Am J Obstet Gynecol 2015;212:782.e1-5Elovitz MA et al., Am J Obstet Gynecol 2015;212:782.e1-5 Sanders AP et al., Epigenetics 2015;10:221-8Sanders AP et al., Epigenetics 2015;10:221-8

본 발명자들은 1) 건강한 정상 대조군과 양막 내 염증 환자의 양수 HMGB1 수준을 비교하고, 2) 정상 대조군과 융모양막염 및 조산 환자의 양막의 HMGB1 발현을 비교하고, 3) 양막 내 miR-548 클러스터의 발현을 조사하고 miR-548 클러스터에 의해 HMGB1 발현이 조절되는지를 밝혀 양막 내 염증 및 조산을 예방 또는 치료할 수 있는 효과적인 약제를 제공하려는 것을 목표로 설정하였다.The present inventors 1) compared the level of amniotic fluid HMGB1 in a healthy normal control group and a patient with inflammation in the amnion, 2) compared the HMGB1 expression in the amniotic membrane of a healthy control group and a patient with chorionic amnion and premature birth, and 3) the miR-548 cluster in the amniotic membrane. It was set as the goal to provide an effective drug that can prevent or treat inflammation and premature birth in the amniotic membrane by examining the expression and finding out whether HMGB1 expression is regulated by the miR-548 cluster.

본 발명자들은 양막 내 염증 환자의 양수 내 HMGB1 수준이 염증이 없는 여성의 HMGB1 수준보다 현저히 높다는 것과, HMGB1이 정상 대조군에 비하여 융모양막염 및 조산 환자의 양막에서 현저히 높게 발현된다는 것을 밝혔다. 또한, 본 발명자들은 지다당 (LPS)-매개 염증이 배양한 양막상피세포(hAECs)에서 HMGB1의 과발현 및 hAECs로부터 HMGB1 분비의 원인이 됨을 확인하였다. 이러한 결과들은 생체 내 및 실험실 조건하에서 모두 확인된 바 있으며, 염증이 양막에서 HMGB1 발현과 양막 상피세포로부터 HMGB1의 배출을 유도한다는 사실과 일치하였다. HMGB1은 외인성 병원체 유래 분자를 통한 내재적 면역체계의 자극에 의해 활발히 유리된다. 뉴런, 성상 세포, 적백혈병 세포, 신경 아세포종 세포 및 기타 종양 세포도 HMGB1을 활발하게 분비할 수 있다고 보고되었다 [12,14,15,17,38]. 세포 무결성이 손상되면 HMGB1의 수동 유리가 시작될 수 있다 [24]. 세포가 지다당에 의해 자극받았을 때 hAEC에서 HMGB1 발현이 증가함을 고려하면, HMGB1은 양막 상피세포로부터 활발하게 유리될 수 있다. 또한, 양막의 염증은 양막 상피세포 손상으로 이어질 수 있으며 이는 HMGB1의 수동 유리를 일으킬 수 있다. 기전에 관계없이, 양수 내 HMGB1의 증가된 수준은 양막 상피세포 손상 및 상해의 마커로 간주될 수 있으며, 양막 상피세포에서의 활발한 염증매개 신호 전달을 나타낸다. 유리된 HMGB1이 어떻게 양막 상피세포에 영향을 미치며, 조산을 유도함에 있어서 어떠한 기능을 하는지는 알려져 있지 않다. 본 발명자들은 HMGB1이 조산에 관여하는 사이토카인, 케모카인 및 MMP 합성을 유도할 것이라고 예상하였다.The present inventors found that the level of HMGB1 in the amniotic fluid of patients with inflammation in the amnion is significantly higher than the level of HMGB1 in women without inflammation, and that HMGB1 is significantly higher in the amniotic membrane of patients with chorionic amnion and preterm delivery compared to the normal control group. In addition, the present inventors confirmed that lipopolysaccharide (LPS)-mediated inflammation causes overexpression of HMGB1 in cultured amniotic epithelial cells (hAECs) and secretion of HMGB1 from hAECs. These results have been confirmed both in vivo and under laboratory conditions, and are consistent with the fact that inflammation induces HMGB1 expression in amnion and release of HMGB1 from amnion epithelial cells. HMGB1 is actively liberated by stimulation of the intrinsic immune system through molecules derived from exogenous pathogens. It has been reported that neurons, astrocytes, red leukemia cells, neuroblastoma cells and other tumor cells can also actively secrete HMGB1 [12,14,15,17,38]. Impaired cellular integrity can initiate passive release of HMGB1 [24]. Considering that HMGB1 expression in hAEC increases when cells are stimulated by lipopolysaccharide, HMGB1 can be actively released from amniotic epithelial cells. In addition, inflammation of the amnion can lead to damage to the amnion epithelial cells, which can cause passive release of HMGB1. Regardless of the mechanism, increased levels of HMGB1 in the amniotic fluid can be regarded as a marker of amnion epithelial cell damage and injury, indicating active inflammatory mediated signaling in amniotic epithelial cells. It is not known how free HMGB1 affects amnion epithelial cells and how it functions in inducing preterm birth. The present inventors predicted that HMGB1 would induce the synthesis of cytokines, chemokines and MMPs involved in preterm birth.

질병 과정에서 miR-548 일족의 관여에 대해서는 거의 알려진 바가 없다. miR-548 일족의 하류 표적들은 유방암, 염증 반응 및 에스트로젠 수용체 민감성과 관련이 있으며, 조산의 설정에서 중요한 생물학적 기능을 할 것임을 암시한다 [41-43]. 최근 연구에 따르면 바이러스 감염의 발생에 있어 내인성 miR-548 수준의 억제가 보고되었다 [43]. 이와 유사하게, 본 발명자들은 정상 대조군과 비교하여 융모양막염 및 조산 환자의 양막에서 miR-548 클러스터의 현저한 억제를 관찰하였다. 또한, 지다당으로 hAECs를 처리하였을 때, miR-548이 저하조절되었다. 이전의 연구에 따르면 염증은 장 상피 장벽에서 miRNA를 변화시키고 miRNA의 표적 단백질인 치밀 접합 단백질 (tight junction protein)의 분해를 통해 장 투과성을 조절한다고 보고되었다 [39]. 또한, 자궁 경부 세포에서 염증은 특정 miRNA의 발현을 크게 변화시킬 수 있고, 이러한 변화는 자궁 경부 개조 및 조산에 관련될 수 있다 [40]. 비록 염증성 자극에 따른 miR-548의 저하조절 기전이 밝혀지지는 않았지만 이러한 결과들은 miR-548의 낮은 발현이 융모양막염에 의한 조산에서 중요한 역할을 수행할 수 있음을 시사한다.Little is known about the involvement of the miR-548 clan in the disease process. Downstream targets of the miR-548 family are associated with breast cancer, inflammatory responses and estrogen receptor sensitivity, suggesting that they will play important biological functions in the setting of preterm birth [41-43]. Recent studies have reported inhibition of endogenous miR-548 levels in the outbreak of viral infection [43]. Similarly, the present inventors observed marked inhibition of the miR-548 cluster in the amniotic membrane of patients with chorioamnitis and preterm delivery compared to the normal control group. In addition, when hAECs were treated with lipopolysaccharide, miR-548 was lowered and regulated. Previous studies have reported that inflammation alters miRNA in the intestinal epithelial barrier and modulates intestinal permeability through degradation of the tight junction protein, a target protein of miRNA [39]. In addition, inflammation in cervical cells can significantly alter the expression of certain miRNAs, and these changes may be related to cervical remodeling and premature birth [40]. Although the mechanism for regulating miR-548's lowering due to inflammatory stimulation has not been identified, these results suggest that low expression of miR-548 may play an important role in preterm delivery due to chorioamnionitis.

본 발명은 인간 양막 상피세포에서 지다당이 miR-548의 발현을 저하조절하며, miR-548 억제가 HMGB1 mRNA 및 단백질 발현을 상향조절하며 miR-548 클러스터 억제제로 트랜스펙션하여 miR-548을 억제시킨 hAECs 배양 배지에 HMGB1의 유리를 유도함을 증명한다. 이러한 결과는 양막 내 염증이 양막에서 miR-548의 하향 조절을 유도하며 이는 HMGB1의 발현을 상향조절하고 양막 상피세포로부터의 HMGB1의 유리를 유도할 수 있음을 시사한다. 더욱이, miR-548 클러스터 모조물은 대조군 모조물과 비교하여 hAEC에서 지다당에 의해 유도된 HMGB1의 상향조절을 돌이킬 수 있다. hAEC로부터 HMGB1의 유리는 또한 miR-548 클러스터 모조물로 트랜스펙션된 hAEC에서 유의하게 감소하였다. 또한, miR-548 클러스터 모조물로 트랜스펙션된 hAEC의 배양 배지에서 염증성 사이토카인 및 케모카인의 농도는 대조군 모조물 처리 세포와 비교하여 억제되었다. 이러한 결과는 miR-548 클러스터 모조물이 염증이 자극될 때 발생하는 HMGB1의 상향 조절을 억제하고 hAEC의 염증 반응을 변화시킬 수 있음을 시사한다. 따라서 우리는 miR-548이 내재적 면역의 활성화를 효과적으로 반전시키고 억제할 수 있으며 IAI의 손상을 상당히 감소시킬 수 있다고 예상할 수 있다.In the present invention, lipopolysaccharide decreases and regulates the expression of miR-548 in human amniotic epithelial cells, and miR-548 inhibition upregulates HMGB1 mRNA and protein expression, and miR-548 is inhibited by transfection with a miR-548 cluster inhibitor. It is demonstrated that the release of HMGB1 is induced in the hAECs culture medium. These results suggest that inflammation in the amnion induces down-regulation of miR-548 in the amnion, which may upregulate the expression of HMGB1 and induce the release of HMGB1 from amnion epithelial cells. Moreover, the miR-548 cluster replica is capable of reversing the upregulation of HMGB1 induced by lipopolysaccharide in hAEC compared to the control replica. The liberation of HMGB1 from hAEC was also significantly reduced in hAEC transfected with the miR-548 cluster replica. In addition, the concentration of inflammatory cytokines and chemokines in the culture medium of hAEC transfected with the miR-548 cluster replica was suppressed compared to the control replica treated cells. These results suggest that the miR-548 cluster replica may inhibit the upregulation of HMGB1 that occurs when inflammation is stimulated and may alter the inflammatory response of hAEC. Therefore, we can expect that miR-548 can effectively reverse and inhibit the activation of intrinsic immunity and significantly reduce the damage of IAI.

