KR102178356B1 - Molecular marker for discriminating genotype of turnip or subspecies of Brassica rapa and uses thereof - Google Patents

Abstract

The present invention relates to a molecular marker for discriminating turnip genotypes or subspecies of Brassica rapa, and uses thereof. A primer set of the present invention can accurately discriminate between a heterozygous genotype and a homozygous genotype of turnip, or cabbage and turnip, and thus not only enables pure breeding of Ganghwa turnip, but also effectively prevents the mixed cultivation of cabbage and turnip in farms.

Description

Molecular marker for discriminating genotype of turnip or subspecies of Brassica rapa and uses thereof

The present invention relates to a molecular marker for genotype of turnip or subspecies of Brassica rapa, and a use thereof.

Brassicaceae (Brassicaceae) is a crop belonging to the same family as Arabidopsis taxonomically, also called the cruciferous family or the mustard family. The cabbage family crops are classified according to the shape of each maximized organ. Representatively, the flowering cabbage ( Brassica oleracea var. botrytis ) and broccoli ( B. oleracea var. italica ), kolabi with developed stem tissue ( B. oleracea var. gongylodes ), turnip with developed root organs ( B. rapa subsp. rapa ), twisty leaf tissue Developed Chinese cabbage ( B. rapa subsp. pekinensis ) and bok choy ( B. rapa subsp. chinensis ), cabbage with a single apical bud ( B. oleracea var. capitata ), and bell pepper with various lateral tissues ( B. oleracea var.gemmifera ). Cabbage crops have very high polymorphism between species or subspecies, which can be found in polyploidy, which means the phenomenon that causes the most frequent and rapid chromosomal mass changes in the plant genome. Brassica rapa among the cabbage family crops is a plant species composed of brassica rapa subspecies such as turnip, Chinese cabbage, bok choy, and turnip rapeseed.

Turnip is classified into white, purple, and red depending on the color of the root, and most of the purple turnips are grown and distributed. Unlike ordinary radish, it is also called fruit radish because it has a sweet taste like fruit, and the texture is similar to melon. Turnip is one of the effective food ingredients for cancer prevention as it contains a large amount of anticancer substances such as glucosinolate, tryptophan, and lysine. In addition, minerals such as calcium, potassium, phosphorus, and iron and vitamins such as vitamin C, B6, pantothenic acid, and folic acid It contains a large amount of this, and has a lot of dietary fiber, which is effective in relieving constipation. Originally, turnips were sown in spring and autumn and harvested in summer and early winter, but now they can be cultivated annually through cultivar improvement, and about 80 to 90% of turnips are produced in Ganghwa Island, the representative production area of turnips. However, the color, shape, and size of the roots are not uniform because there are no stabilized varieties of turnips cultivated in Ganghwa-do and the farmhouses are self-cultivated and maintain the system. Looking at the results of the next-generation sequencing analysis of Ganghwa Turnip, it can be seen that heterozygous alleles are distributed throughout the genome, indicating that the non-uniformity of Ganghwa Turnip appears. For this reason, it is necessary to select turnip individuals with homozygous genotype and develop turnip varieties with uniform characteristics through pure breeding, but since turnip is one of the plants with high heterozygous, there is a high probability of individuals with various phenotypes. There is a need to distinguish between heterozygous genotypes and homozygous genotype turnips before starting cultivation.

In addition, chinese cabbage is one of the four vegetables used with radish, red pepper, and garlic, and is used for various purposes such as soup, salad, radish, and stir-fried in addition to kimchi. In general, it is classified into spring cabbage, summer cabbage, autumn cabbage, and winter cabbage according to the growing season, but about 7 varieties according to not only the growing season, but also the growing period, region, and shape of a colony (the shape of the leaves overlapping in several layers). It is distributed in Korea. Chinese cabbage has a very high water content of about 95%, which helps smooth diuresis, and has a low calorie content and a high content of dietary fiber, which promotes bowel activity and is effective in preventing constipation and colon cancer. In addition, as it is rich in minerals such as calcium, potassium and phosphorus and vitamin C, it is effective in preventing and treating colds. Especially, the green leaves of cabbage contain a lot of beta-carotene, a precursor of vitamin A, which helps strengthen immunity.

Turnip is a radish ( Raphanus raphanistrum ), but with a different genus, and actually has a gene very similar to that of Chinese cabbage. Conventionally, morphological and physicochemical methods have been used to identify the species or cultivar of organisms, but cabbage family crops such as turnips and cabbages have complicated chromosomal composition, making it difficult to establish classification indicators, so that varieties and species are almost subjectively identified. The situation is losing. Recently, with the rapid development of molecular biology, a nucleic acid fingerprint analysis method and various DNA markers