본 발명의 강점 중 하나는 양막 상피세포가 HMGB1을 분비할 수 있다는 것을 증명했다는 점이다. 조산과 양막 내 염증 여성의 양수에서 HMGB1이 증가하며, 양수 HMGB1이 증가하면 조산을 유발할 수 있다는 것이 알려져 있다. 그러나 어디서 양수 HMGB1이 배출되는지는 분명하지 않았다. 본 발명의 결과들은 양막 내 염증이 발생했을 때 양막이 HMGB1과 다른 친염증성 사이토카인을 분비함으로써 조산으로 이끄는 데 중요한 역할을 한다는 것을 밝혔다. 또한, 우리는 조산과 관련된 microRNA/표적 단백질 네트워크가 양막 내 염증/융모양막염으로 인한 조산과 관련이 있음을 밝혔다. 조산 여성에서 차별적으로 발현되는 miRNA에 대한 연구가 일부 보고되었지만 조산에서 miRNA의 역할과 이들 miRNA가 조산 유도에 어떻게 관여하는지에 대해서는 거의 알려지지 않았다. 본 발명자들은 염증이 양막의 miR-548 발현을 변화시킬 수 있고 억제된 miR-548이 양수 내 염증 반응을 증강시켜 조산을 유도할 수 있음을 입증한다.One of the strengths of the present invention is that it has proven that amnion epithelial cells can secrete HMGB1. It is known that HMGB1 increases in amniotic fluid in women with preterm birth and inflammation in the amnion, and an increase in amniotic fluid HMGB1 can cause premature birth. However, it was not clear where amniotic HMGB1 was released. The results of the present invention revealed that the amnion plays an important role in leading to premature birth by secreting HMGB1 and other pro-inflammatory cytokines when inflammation in the amnion occurs. In addition, we found that the microRNA/target protein network associated with preterm birth is associated with preterm birth due to intraamniotic inflammation/chorioamnionitis. Although some studies have been reported on miRNAs that are differentially expressed in premature women, little is known about the role of miRNAs in preterm birth and how these miRNAs are involved in inducing preterm birth. The present inventors demonstrate that inflammation can alter the expression of miR-548 in the amniotic membrane and that suppressed miR-548 can enhance the inflammatory response in the amniotic fluid and induce premature birth.

양막 내 염증은 양막에서 HMGB1 발현의 상향 조절 및 miR-548 억제를 통한 HMGB1 유리를 유도한다. 또한, miR-548은 양막 상피 세포에서 염증 반응을 약화시킬 수 있다. HMGB1 발현에 대한 miR-548의 특이적 조절 기전은 불분명하지만, 이러한 데이터들은 조산에 대한 miR-548의 억제 효과에 기인하는 잠재적인 분자 기전을 보여 주며, 조기 융모양막염으로 인한 조산에 있어서 miR-548은 잠재적 치료 표적으로 생각된다.Inflammation in the amnion induces HMGB1 release through upregulation of HMGB1 expression and inhibition of miR-548 in the amnion. In addition, miR-548 can attenuate the inflammatory response in amniotic epithelial cells. The mechanism of specific regulation of miR-548 on HMGB1 expression is unclear, but these data show a potential molecular mechanism due to the inhibitory effect of miR-548 on preterm birth, and miR- in preterm birth due to premature chorionic amnion. 548 is considered a potential therapeutic target.

본 발명은 miR-548 또는 miR-548 모조물을 함유하는 조산 예방 또는 치료제 조성물에 관한 것이다.The present invention relates to a composition for preventing or treating preterm birth containing a miR-548 or miR-548 replica.

또한, 본 발명은 상기 miR-548이 miR-548aa, miR-548ai, miR-548a-3p 또는 miR-548x-5p임을 특징으로 하는 조산 예방 또는 치료제 조성물에 관한 것이다.In addition, the present invention relates to a composition for preventing or treating preterm birth, characterized in that the miR-548 is miR-548aa, miR-548ai, miR-548a-3p or miR-548x-5p.

또한, 본 발명은 상기 miR-548 또는 miR-548 모조물이 HMGB1 (high mobility group box 1 protein) 3' 비번역 부위에 결합하는 것을 특징으로 하는 조산 예방 또는 치료제 조성물에 관한 것이다.In addition, the present invention relates to a composition for preventing or treating preterm birth, characterized in that the miR-548 or miR-548 replica binds to the 3′ untranslated region of HMGB1 (high mobility group box 1 protein).

또한, 본 발명은 상기 miR-548 서열이 서열번호 5 내지 13 중 선택된 1종임을 특징으로 한다.In addition, the present invention is characterized in that the miR-548 sequence is one selected from SEQ ID NOs: 5 to 13.

또한, 본 발명은 상기 miR-548 모조물 서열이 서열번호 16 내지 23 중 1종임을 특징으로 한다.In addition, the present invention is characterized in that the miR-548 replica sequence is one of SEQ ID NOs: 16 to 23.

또한, 본 발명은 상기 조성물에 트랜스펙션 제제가 더 포함됨을 특징으로 한다.In addition, the present invention is characterized in that the composition further includes a transfection agent.

또한, 본 발명은 상기 조산이 염증에 의해 유도되는 조산임을 특징으로 한다.In addition, the present invention is characterized in that the premature birth is induced by inflammation.

또한, 본 발명은 miR-548 또는 miR-548 모조물을 함유하는 양막 내 염증 예방 또는 치료제 조성물에 관한 것이다.Further, the present invention relates to a composition for preventing or treating inflammation in amnion containing miR-548 or miR-548 replica.

또한, 본 발명은 상기 miR-548이 miR-548aa, miR-548ai, miR-548a-3p 또는 miR-548x-5p임을 특징으로 하는 양막 내 염증 예방 또는 치료제 조성물에 관한 것이다.In addition, the present invention relates to a composition for preventing or treating inflammation in the amnion, characterized in that the miR-548 is miR-548aa, miR-548ai, miR-548a-3p or miR-548x-5p.

또한, 본 발명은 상기 miR-548 서열이 서열번호 5 내지 13 중 선택된 1종임을 특징으로 하는 양막 내 염증 예방 또는 치료제 조성물에 관한 것이다.In addition, the present invention relates to a composition for preventing or treating inflammation in the amnion, characterized in that the miR-548 sequence is one selected from SEQ ID NOs: 5 to 13.

또한, 본 발명은 상기 miR-548 모조물 서열이 서열번호 16 내지 23 중 선택된 1종임을 특징으로 하는 양막 내 염증 예방 또는 치료제 조성물에 관한 것이다.In addition, the present invention relates to a composition for preventing or treating inflammation in the amniotic membrane, wherein the miR-548 replica sequence is one selected from SEQ ID NOs: 16 to 23.

또한, 본 발명은 상기 miR-548 또는 miR-548 모조물이 HMGB1 (high mobility group box 1 protein) 3' 비번역 부위에 결합하는 것을 특징으로 하는 양막 내 염증 예방 또는 치료제 조성물에 관한 것이다.In addition, the present invention relates to a composition for preventing or treating inflammation in the amniotic membrane, characterized in that the miR-548 or miR-548 replica binds to the 3′ untranslated region of HMGB1 (high mobility group box 1 protein).

또한, 본 발명은 상기 조성물에 트랜스펙션 제제가 더 포함됨을 특징으로 하는 양막 내 염증 예방 또는 치료제 조성물에 관한 것이다.In addition, the present invention relates to a composition for preventing or treating inflammation in amnion, characterized in that the composition further includes a transfection agent.

또한, 본 발명은 상기 양막 내 염증이 융모양막염임을 특징으로 하는 양막 내 염증 예방 또는 치료제 조성물에 관한 것이다.In addition, the present invention relates to a composition for preventing or treating inflammation in the amniotic membrane, characterized in that the inflammation in the amniotic membrane is chorionic amnionitis.

본 발명의 miR-548 또는 miR-548 모조물을 유효성분으로 함유하는 약학 조성물은 약제학적 분야에서 통상적으로 허용되는 담체와 함께 배합하여 통상적인 방법에 의해 피부 외용제, 경구, 스프레이, 패치 또는 주사 등 다양한 형태로 제형화할 수 있다. 예를 들면 경구용 조성물로는 정제 및 젤라틴 캡슐이 있으며, 이들은 활성 성분 이외에도 희석제(예: 락토스, 덱스트로스, 수크로스, 만니톨, 솔비톨, 셀룰로즈 및/또는 글리신), 활탁제(예: 실리카, 탤크, 스테아르산 및 그의 마그네슘 또는 칼슘염 및/또는 폴리에틸렌 글리콜)를 함유하고, 정제는 또한 결합제(예: 마그네슘 알루미늄 실리케이트, 전분 페이스트, 젤라틴, 메틸셀룰로스, 나트륨 카복시메틸셀룰로스 및/또는 폴리비닐피롤리돈)를 함유하며, 경우에 따라서 붕해제(예: 전분, 한천, 알긴산 또는 그의 나트륨염) 또는 비등 혼합물 및/또는 흡수제, 착색제, 향미제 및 감미제를 함유하는 것이 바람직하다. 주사용 조성물은 등장성 수용액 또는 현탁액이 바람직하고, 언급한 조성물은 멸균되고/되거나 보조제(예: 방부제, 안정화제, 습윤제 또는 유화제 용액 촉진제, 삼투압 조절을 위함 염/또는 완충제)를 함유한다. 또한, 이들은 기타 치료적으로 유용한 물질을 함유할 수 있다.The pharmaceutical composition containing the miR-548 or miR-548 replica of the present invention as an active ingredient is formulated with a carrier commonly accepted in the pharmaceutical field and used for external skin, oral, spray, patch or injection by a conventional method. It can be formulated in various forms. For example, oral compositions include tablets and gelatin capsules, which in addition to the active ingredient are diluents (e.g. lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine), lubricants (e.g. silica, talc). , Stearic acid and its magnesium or calcium salt and/or polyethylene glycol), and the tablet also contains a binder (e.g. magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone). ), and in some cases, a disintegrant (eg starch, agar, alginic acid or sodium salt thereof) or a boiling mixture and/or an absorbent, colorant, flavoring and sweetening agent. The composition for injection is preferably an isotonic aqueous solution or suspension, and the compositions mentioned are sterilized and/or contain adjuvants (e.g., preservatives, stabilizers, wetting or emulsifying agent solution accelerators, salts/or buffers for controlling the osmotic pressure). In addition, they may contain other therapeutically useful substances.

이와 같이 제조된 약학 제제는 목적하는 바에 따라 경구로 투여하거나, 비경구 방식 즉, 정맥 내, 피하, 복강 내 투여 또는 국소적용할 수 있다. 용량은 일일 투여량 0.0001~100㎎/㎏을 1 내지 수회에 나누어 투여할 수 있다. 특정 환자에 대한 투여용량 수준은 환자의 체중, 연령, 성별, 건강상태, 투여시간, 투여방법, 배설율, 질환의 중증도 등에 따라 변화될 수 있다.The pharmaceutical preparation prepared as described above may be administered orally, or parenterally, ie, intravenously, subcutaneously, intraperitoneally, or topically, as desired. The dose can be administered by dividing the daily dose of 0.0001 to 100 mg/kg in 1 to several times. The dosage level for a specific patient may vary depending on the patient's weight, age, sex, health status, administration time, administration method, excretion rate, and severity of disease.

이뿐만 아니라, 본 발명은 In addition to this, the present invention

정상 대조군 및 시험군의 인간 양막 또는 양수에서 miR-548의 농도를 측정하는 단계; Measuring the concentration of miR-548 in the human amniotic membrane or amniotic fluid of the normal control group and the test group;

정상 대조군 및 시험군의 miR-548 농도를 비교하는 단계; 및Comparing the miR-548 concentration of the normal control group and the test group; And

정상 대조군과 비교하여 miR-548의 농도가 유의하게 감소한 경우, 양막 내 염증 또는 조산 가능성이 높음을 판정하는 단계;를 포함하는 양막 내 염증 또는 염증에 의한 조산 가능성 예측 방법에 관한 것이다.When the concentration of miR-548 is significantly reduced compared to the normal control, the step of determining that the amnion has a high probability of inflammation or premature delivery; it relates to a method for predicting the likelihood of preterm birth due to inflammation or inflammation in the amniotic membrane.

본 발명자들은 융모양막염으로 인한 조산 환자에서 얻은 양막으로부터 분리된 일차 인간 양막 상피 세포와 대조군으로서 만삭 임신 여성 유래 양막의 양막 상피세포에서 HMGB1의 발현 수준을 측정한 결과, 환자의 양막 상피세포에서 HMGB1 발현이 정상 대조군보다 현저히 높았고, 환자 양막 상피세포에서 분비된 HMGB1이 정상 대조군에 비해 매우 증가하였으며, miR-548 클러스터의 모든 구성원들이 정상 대조군과 비교하여 융모양막염 조산 여성의 양막에서 현저히 감소하였음을 밝혔으며, miR-548 클러스터의 저하 조절이 융모양막염 조산 환자의 HMGB1 과발현에 기여함을 밝혔다. 또한, 본 발명자들은 인간 양막 상피세포에서 miR-548 클러스터의 과발현이 염증 반응을 억제할 수 있음을 밝혔다.The present inventors measured the expression level of HMGB1 in primary human amniotic epithelial cells isolated from the amniotic membrane obtained from premature birth patients due to chorioamnitis and the amniotic epithelial cells of the amniotic membrane derived from term pregnant women as a control. As a result, HMGB1 in the amniotic epithelial cells of the patient The expression was significantly higher than that of the normal control group, and HMGB1 secreted from the patient's amniotic epithelial cells was significantly increased compared to the normal control group, and all members of the miR-548 cluster were significantly decreased in the amniotic membrane of premature women with chorionic amniotic infection compared to the normal control group. It was found that the regulation of the reduction of the miR-548 cluster contributes to the overexpression of HMGB1 in premature patients with chorioamnionitis. In addition, the present inventors have found that overexpression of the miR-548 cluster in human amniotic epithelial cells can inhibit the inflammatory response.

본 발명자들은 이러한 결과들로부터 miR-548 또는 miR-548의 모조물을 구성성분으로 하는 약학 조성물을 투여할 경우 양막 내 염증 및/또는 조산을 예방 또는 치료할 가능성을 밝혔다.From these results, the present inventors have revealed the possibility of preventing or treating inflammation and/or premature birth in the amniotic membrane when administering a pharmaceutical composition containing miR-548 or miR-548 mimic as a component.

또한, 본 발명자들은 양수 또는 양막의 miR-548 수준을 측정하여 정상 대조군과 비교하여 유의하게 감소한 경우 양막 내 염증 및/또는 조산의 가능성이 높음을 예측할 수 있음을 밝혔다.In addition, the present inventors measured the miR-548 level in the amniotic fluid or the amniotic membrane and found that it is possible to predict that the likelihood of inflammation and/or premature birth in the amniotic membrane is high when it is significantly reduced compared to the normal control.

도 1은 양수의 HMGB1 및 IL-6 수준을 나타낸다. A, B, 양막 내 염증이 있는 여성과 없는 여성의 HMGB1 및 IL-6 농도. C, 급성기 사이토카인 인터류킨 (IL)-6에 대한 양수 HMGB1의 관계.
도 2는 양막 및 인간 양막 상피세포에서 HMGB1 mRNA와 단백질의 발현을 나타낸다. A, 조산 및 융모양막염이 있는 여성과 정상 출산 대조군 여성 양막의 HMGB1 mRNA 및 단백질 발현. B, 조산 및 융모양막염이 있는 여성과 정상 출산 대조군 여성의 양막 상피세포에서의 HMGB1 mRNA 및 단백질 발현. C, 조산 및 융모양막염이 있는 여성과 정상 출산 대조군 여성의 양막 상피세포 배양 배지의 HMGB1 수준. **는 대조군과 비교하여 현저한 차이 (P<0.001)가 있음을 의미함. hAECs: 인간 양막 상피세포 (human amniotic epithelial cells); PD-hAECs: 환자 유래 인간 양막 상피세포.
도 3은 양막 및 인간 양막 상피세포 (hAECs)에서 miRNA-548 클러스터의 발현을 나타낸다. A, 조산 및 융모양막염이 있는 여성 및 정상 출산 대조군 여성의 양막의 miRNA-548aa, miRNA-548ai, miRNA-548a-3p 및 miRNA-548x-5p 수준. B, 환자 유래 hAECs (PD-hAECs) 및 정상의 건강한 여성 유래 hAECs 내의 miRNA-548aa, miRNA-548ai, miRNA-548a-3p 및 miRNA-548x-5p 수준. ** 대조군과 비교하여 현저한 차이(P<0.01)가 있음을 나타냄. * 대조군과 비교하여 현저한 차이 (P<0.05)가 있음을 나타냄. hAECs: 인간 양막 상피세포 (human amniotic epithelial cells).
도 4는 인간 양막 상피세포 (hAECs)의 miRNA-548 클러스터가 HMGB1 발현을 조절할 수 있음을 보여준다. A, miRNA-548aa 억제제, miRNA-548ai 억제제, miRNA-548a-3p 억제제, miRNA-548x-5p 억제제 및 대조군 억제제로 트랜스펙션한 hAECs 내의miRNA-548aa, miRNA-548ai, miRNA-548a-3p 및 miRNA-548x-5p 수준. B, miRNA-548 억제제 및 대조군 억제제로 트랜스펙션한 hAECs에서의 HMGB1 mRNA와 단백질 발현. C, miRNA-548 억제제와 대조군 억제제로 트랜스펙션한 hAECs 배양 배지 내의 HMGB1 수준. ** 대조군과 비교하여 현저한 차이 (P<0.01)가 남을 의미함.
도 5는 LPS (Lipopolysaccharide) 매개 염증이 miRNA-548 클러스터의 저하조절을 통해 HMGB1 발현 증가를 유도함을 보여준다. A, 24시간 동안 10 또는 100 ng/mL LPS로 처리한 hAECs에서의 miRNA-548aa, miRNA-548ai, miRNA-548a-3p 및 miRNA-548x-5p 수준. B, 24시간 동안 10 또는 100 ng/mL LPS로 처리한 hAECs에서의 HMGB1 mRNA 및 단백질 발현. C, 24시간 동안 10 또는 100 ng/mL LPS로 처리한 hAECs 배양 배지의 HMGB1 수준. **는 대조군과 비교하여 현저한 차이 (P<0.01)가 있음을 의미한다. *는 대조군과 비교하여 현저한 차이 (P<0.05)가 있음을 의미한다. LPS: 지다당 (Lipopolysaccharide).
도 6은 인간 양막 상피세포에서 miR-548 클러스터가 LPS-유도 염증을 완화할 수 있음을 보여준다. A, miRNA-548 모조물 (mimic) 및 대조군 모조물로 트랜스펙션된 인간 양막 상피세포에서 LPS로 처리했을 때와 LPS 처리하지 않았을 때의 HMGB1 mRNA 및 단백질 발현. B, miRNA-548 모조물 및 대조군 모조물로 트랜스펙션된 인간 양막 상피세포를 LPS로 처리했을 때와 LPS 처리하지 않았을 때 배양 배지 내의 HMGB1 수준. C, miRNA-548 모조물 및 대조군 모조물로 트랜스펙션된 인간 양막 상피세포를 LPS로 처리했을 때와 LPS 처리하지 않았을 때 배양 배지 내의 IL-1β, IL-6 및 IL-8 수준. ** 대조군 모조물과 비교하여 현저한 차이 (P<0.001)가 있음을 의미함, * 대조군과 비교하여 현저한 차이 (P<0.001)가 있음을 의미함. LPS: 지다당 (Lipopolysaccharide); IL: 인터류킨 (interleukin).Figure 1 shows the HMGB1 and IL-6 levels of amniotic fluid. A, B, HMGB1 and IL-6 concentrations in women with and without inflammation in the amnion. C, Relationship of amniotic HMGB1 to the acute phase cytokine interleukin (IL)-6.
2 shows the expression of HMGB1 mRNA and protein in amniotic membrane and human amniotic membrane epithelial cells. A, HMGB1 mRNA and protein expression in the amniotic membrane of women with preterm and chorionic amniotic and normal birth control women. B, HMGB1 mRNA and protein expression in amniotic epithelial cells of women with preterm and chorionic amniotic and normal birth control women. C, HMGB1 levels in amnion epithelial cell culture medium in women with preterm and chorionic amniotic and normal birth control women. ** means there is a significant difference (P<0.001) compared to the control group. hAECs: human amniotic epithelial cells; PD-hAECs: human amniotic epithelial cells derived from patients.
3 shows the expression of the miRNA-548 cluster in amnion and human amnion epithelial cells (hAECs). A, levels of miRNA-548aa, miRNA-548ai, miRNA-548a-3p and miRNA-548x-5p in the amnion of women with preterm and chorionic amniotic and normal birth control women. B, levels of miRNA-548aa, miRNA-548ai, miRNA-548a-3p and miRNA-548x-5p in patient-derived hAECs (PD-hAECs) and normal healthy female-derived hAECs. ** Indicates that there is a significant difference (P<0.01) compared to the control group. * It indicates that there is a significant difference (P<0.05) compared to the control group. hAECs: human amniotic epithelial cells.
Figure 4 shows that the miRNA-548 cluster of human amnion epithelial cells (hAECs) can regulate HMGB1 expression. A, miRNA-548aa, miRNA-548ai, miRNA-548a-3p and miRNA in hAECs transfected with miRNA-548aa inhibitor, miRNA-548ai inhibitor, miRNA-548a-3p inhibitor, miRNA-548x-5p inhibitor and control inhibitor -548x-5p level. B, HMGB1 mRNA and protein expression in hAECs transfected with miRNA-548 inhibitor and control inhibitor. C, HMGB1 levels in hAECs culture medium transfected with miRNA-548 inhibitor and control inhibitor. ** This means that there is a significant difference (P<0.01) compared to the control group.
5 shows that LPS (Lipopolysaccharide)-mediated inflammation induces an increase in HMGB1 expression through lowering regulation of the miRNA-548 cluster. A, levels of miRNA-548aa, miRNA-548ai, miRNA-548a-3p and miRNA-548x-5p in hAECs treated with 10 or 100 ng/mL LPS for 24 hours. B, HMGB1 mRNA and protein expression in hAECs treated with 10 or 100 ng/mL LPS for 24 hours. C, HMGB1 levels in hAECs culture medium treated with 10 or 100 ng/mL LPS for 24 hours. ** means there is a significant difference (P<0.01) compared to the control group. * Means there is a significant difference (P<0.05) compared to the control group. LPS: Lipopolysaccharide.
6 shows that the miR-548 cluster in human amniotic epithelial cells can alleviate LPS-induced inflammation. A, HMGB1 mRNA and protein expression when treated with LPS and without LPS in human amniotic epithelial cells transfected with miRNA-548 mock (mimic) and control mock. B, HMGB1 levels in culture medium when human amniotic epithelial cells transfected with miRNA-548 replicas and control replicas were treated with LPS and without LPS treatment. Levels of IL-1β, IL-6 and IL-8 in culture medium when human amniotic epithelial cells transfected with C, miRNA-548 replica and control replica were treated with LPS and without LPS treatment. ** Means that there is a significant difference (P<0.001) compared to the control replica, * Means that there is a significant difference (P<0.001) compared to the control. LPS: Lipopolysaccharide; IL: interleukin.

아래에서는 구체적인 실시예를 들어 본 발명의 구성을 좀 더 자세히 설명한다. 그러나, 본 발명의 범위가 실시예의 기재에만 한정되는 것이 아님은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 자명하다.Hereinafter, the configuration of the present invention will be described in more detail with reference to specific embodiments. However, it is apparent to those of ordinary skill in the art that the scope of the present invention is not limited only to the description of the examples.

재료와 방법Materials and methods

환자와 양수 채취Patient and amniotic fluid collection

우리는 단태 임신 (singleton pregnancies)을 한 48명의 여성으로부터 양수(AF) 시료를 조사하였고 임상적으로 양수 천자(Amniocentis)를 수행했다. 시료는 제2 삼분기 유전자 핵형 검사 (n = 10)에 대한 경복식 양수 천자 (transabdominal amniocentesis)로 얻거나, 자궁수축 억제나 자궁경부확장에 대한 저항성이 있는 여성 (n=38)의 양수 감염을 배제하기 위해 채취했다. 제외 기준은 무양수증 (anhydramnios), HIV 또는 간염 바이러스 감염, 선천성 이상 또는 비정상 핵형의 존재였다. 임신 14주 전 초음파 검사로 확인된 마지막 월경 기간을 기준으로 재태연령 (gestational age)을 정했다. 조기 진통은 임신 37주 전 환자의 정기적인 자궁 수축의 존재로 정의되며, 자궁 경부 소실 및/또는 개대로 기록되었다. 양막 내 염증 (Intra-amniotic inflammation; IAI)은 양수 인터류킨 (IL)-6 농도 = 2,600 pg/mL로 정의되었다 [32]. 양수 및 태반 검체 채취 전에 시험 대상 여성들 전원으로부터 서면 동의를 받았다. 시료의 수집과 활용은 강남성심병원 윤리위원회의 승인을 받았다.We examined amniotic fluid (AF) samples from 48 women with singleton pregnancies and clinically performed amniotic fluid puncture (Amniocentis). Samples were obtained by transabdominal amniocentesis for the second trimester genotyping (n = 10), or for amniotic fluid infection in women (n = 38) with resistance to uterine contraction or cervical dilatation. Collected to rule out. Exclusion criteria were anhydramnios, HIV or hepatitis virus infection, congenital abnormalities or the presence of abnormal karyotypes. Gestational age was determined based on the last menstrual period confirmed by ultrasound 14 weeks before pregnancy. Early labor is defined as the presence of regular uterine contractions in the patient 37 weeks prior to gestation, and was recorded as cervical loss and/or patency. Intra-amniotic inflammation (IAI) was defined as amniotic interleukin (IL)-6 concentration = 2,600 pg/mL [32]. Written consent was obtained from all women tested before amniotic fluid and placenta specimens were collected. The collection and use of samples were approved by the Gangnam Sacred Heart Hospital Ethics Committee.

양수에 대한 화학적 및 미생물학적 연구Chemical and microbiological studies of amniotic fluid

무균 상태에서의 검색 후, 양수에 대하여 포도당 농도, 백혈구 (WBC) 수, 그람 염색으로 분석하고, 유레아플라즈마 (Ureaplasma) 및 마이코플라즈마 (Mycoplasma) 종을 포함한 호기성 및 혐기성 박테리아의 표준 배양을 위해 분석하였다. 나머지 양수를 2mL 바이알에 나누어 넣고 -80℃에서 저온 보존하였다.After screening in aseptic conditions, amniotic fluid was analyzed by glucose concentration, white blood cell (WBC) count, and Gram staining, and analyzed for standard culture of aerobic and anaerobic bacteria including Ureaplasma and Mycoplasma species. . The remaining amniotic water was divided into a 2 mL vial and stored at -80°C at low temperature.

양수 Positive number HMGB1HMGB1 및 IL-6의 효소 결합 면역흡착 분석 (ELISA) And enzyme-linked immunosorbent assay of IL-6 (ELISA)

양수 및 세포 배양 배지 (조건화 배지) 중 IL-6 및 HMGB1의 수준을 ELISA 분석 키트 (Cusabio, Wuhan, China)로 제조자의 지시에 따라 측정하였다. 배양 배지 중 IL-1β 및 IL-8의 수준을 ELISA 분석 키트 (Cusabio 및 RayBiotech, Norcross, GA, USA)를 사용하여 제조자의 지시에 따라 측정하였다.The levels of IL-6 and HMGB1 in amniotic fluid and cell culture medium (conditioned medium) were measured with an ELISA assay kit (Cusabio, Wuhan, China) according to the manufacturer's instructions. The levels of IL-1β and IL-8 in the culture medium were measured according to the manufacturer's instructions using an ELISA assay kit (Cusabio and RayBiotech, Norcross, GA, USA).

양막 수집 및 처리Amnion collection and processing

태반(n=6)은 조기 양막파수 및/또는 조기 진통 후 지연 시간이 길어져 발생하는 융모양막염 의심 여성(중간 재태 연령 29.4주, 범위 25.3-35.0주)과 진통이 없는 기간에 선택적 제왕절개를 하는 건강한 여성(n=4) (중간 재태 연령 38.1주, 범위 20.1~39.0주)에게서 얻었다. 양막은 수동으로 융모막에서 벗겨 작은 조각(각각 약 1.0㎤)으로 나누었다. 시료 채취 후 남은 완전 두께의 태반 생검을 입수하여 포르말린으로 고정하였다. 생검 검체는 임상 및 검사 소견에 대해 모르는 태반 병리학자에 의해 해석되었다. 조직학적으로 융모양막염으로 진단된 양막 시료는 실험에서 환자 시료로 이용되었다. Placenta (n=6) is a female with suspected chorionic amnion (intermediate gestational age 29.4 weeks, range 25.3-35.0 weeks) due to a prolonged delay after early amniotic membrane rupture and/or early labor, and selective cesarean section in the period without pain. It was obtained from healthy women (n=4) (median gestational age 38.1 weeks, range 20.1-39.0 weeks). The amnion was manually peeled off the chorionic membrane and divided into small pieces (approximately 1.0 cm3 each). A full-thick placenta biopsy remaining after sample collection was obtained and fixed with formalin. Biopsy specimens were interpreted by a placental pathologist who was unaware of clinical and laboratory findings. The amniotic membrane sample, histologically diagnosed as chorioamnitis, was used as a patient sample in the experiment.

양막 상피세포 분리Isolation of amniotic epithelial cells

양막 (n = 5)은 출산 전에 분만 제왕 절개를 시행한 여성과 조산 및 융모양막염이 있는 여성 (n = 3)에게서 얻었다. 일차 인간 양막 상피세포 (hAECs)는, (PBS, pH=7.2) 앞서 기재된 것과 같이 얻은 양막에서 분리하였다 [33-36]. 간단히 설명하면, 양막을 차가운 인산염 완충 식염수로 세척하여 혈병 및 세포 파편을 제거하고, 약 6cm 길이의 조각으로 자른다. 첫 번째 효소 소화는 37℃에서 10분 동안 온화하게 진탕하면서 예열된 0.05% 트립신/EDTA (Thermo Fisher Scientific, Waltham, MA, USA) 20 mL로 막 조각을 배양하여 수행하였다. 이 단계에서 얻은 세포는 혈병 및 세포 파편을 제거하기 위해 버렸다. 두 번째와 세 번째 소화도 같은 방식으로 수행되었다. 막 조각을 0.05% 트립신/EDTA 20mL가 들어있는 새로운 50mL 원추형 튜브에 옮기고 부드럽게 흔들면서 37℃에서 30분 동안 배양했다. 두 번째 및 세 번째 소화에서 얻은 소화 혼합물을 70-㎛ 세포 여과기에 넣고 500×g에서 10분간 원심분리하였다. 세포 펠릿을 현탁하고, 10% 소 태아 혈청, 100 U/㎖ 페니실린, 100 ㎍/㎖ 스트렙토마이신 (Sigma-Aldrich, St. Louis, MO, USA) 및 10 ng/mL 상피세포 성장인자 (R&D Systems, Madison, WI, USA)가 보충된 DMEM/F12 (Gibco, Franklin Lakes, NJ, USA)에서 배양하였다.Amniotic membrane (n = 5) was obtained from women who underwent a cesarean section before delivery and women with preterm birth and chorionic amnioticitis (n = 3). Primary human amniotic epithelial cells (hAECs) (PBS, pH=7.2) were isolated from the amnion obtained as described above [33-36]. Briefly, the amnion is washed with cold phosphate buffered saline to remove blood clots and cellular debris, and cut into pieces about 6 cm long. The first enzymatic digestion was performed by incubating the membrane pieces with 20 mL of preheated 0.05% trypsin/EDTA (Thermo Fisher Scientific, Waltham, MA, USA) with gentle shaking at 37° C. for 10 minutes. The cells obtained at this stage were discarded to remove blood clots and cell debris. The second and third digestions were carried out in the same way. The membrane pieces were transferred to a new 50 mL conical tube containing 20 mL of 0.05% trypsin/EDTA and incubated at 37° C. for 30 minutes while gently shaking. The digestion mixture obtained from the second and third digestion was placed in a 70-µm cell filter and centrifuged at 500×g for 10 minutes. The cell pellet was suspended and 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin (Sigma-Aldrich, St. Louis, MO, USA) and 10 ng/ml epithelial growth factor (R&D Systems, Madison, WI, USA) supplemented with DMEM/F12 (Gibco, Franklin Lakes, NJ, USA).

세포 배양 및 시약Cell culture and reagents

양막 조직 유래 일차 hAECs 세포를 깔고 5% CO2 분위기의 습한 배양기 내에서 37℃로 배양하면서 유지하였다. JetPrime 트랜스펙션 시약은 PolyPlus-Transfection (Strasbourg, France)에서 구입하였다. HMGB1 항체 (Cell Signaling Technology, Beverly, MA, USA)와 액틴 항체 (Santa Cruz Biotechnology, Santa Cruz, CA, USA)를 이용하였다. Escherichia coli 0111:B4 변종 유래 지다당 (LPS)은 Sigma-Aldrich에서 구입하였다.The primary hAECs cells derived from amnion tissue were laid and maintained while culturing at 37°C in a humid incubator in a 5% CO 2 atmosphere. JetPrime transfection reagent was purchased from PolyPlus-Transfection (Strasbourg, France). HMGB1 antibody (Cell Signaling Technology, Beverly, MA, USA) and actin antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) were used. Escherichia Lipopolysaccharide (LPS) derived from coli 0111:B4 strain was purchased from Sigma-Aldrich.

웨스턴Western 블롯Blot 분석 analysis

웨스턴 블롯 분석은 표준 절차에 따라 수행하였다 [37]. 동량의 단백질을 10% SDS-전기영동으로 분리하고 폴리비닐 플루오라이드 막 (Thermo Fisher Scientific)에 옮겼다. 표적 단백질은 향상된 화학발광시약 (Thermo Fisher Scientific)으로 탐지하였다. Western blot analysis was performed according to standard procedures [37]. Equal amounts of protein were separated by 10% SDS-electrophoresis and transferred to a polyvinyl fluoride membrane (Thermo Fisher Scientific). The target protein was detected with an improved chemiluminescent reagent (Thermo Fisher Scientific).

표적 유전자 Target gene miRNAmiRNA 예측과 기능적 및 생물정보학적 분석 Prediction and functional and bioinformatics analysis

HMGB1 3'UTR 상의 결합 부위와 miR-548 클러스터의 서열은 표적 예측 프로그램인 TargetScan (http://www.targetscan.org), MiRDB (http://mirdb.org) 및 miRmap (https://mirmap.ezlab.org)으로 예측하였다. 짝을 이룬 서열 정렬은 선으로 표시된다 (표 1).The binding site on HMGB1 3'UTR and the sequence of the miR-548 cluster are determined by target prediction programs TargetScan (http://www.targetscan.org), MiRDB (http://mirdb.org) and miRmap (https://mirmap). .ezlab.org). Paired sequence alignments are indicated by lines (Table 1).

RNA 분리 및 정량적 RNA isolation and quantitative PCRPCR ( ( qPCRqPCR ))

총 RNA 시료는 세포와 양막 조직으로부터 트리졸 시약 (Invitrogen, Carlsbad, CA, USA)을 이용하여 분리하였다. 5㎍의 RNA를 이용하여 Maxime RT PreMix Kit (iNtRON Biotechnology, Seoul, South Korea)로 cDNA를 합성하였다. PCR 반응은 Rotor-Gene Q (Qiagen)에서 2Х Rotor-Gene SYBR Green PCR Master Mix (Qiagen, Carlsbad, CA, USA)를 이용하여 수행하였다. 사용된 프라이머는 다음과 같다: HMGB1 정방향 프라이머: 5'-ACATCCAAAATCTTGATCAGTTA-3', HMGB1 역방향 프라이머: 5'-CTCCTTAATGTC ACGCACGA-3', 액틴 정방향 프라이머: 5'-CATGTACGTTGCTA TCCAGGC-3', 액틴 역방향 프라이머: 5'-CTCCTTAATGTCACGCACGA-3'. miRNA 발현 분석을 위하여, miRNeasy (Qiagen)를 이용하여 hAECs 및 양막 조직으로부터 miRNA를 분리하였고, miScript Transcription Kit (Qiagen)로 역전사하였다. Rotor-Gene Q (Qiagen)를 이용하여 miScript SYBR Green PCR Kit (Qiagen)로 miRNA 발현 수준을 측정하였다. miRNAs 및 내생 대조군 U6 유전자에 대한 프라이머는 표 2와 표 3에 나타내었다.Total RNA samples were isolated from cells and amniotic tissues using Trizol reagent (Invitrogen, Carlsbad, CA, USA). CDNA was synthesized with Maxime RT PreMix Kit (iNtRON Biotechnology, Seoul, South Korea) using 5 μg of RNA. The PCR reaction was performed in Rotor-Gene Q (Qiagen) using 2Х Rotor-Gene SYBR Green PCR Master Mix (Qiagen, Carlsbad, CA, USA). The primers used were as follows: HMGB1 forward primer: 5'-ACATCCAAAATCTTGATCAGTTA-3', HMGB1 reverse primer: 5'-CTCCTTAATGTC ACGCACGA-3', actin forward primer: 5'-CATGTACGTTGCTA TCCAGGC-3', actin reverse primer: 5'-CTCCTTAATGTCACGCACGA-3'. For the analysis of miRNA expression, miRNA was isolated from hAECs and amniotic tissue using miRNeasy (Qiagen), and reverse transcription was performed with the miScript Transcription Kit (Qiagen). The miRNA expression level was measured with the miScript SYBR Green PCR Kit (Qiagen) using Rotor-Gene Q (Qiagen). Primers for miRNAs and endogenous control U6 gene are shown in Tables 2 and 3.

miRNAmiRNA -548 -548 클러스터에 대한 강제Force on cluster 발현Manifestation 및 억제 발현 And inhibition expression

miRNAs의 효과를 확인하기 위하여, JetPrime (Polyplus-Transfection)을 이용하여 miR-548 억제제, 모조물 (mimic) 및 음성 대조군을 트랜스펙션하였다. miRNA를 포함하는 총 RNA와 단백질을 트랜스펙션 36시간 후 분리하여 웨스턴 블롯 분석과 qPCR에 이용하였다. miR 억제제와 모조물의 서열은 표 2에 나타내었다. 10 및 100 ng/mL LPS 존재 하에 hAECs를 배양하여 염증을 유도하였다. 배양 배지는 HMGB1 수준을 측정하기 위하여 24시간 배양 후 수집하였다.In order to confirm the effect of miRNAs, a miR-548 inhibitor, mimic, and negative control were transfected using JetPrime (Polyplus-Transfection). Total RNA and protein including miRNA were separated 36 hours after transfection and used for Western blot analysis and qPCR. The sequences of the miR inhibitor and the replica are shown in Table 2. Inflammation was induced by culturing hAECs in the presence of 10 and 100 ng/mL LPS. The culture medium was collected after 24 hours incubation in order to measure the HMGB1 level.

통계 분석Statistical analysis

모든 실험은 최소 세 번 반복 수행하였다. 통계 분석은 SPSS version 18.0 (SPSS Inc., Chicago, IL, USA)을 이용하여 수행하였다. 데이터는 모수적 데이터 (parametric data)에 대해서는 Student's t test로 비교하고, 또는 비모수적 데이터 (nonparametric data)에 대해서는 Mann-Whitney U test로 비교하였다. Spearman 상관 관계는 선택된 독립 변수들 사이의 공선성을 측정하는 데 사용되었다. 비율 간의 비교는 피셔의 정확 검정 (Fisher's exact test)으로 수행되었다. 면역 분석 데이터의 통계 분석은 데이터의 로그 변환 후에 수행되었다. 통계의 유의성은 p<0.05일 때 나타내었다.All experiments were repeated at least three times. Statistical analysis was performed using SPSS version 18.0 (SPSS Inc., Chicago, IL, USA). Data were compared with Student's t test for parametric data or Mann-Whitney U test for nonparametric data. The Spearman correlation was used to measure the collinearity between selected independent variables. Comparison between proportions was performed with Fisher's exact test. Statistical analysis of the immunoassay data was performed after log transformation of the data. The significance of statistics was indicated when p<0.05.

결과 1: 양수와 양막에서 Outcome 1: in amniotic fluid and amnion HMGB1의HMGB1 발현 Manifestation

우리는 감염 (n=38)을 배제하거나 유전적 표시 (n = 10)를 위하여 양수 천자를 받아 조산 징후 또는 증상이 있는 여성에게서 얻은 양수에서 HMGB1 수치를 분석하였다. 표 4는 양수 천자로 환자의 임상 특성을 비교한 것이다. 48명의 환자 중 3/4이 양막 내 감염으로 진단되었다. HMGB1의 양수 농도 중앙값 [사분위 범위]은 양막 내 감염이 없는 환자보다 감염 환자에서 유의하게 높았다 (563.8 [373.0-800.0] vs 273.0 [47.0-539.3] pg/mL, p=0.004; 도 1의 A). HMGB1의 수준은 IL-6의 수준과 현저한 상관 관계가 있었다 (r=0.571; p<0.001; 도 1의 C).We analyzed HMGB1 levels in amniotic fluid obtained from women with signs or symptoms of preterm birth by amniotic fluid puncture to rule out infection (n=38) or for genetic indication (n=10). Table 4 compares the clinical characteristics of patients with amniotic fluid puncture. Three-quarters of 48 patients were diagnosed with intraamniotic infection. The median amniotic fluid concentration [interquartile range] of HMGB1 was significantly higher in infected patients than in patients without intraamniotic infection (563.8 [373.0-800.0] vs 273.0 [47.0-539.3] pg/mL, p=0.004; FIG. 1A ). The level of HMGB1 was significantly correlated with the level of IL-6 (r=0.571; p<0.001; Fig. 1C).

HMGB1 mRNA와 단백질의 발현은 정상 대조군과 비교하여 조산 및 융모양막염 여성의 양막에서 증가하였다 (도 2의 A). 이 데이터를 확인하기 위해 우리는 융모양막염으로 인한 조산 환자에서 얻은 양막으로부터 분리된 일차 인간 양막 상피 세포 (환자 유래 hAECs, PD-hAECs)와 대조군으로서 만삭 임신 여성 유래 양막의 양막 상피세포 (hAECs)에서 HMGB1의 발현 수준을 측정하였다. 예측대로, PD-hAECs에서 HMGB1 발현은 hAECs보다 현저히 높았다 (도 2의 B). 또한, PD-hAECs에서 분비된 HMGB1은 hAECs 분비 HMGB1에 비해 매우 증가하였다 (도 2의 C). 이 결과들은 HMGB1이 융모양막염에 의해 결정된 조산의 조기 예측을 위한 새로운 바이오마커 후보임을 의미한다.The expression of HMGB1 mRNA and protein was increased in the amniotic membrane of preterm labor and chorionic amniotic women compared to the normal control (Fig. 2A). To confirm this data, we used primary human amniotic epithelial cells (patient-derived hAECs, PD-hAECs) isolated from amniotic membranes obtained from premature birth patients due to chorioamnitis and amniotic epithelial cells (hAECs) derived from term pregnant women as controls. The expression level of HMGB1 was measured. As expected, HMGB1 expression in PD-hAECs was significantly higher than that of hAECs (Fig. 2B). In addition, HMGB1 secreted from PD-hAECs was significantly increased compared to HMGB1 secreting hAECs (Fig. 2C). These results imply that HMGB1 is a new biomarker candidate for early prediction of preterm birth determined by chorioamnitis.

결과 2: Outcome 2: MiRMiR -548 클러스터는 조산 및 융모양막염 환자의 양막에서 과소발현된다.The -548 cluster is underexpressed in the amniotic membrane of preterm labor and chorionic amniotic patients.

miR-548 클러스터를 포함하여 몇몇 miRNA들은 대조군과 비교하여 자연조산 환자에서 저하조절되는 것으로 보고된다. 그리하여, 본 발명자들은 HMGB1과 miR-548 클러스터의 상관관계를 조사하였다. miR-548 클러스터의 몇몇 결합부위는 HMGB1의 3' UTR 내에 있을 것으로 컴퓨터에 의해 예측되었다 (표 1). miR-548 클러스터가 융모양막염이 있는 조산 환자의 HMGB1의 음성 조절자일 가능성을 알아보기 위하여, miR-548aa, miR-548ai, miR-548-3p 및 miR-548x-5p를 포함하는 miR-548 클러스터의 발현 수준을 양막에서 qPCR을 이용하여 측정하였다. 또한, 우리는 자연 조산에서 발현 감소를 보이는 miR-302b를 조사하였다 [31]. 도 3의 A와 같이, miR-548 클러스터의 모든 구성원들은 정상 대조군과 비교하여 융모양막염 조산 여성의 양막에서 현저히 감소하였다. 이뿐만 아니라, miR-548 클러스터의 발현은 정상의 건강한 여성 유래 hAECs보다 PD-hAECs에서 감소하였다 (도 3의 B). 그러나, 조산 여성과 정상 대조군 간에 miR-302b의 발현 수준에는 유의한 차이가 없었다 (데이터 나타내지 않음). 이러한 결과는 융모양막염 조산 환자에서 miR-548 클러스터가 HMGB1 발현의 억제 조절자가 될 수 있음을 암시한다.Several miRNAs, including the miR-548 cluster, are reported to be underregulated in spontaneous preterm patients compared to controls. Thus, the present inventors investigated the correlation between HMGB1 and miR-548 cluster. Several binding sites of the miR-548 cluster were predicted by computer to be within the 3'UTR of HMGB1 (Table 1). In order to investigate the possibility that the miR-548 cluster is a negative regulator of HMGB1 in premature patients with chorioamnitis, the miR-548 cluster including miR-548aa, miR-548ai, miR-548-3p and miR-548x-5p. The expression level of was measured in the amnion using qPCR. In addition, we investigated miR-302b, which showed decreased expression in natural preterm birth [31]. As shown in FIG. 3A, all members of the miR-548 cluster were significantly reduced in the amniotic membrane of premature women with chorionic amniotic infection compared to the normal control group. In addition, the expression of the miR-548 cluster was decreased in PD-hAECs compared to hAECs derived from normal healthy females (Fig. 3B). However, there was no significant difference in the expression level of miR-302b between the premature female and the normal control group (data not shown). These results suggest that the miR-548 cluster may be an inhibitory modulator of HMGB1 expression in patients with premature chorionic amnion.

결과 3: Outcome 3: MiRMiR -548 클러스터는 -548 cluster hAECs에서in hAECs HMGB1HMGB1 발현을 조절할 수 있다. Expression can be regulated.

융모양막염 조산 환자에서 HMGB1과 miR-548 클러스터 간의 상관관계를 밝히기 위하여 hAECs에서 miR-548 클러스터에 대한 합성 모조물과 억제제 (표 3)를 이용하여 HMGB1 발현 수준에 miR-548 클러스터의 발현 수준이 결정적인지를 조사하였다. miR-548 클러스터의 저하 조절이 HMGB1 발현의 증대를 유도하는지를 시험하기 위하여 hAECs를 miR-548aa 억제제, miR-548ai 억제제, miR-548a-3p 억제제 또는 miR-548x-5p 억제제로 트랜스펙션한 다음 qPCR 하였다 (도 4, A). miR-548 클러스터의 억제제들은 대조군 억제제와 비교하여 hAECs의 HMGB1 mRNA 및 단백질 발현 수준을 모두 현저히 증가시켰다 (도 4, B). 이뿐만 아니라, miR-548 억제제로 트랜스펙션된 hAECs의 배양 배지 내의 HMGB1 수준도 대조군 억제제로 트랜스펙션된 것과 비교하여 증가하였다 (도 4, C). 이러한 결과들은 miR-548 클러스터의 저하 조절이 융모양막염 조산 환자의 HMGB1 과발현에 기여했음을 말해준다. 또한, miR-548 클러스터의 발현과 HMGB1 수준 사이의 음의 상관관계는 융모양막염으로 인한 조산과 관련이 있었다.To elucidate the correlation between HMGB1 and miR-548 clusters in patients with chorionic amniotic infection, the expression level of the miR-548 cluster was determined by using a synthetic replica and inhibitor (Table 3) for the miR-548 cluster in hAECs. Investigate whether it is crucial. To test whether the reduction of miR-548 cluster induces an increase in HMGB1 expression, hAECs were transfected with a miR-548aa inhibitor, miR-548ai inhibitor, miR-548a-3p inhibitor, or miR-548x-5p inhibitor, followed by qPCR. (Fig. 4, A). Inhibitors of the miR-548 cluster significantly increased both HMGB1 mRNA and protein expression levels of hAECs compared to control inhibitors (Fig. 4, B). In addition, HMGB1 levels in the culture medium of hAECs transfected with the miR-548 inhibitor were also increased compared to those transfected with the control inhibitor (FIG. 4, C). These results suggest that the regulation of the reduction of the miR-548 cluster contributed to HMGB1 overexpression in patients with chorionic amnion. In addition, a negative correlation between the expression of the miR-548 cluster and HMGB1 levels was associated with premature birth due to chorioamnitis.

결과 4:Outcome 4: LPSLPS -유도 염증은 -Induced inflammation miRmiR -548 클러스터의 저하조절을 통해 -548 through cluster degradation HMGB1HMGB1 발현의 증대를 유도한다. Induces an increase in expression.

융모양막염 조산 환자에서 miR-548 클러스터와 HMGB1 간의 음의 상관관계의 역할을 평가하기 위하여, hAECs를 지다당 (10 또는 100 ng/mL)으로 24시간 동안 처리하여 염증을 유도한 다음 miR-548 클러스터와 HMGB1의 발현 수준을 측정하였다. 대조군과 비교하여 지다당은 hAECs에서 miR-548 클러스터의 발현을 저해하고 HMGB1 mRNA를 증가시켰다 (도 5, A와 B). 정상 대조군과 비교하여 지다당으로 자극한 hAECs의 배양 배지에서는 HMGB1 수준의 현저한 증가도 관찰되었다 (도 5, C). 이러한 결과들은 hAECs에서 지다당-매개 염증에 대하여 miR-548 클러스터의 저하조절이 HMGB1 발현을 촉진하여 세포로부터 HMGB1이 배출되도록 함을 말해준다.In order to evaluate the role of the negative correlation between the miR-548 cluster and HMGB1 in premature chorioamniotic patients, hAECs were treated with lipopolysaccharide (10 or 100 ng/mL) for 24 hours to induce inflammation and then miR-548. The expression levels of clusters and HMGB1 were measured. Compared with the control group, lipopolysaccharide inhibited the expression of the miR-548 cluster in hAECs and increased HMGB1 mRNA (Figs. 5, A and B). Compared to the normal control, a significant increase in HMGB1 levels was also observed in the culture medium of hAECs stimulated with lipopolysaccharide (FIG. 5, C). These results suggest that the reduction-regulation of the miR-548 cluster against lipopolysaccharide-mediated inflammation in hAECs promotes HMGB1 expression, resulting in HMGB1 excretion from cells.

결과 5:Outcome 5: hAECs에서in hAECs MiRMiR -548 클러스터는 -548 cluster 지다당Gidadang -유도 염증을 완화할 수 있다.-Can relieve induction inflammation.

지다당-유도 HMGB1 발현 및 배출에 대한 miR-548 클러스터의 효과를 확인하기 위하여, hAECs를 miR-548aa 모조물 (mimic), miR-548ai 모조물, miR-548a-3p 모조물, miR-548x-5p 모조물 또는 대조군 모조물로 트랜스펙션하였다. 지다당을 처리하고, 대조군 모조물로 트랜스펙션한 hAECs에서 HMGB1 mRNA 및 단백질 발현은 변화가 없었다. 반면, 지다당을 처리하고 miR-548 클러스터 모조물로 트랜스펙션한 세포에서는 miR-548 과발현이 HMGB1 유도를 저하시켰다 (도 6, A). 나아가, 대조군 모조물 처리 세포와 비교하여 miR-548 모조물로 트랜스펙션한 hAECs 세포의 배양 배지에서는 HMGB1 수준이 감소하였다 (도 6, B). 이러한 결과들은 염증 자극에 노출된 hAECs 세포에서 miR-548 모조물이 HMGB1 상향조절을 억제하고, 또한 이후 hAECs에서 HMGB1의 배출을 억제함을 말해준다. 이뿐만 아니라, 대조군 모조물 처리 세포와 비교하여 miR-548 클러스터 모조물로 트랜스펙션한 배양 배지에서는 염증 사이토카인 (IL-1ß 및 IL-6)과 케모카인 (IL-8)의 분비가 현저히 감소하였다. 이 결과들은 hAECs에서 miR-548 클러스터의 과발현이 염증 반응을 억제할 수 있음을 나타낸다.To confirm the effect of the miR-548 cluster on lipopolysaccharide-induced HMGB1 expression and excretion, hAECs were incorporated into the miR-548aa mimic, miR-548ai mimic, miR-548a-3p mimic, miR-548x- Transfected with 5p replica or control replica. There was no change in HMGB1 mRNA and protein expression in hAECs treated with lipopolysaccharide and transfected with a control replica. On the other hand, in cells treated with lipopolysaccharide and transfected with miR-548 cluster replica, miR-548 overexpression decreased HMGB1 induction (Fig. 6, A). Furthermore, HMGB1 levels were decreased in the culture medium of hAECs cells transfected with miR-548 replicas compared to control replica-treated cells (FIG. 6, B). These results suggest that the miR-548 replica inhibits HMGB1 upregulation in hAECs cells exposed to inflammatory stimuli, and later inhibits HMGB1 excretion in hAECs. In addition, the secretion of inflammatory cytokines (IL-1ß and IL-6) and chemokines (IL-8) was significantly reduced in the culture medium transfected with the miR-548 cluster replica compared to the control replica-treated cells. I did. These results indicate that overexpression of the miR-548 cluster in hAECs can inhibit the inflammatory response.

표 1에 개시된 miR-548은 성숙한 miRNA 서열이다. 표 5에는 miR-548의 pre-miRNA 서열과 성숙한 miRNA 서열을 나타내었다. 본 발명에서는 양막 내 감염 및/또는 조산의 예방 또는 치료 용도로 pre-miR-548 서열 또는 성숙한 miRNA 서열을 모두 사용할 수 있다. 표 5의 성숙한 miR-548 서열은 위로부터 차례로 서열번호 5, 6, 7, 8번이며, 표 5의 pre-miR-548 서열은 위로부터 각각 서열번호 9, 10, 11, 12, 13번이다. 또한, 표 3에 개시된 miR 모조물은 각각 위로부터 서열번호 14 내지 23번이며, 표 3의 아래쪽 miR 억제제는 각각 위로부터 서열번호 24 내지 28번이다. 표 2의 프라이머 서열은 miR-548 서열 (서열번호 5 내지 8)과 같고, 다만 서열번호 5 내지 8에서 U로 표시된 것이 표 2에서는 T로 표시되었다는 점만 차이가 있음을 밝혀둔다.The miR-548 disclosed in Table 1 is a mature miRNA sequence. Table 5 shows the pre-miRNA sequence and mature miRNA sequence of miR-548. In the present invention, both the pre-miR-548 sequence or the mature miRNA sequence may be used for the purpose of preventing or treating infection and/or premature birth in the amnion. The mature miR-548 sequence in Table 5 is SEQ ID NOs: 5, 6, 7, 8 in order from the top, and the pre-miR-548 sequence in Table 5 is SEQ ID NOs: 9, 10, 11, 12, and 13, respectively, from the top. . In addition, the miR replicas disclosed in Table 3 are SEQ ID NOs: 14 to 23 from the top, respectively, and the lower miR inhibitors of Table 3 are SEQ ID NOs: 24 to 28 from the top, respectively. It should be noted that the primer sequence in Table 2 is the same as the miR-548 sequence (SEQ ID NOs: 5 to 8), except that what is denoted by U in SEQ ID NOs: 5 to 8 is denoted by T in Table 2.

Figure 112019058203013-pat00001
Figure 112019058203013-pat00001

DesignationDesignation Sequence (5'→3')Sequence (5'→3') miR-548aamiR-548aa AAAAACCACAATTACTTTTGCACCAAAAAACCACAATTACTTTTGCACCA miR-548ai miR-548ai AAAGGTAATTGCAGTTTTTCCCAAAGGTAATTGCAGTTTTTCCC miR-548a-3pmiR-548a-3p CAAAACTGGCAATTACTTTTGCCAAAACTGGCAATTACTTTTGC miR-548x-5p miR-548x-5p TGCAAAAGTAATTGCAGTTTTTGTGCAAAAGTAATTGCAGTTTTTG U6U6 CTCGCTTCGGCAGCACACTCGCTTCGGCAGCACA

Figure 112019058203013-pat00002
Figure 112019058203013-pat00002

융모양막염 환자
(n=34)Chorionic amniotic patients
(n=34) 정상 대조군
(n=14)Normal control
(n=14) p-값p-value 임산부 연령Pregnant woman age 33 [30.8-36.0]33 [30.8-36.0] 36.5 [33.8-38.5]36.5 [33.8-38.5] 0.0050.005 조산 경험Premature birth experience 5 (14.7)5 (14.7) 1 (7.1)1 (7.1) 0.6560.656 양수 천자 시 재태 연령 (주)Gestational age at the time of amniotic puncture (weeks) 21 [19.6-22.4]21 [19.6-22.4] 17.4 [16.7-19.9]17.4 [16.7-19.9] ＜0.001<0.001 출산시 재태 연령 (주)Gestational age at birth (weeks) 29.4 [21.0-38.0]29.4 [21.0-38.0] 38.0 [37.0-38.5]38.0 [37.0-38.5] 0.0020.002 산모 백혈구 수
(세포/ml)Maternal white blood cell count
(Cell/ml) 9,750 [8,375-12,350]9,750 [8,375-12,350] 8,885 [7,395-11,012]8,885 [7,395-11,012] 0.3530.353 양수 분석
HMGB1 (pg/ml)
IL-6 (pg/ml)
포도당 ＜ 20 mg/dl n(%)
백혈구 (세포/㎣)
양성 배양Amniotic fluid analysis
HMGB1 (pg/ml)
IL-6 (pg/ml)
Glucose <20 mg/dl n(%)
Leukocyte (cell/㎣)
Positive culture
563.8 [373.0-800.0]
6,022 [5,199-6,224]
10 (29.4)
40 [7.0-137.5]
2 (5.9)
563.8 [373.0-800.0]
6,022 [5,199-6,224]
10 (29.4)
40 [7.0-137.5]
2 (5.9)
273.0 [47.0-539.3]
588 [465-1,175]
0
7.0 [2.0-9.3]
0
273.0 [47.0-539.3]
588 [465-1,175]
0
7.0 [2.0-9.3]
0
0.004
＜0.001
0.023
0.019
1.000
0.004
<0.001
0.023
0.019
1.000

데이터는 중간값 [사분위 범위] 또는 n (%)로 나타내었다.Data are expressed as median [interquartile range] or n (%).

Figure 112019058203013-pat00003
Figure 112019058203013-pat00003

<110> Industry Academic Cooperation Foundation, Hallym University <120> Preventing or treating composition for preterm birth containing miR-548 <130> HallymU_GHSon_miR-548 <160> 28 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 acatccaaaa tcttgatcag tta 23 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctccttaatg tcacgcacga 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 catgtacgtt gctatccagg c 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ctccttaatg tcacgcacga 20 <210> 5 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> miR-548aa <400> 5 aaaaaccaca auuacuuuug cacca 25 <210> 6 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548ai <400> 6 aaagguaauu gcaguuuuuc cc 22 <210> 7 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548a-3p <400> 7 caaaacuggc aauuacuuuu gc 22 <210> 8 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-548x-5p <400> 8 ugcaaaagua auugcaguuu uug 23 <210> 9 <211> 97 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-548aa-1 <400> 9 cuuuauuagu cuggugcaaa agaaacugug guuuuugcca uuacuuuuac aggcaaaaac 60 cacaauuacu uuugcaccaa ccuaauauaa cuuguuu 97 <210> 10 <211> 97 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-548aa-2 <400> 10 uuuuauuagg uuggugcaaa agaaacugug guuuuugcca uuacuuucaa uggcaaaaac 60 cacaauuacu uuugcaccaa ccuaaaucuu cccucuc 97 <210> 11 <211> 88 <212> RNA <213> Artificial Sequence <220> <223> has-miR-548ai <400> 11 guauuagguu ggugcaaagg uaauugcagu uuuucccauu uaaaauaugg aaaaaaaaau 60 cacaauuacu uuugcaucaa ccuaauaa 88 <210> 12 <211> 97 <212> RNA <213> Artificial Sequence <220> <223> has-miR-548a-3 <400> 12 ccuagaaugu uauuaggucg gugcaaaagu aauugcgagu uuuaccauua cuuucaaugg 60 caaaacuggc aauuacuuuu gcaccaacgu aauacuu 97 <210> 13 <211> 75 <212> RNA <213> Artificial Sequence <220> <223> has-miR-548x <400> 13 agguuagugc aaaaguaauu gcaguuuuug cguuacuuuc aaucguaaaa acugcaauua 60 cuuucacacc aaucu 75 <210> 14 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> control miRNA mimic <400> 14 uucuccgaac gugucacgut t 21 <210> 15 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> control miRNA mimic <400> 15 acgugacacg uucggagaat t 21 <210> 16 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> miR-548aa mimic sense sequence <400> 16 aaaaaccaca auuacuuuug cacca 25 <210> 17 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> miR-548aa mimic antisense sequence <400> 17 gugcaaaagu aauugugguu uuuuu 25 <210> 18 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548ai mimic sense sequence <400> 18 aaagguaauu gcaguuuuuc cc 22 <210> 19 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548ai mimic antisense sequence <400> 19 gaaaaacugc aauuaccuuu uu 22 <210> 20 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548a-3p mimic sense sequence <400> 20 caaaacuggc aauuacuuuu gc 22 <210> 21 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548a-3p mimic antisense sequence <400> 21 aaaaguaauu gcgaguuuua cc 22 <210> 22 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-548x-5p mimic sense sequence <400> 22 ugcaaaagua auugcaguuu uug 23 <210> 23 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> miR-548x-5p mimic antisense sequence <400> 23 uaaaaacugc aauuacuuuc 20 <210> 24 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miR-control inhibitor <400> 24 caguacuuuu guguaguaca a 21 <210> 25 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> miR-548aa inhibitor <400> 25 uggugcaaaa guaauugugg uuuuu 25 <210> 26 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548ai inhibitor <400> 26 gggaaaaacu gcaauuaccu uu 22 <210> 27 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548a-3p inhibitor <400> 27 gcaaaaguaa uugccaguuu ug 22 <210> 28 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-548x-5p inhibitor <400> 28 caaaaacugc aauuacuuuu gca 23 <110> Industry Academic Cooperation Foundation, Hallym University <120> Preventing or treating composition for preterm birth containing miR-548 <130> HallymU_GHSon_miR-548 <160> 28 <170> KoPatentIn 3.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 acatccaaaa tcttgatcag tta 23 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ctccttaatg tcacgcacga 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 catgtacgtt gctatccagg c 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ctccttaatg tcacgcacga 20 <210> 5 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> miR-548aa <400> 5 aaaaaccaca auuacuuuug cacca 25 <210> 6 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548ai <400> 6 aaagguaauu gcaguuuuuc cc 22 <210> 7 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548a-3p <400> 7 caaaacuggc aauuacuuuu gc 22 <210> 8 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-548x-5p <400> 8 ugcaaaagua auugcaguuu uug 23 <210> 9 <211> 97 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-548aa-1 <400> 9 cuuuauuagu cuggugcaaa agaaacugug guuuuugcca uuacuuuuac aggcaaaaac 60 cacaauuacu uuugcaccaa ccuaauauaa cuuguuu 97 <210> 10 <211> 97 <212> RNA <213> Artificial Sequence <220> <223> hsa-mir-548aa-2 <400> 10 uuuuauuagg uuggugcaaa agaaacugug guuuuugcca uuacuuucaa uggcaaaaac 60 cacaauuacu uuugcaccaa ccuaaaucuu cccucuc 97 <210> 11 <211> 88 <212> RNA <213> Artificial Sequence <220> <223> has-miR-548ai <400> 11 guauuagguu ggugcaaagg uaauugcagu uuuucccauu uaaaauaugg aaaaaaaaau 60 cacaauuacu uuugcaucaa ccuaauaa 88 <210> 12 <211> 97 <212> RNA <213> Artificial Sequence <220> <223> has-miR-548a-3 <400> 12 ccuagaaugu uauuaggucg gugcaaaagu aauugcgagu uuuaccauua cuuucaaugg 60 caaaacuggc aauuacuuuu gcaccaacgu aauacuu 97 <210> 13 <211> 75 <212> RNA <213> Artificial Sequence <220> <223> has-miR-548x <400> 13 agguuagugc aaaaguaauu gcaguuuuug cguuacuuuc aaucguaaaa acugcaauua 60 cuuucacacc aaucu 75 <210> 14 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> control miRNA mimic <400> 14 uucuccgaac gugucacgut t 21 <210> 15 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> control miRNA mimic <400> 15 acgugacacg uucggagaat t 21 <210> 16 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> miR-548aa mimic sense sequence <400> 16 aaaaaccaca auuacuuuug cacca 25 <210> 17 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> miR-548aa mimic antisense sequence <400> 17 gugcaaaagu aauugugguu uuuuu 25 <210> 18 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548ai mimic sense sequence <400> 18 aaagguaauu gcaguuuuuc cc 22 <210> 19 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548ai mimic antisense sequence <400> 19 gaaaaacugc aauuaccuuu uu 22 <210> 20 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548a-3p mimic sense sequence <400> 20 caaaacuggc aauuacuuuu gc 22 <210> 21 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548a-3p mimic antisense sequence <400> 21 aaaaguaauu gcgaguuuua cc 22 <210> 22 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-548x-5p mimic sense sequence <400> 22 ugcaaaagua auugcaguuu uug 23 <210> 23 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> miR-548x-5p mimic antisense sequence <400> 23 uaaaaacugc aauuacuuuc 20 <210> 24 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miR-control inhibitor <400> 24 caguacuuuu guguaguaca a 21 <210> 25 <211> 25 <212> RNA <213> Artificial Sequence <220> <223> miR-548aa inhibitor <400> 25 uggugcaaaa guaauugugg uuuuu 25 <210> 26 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548ai inhibitor <400> 26 gggaaaaacu gcaauuaccu uu 22 <210> 27 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-548a-3p inhibitor <400> 27 gcaaaaguaa uugccaguuu ug 22 <210> 28 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-548x-5p inhibitor <400> 28 caaaaacugc aauuacuuuu gca 23

Claims (15)

삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 서열번호 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, 19, 20, 21, 22, 23 중 선택된 1종의 miRNA를 함유하는 양막 내 염증 치료제 조성물.
SEQ ID NO: 5, 6, 7, 8, 9, 10, 11, 12, 13, 16, 17, 18, 19, 20, 21, 22, 23. A composition for treating inflammation in the amnion containing one miRNA selected from.
 청구항 8에 있어서,
상기 miRNA는 HMGB1 (high mobility group box 1 protein) 3' 비번역 부위에 결합하는 것을 특징으로 하는 양막 내 염증 치료제 조성물.
The method of claim 8,
The miRNA is a composition for treating inflammation in the amniotic membrane, characterized in that it binds to the 3′ untranslated region of HMGB1 (high mobility group box 1 protein).
 청구항 8에 있어서,
상기 조성물에는 트랜스펙션 제제가 더 포함됨을 특징으로 하는 양막 내 염증 치료제 조성물.
The method of claim 8,
The composition for treating inflammation in the amniotic membrane, characterized in that the transfection agent is further included.
 청구항 8에 있어서,
상기 양막 내 염증은 융모양막염임을 특징으로 하는 양막 내 염증 치료제 조성물.
The method of claim 8,
Inflammation treatment composition in the amniotic membrane, characterized in that the inflammation in the amniotic membrane is chorioamnionitis.
 삭제delete 삭제delete 삭제delete 삭제delete
KR1020190067159A 2019-06-07 2019-06-07 Preventing or treating composition for preterm birth containing miR-548 KR102184911B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190067159A KR102184911B1 (en) 2019-06-07 2019-06-07 Preventing or treating composition for preterm birth containing miR-548

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190067159A KR102184911B1 (en) 2019-06-07 2019-06-07 Preventing or treating composition for preterm birth containing miR-548

Publications (1)

Publication Number Publication Date
KR102184911B1 true KR102184911B1 (en) 2020-12-01

Family

ID=73790715

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190067159A KR102184911B1 (en) 2019-06-07 2019-06-07 Preventing or treating composition for preterm birth containing miR-548

Country Status (1)

Country Link
KR (1) KR102184911B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020039458A (en) * 2000-11-21 2002-05-27 윤보현 Diagnostic agents for detecting premature birth, fetal infection and fetal damage and diagnostic kit containing the same
JP2013188212A (en) * 2007-07-25 2013-09-26 Univ Of Louisville Research Foundation Inc Exosome-associated microrna as diagnostic marker

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020039458A (en) * 2000-11-21 2002-05-27 윤보현 Diagnostic agents for detecting premature birth, fetal infection and fetal damage and diagnostic kit containing the same
JP2013188212A (en) * 2007-07-25 2013-09-26 Univ Of Louisville Research Foundation Inc Exosome-associated microrna as diagnostic marker

Non-Patent Citations (44)

* Cited by examiner, † Cited by third party
Title
Ambros V. Nature 2004;431:350-5
Andersson U et al., Annu Rev Immunol 2011;29:139-62
Baumbusch MA et al., Cytokine 2016;81:82-7
Behnia F et al., Am J Obstet Gynecol 2015;213:359.e1-16
Bianchi ME et al., Immunol Rev 2007;220:35-46
Bianchi ME. J Leukoc Biol 2007;81:1-5
Buhimschi IA et al., Am J Obstet Gynecol 2007;196:181.e1-13
Castiglioni A et al., Cell Tissue Res 2011;343:189-99
Chaiworapongsa T et al., J Matern Fetal Neonatal Med 2008;21:449-61
Chen G et al., J Interferon Cytokine Res 2004;24:329-33
Christiaens I et al., J Reprod Immunol 2008;79:50-7
Diener KR et al., Immunol Cell Biol 2013;91:443-50
Dumitriu IE et al., Trends Immunol 2005;26:381-7
Elovitz MA et al., Am J Obstet Gynecol 2014;210:221.e1-11
Elovitz MA et al., Am J Obstet Gynecol 2015;212:782.e1-5
Filipowicz W et al., Nat Rev Genet 2008;9:102-14
Friel LA et al., J Perinat Med 2007;35:385-93
Gauley J et al., Autoimmunity 2009;42:299-301
Gomez-Lopez N et al., Am J Reprod Immunol 2016;75:3-7
Gray C et al., Sci Rep. 2017;7:815
Harris HE et al., Nat Rev Rheumatol 2012;8:195-202
Kim Y et al., J Biol Chem 2010;285:25957-68
Klune JR et al., Mol Med 2008;14:476-84
Lotze MT et al., Nat Rev Immunol 2005;5:331-42
Menon R et al., Am J Pathol 2014;184:1740-51
Menon R et al., PLoS One 2013;8:e83416
Menon R. Placenta 2016;44:1-5
Motedayyen H et al., BMC Res Notes 2017;10:552
Romero R et al., Am J Obstet Gynecol 1992;166:1382-8
Romero R et al., Am J Reprod Immunol 1992;27:117-23
Romero R et al., Am J Reprod Immunol 2014;72:458-74
Romero R et al., J Matern Fetal Neonatal Med 2011;24:1444-55
Romero R et al., J Matern Fetal Neonatal Med 2012;25:558-67
Romero R et al., Prostaglandins 1989;37:13-22
Romero R et al., Semin Reprod Med 2007;25:21-39
Rovere-Querini P et al., EMBO Rep 2004;5:825-30
Sanders AP et al., Epigenetics 2015;10:221-8
Scaffidi P et al., Nature 2002;418:191-5
Scientific Reports. 2017. Vol.7, Article 815.* *
Shi Y et al., Biomed Pharmacother 2015;75:111-6
Sonkoly E et al., Int Rev Immunol 2009;28:535-61
Vrachnis N et al., Ann N Y Acad Sci 2010;1205:118-22
Ye D et al., Gastroenterology 2011;141:1323-33
Yoon BH et al., Am J Obstet Gynecol 1997;177:19-26

Similar Documents

Publication Publication Date Title
Waldorf et al. Uterine overdistention induces preterm labor mediated by inflammation: observations in pregnant women and nonhuman primates
Ciavattini et al. Uterine fibroids: pathogenesis and interactions with endometrium and endomyometrial junction
Khanjani et al. NF‐κB regulates a cassette of immune/inflammatory genes in human pregnant myometrium at term
Stock et al. Natural antimicrobial production by the amnion
Lim et al. TLR2, TLR3 and TLR5 regulation of pro-inflammatory and pro-labour mediators in human primary myometrial cells
Ding et al. TIFA upregulation after hypoxia–reoxygenation is TLR4-and MyD88-dependent and associated with HMGB1 upregulation and release
Lappas KLF5 regulates infection-and inflammation-induced pro-labour mediators in human myometrium
Chevillard et al. Identification of interleukin-1β regulated genes in uterine smooth muscle cells
Yang et al. Regulation of miR-33b on endometriosis and expression of related factors.
Li et al. Mmu-miR-126a-3p plays a role in murine embryo implantation by regulating Itga11
Munro et al. Histone deacetylase inhibition by trichostatin A mitigates LPS induced TNFα and IL-10 production in human placental explants
Zong et al. Effect of miR-29b on rats with gestational diabetes mellitus by targeting PI3K/Akt signal.
Lappas A20, an essential component of the ubiquitin-editing protein complex, is a negative regulator of inflammation in human myometrium and foetal membranes
Zhang et al. IL-27 promotes decidualization via the STAT3-ESR/PGR regulatory axis
Ye et al. miR-146a-5p enhances embryo survival in unexplained recurrent spontaneous abortion by promoting M2 polarization of decidual macrophages
Xie et al. Daidzein supplementation improved fecundity in sows via modulation of ovarian oxidative stress and inflammation
CN108245678B (en) Method and medicament for preventing or delaying heart aging
KR102184911B1 (en) Preventing or treating composition for preterm birth containing miR-548
US11149315B2 (en) Method for predicting cervical shortening and preterm birth
Lappas Expression and regulation of metallothioneins in myometrium and fetal membranes
Hirayama et al. Localization of TGF-β and TGF-β receptor in bovine term placentome and expression differences between spontaneous and induced parturition
Wang et al. Down-regulation of uterine LIF expression induced by the hormonal level disorder causes embryo implantation loss after mice exposed to carbon disulfide at peri-implantation
Wu et al. Expression of TLR4 and its effect on Treg cells in early pregnancy decidual stromal cells after lipopolysaccharide treating
Lim et al. Novel anti-inflammatory actions of TIPE2 in human primary amnion and myometrial cells
Hung et al. Increased soluble epoxide hydrolase in human gestational tissues from pregnancies complicated by acute chorioamnionitis

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant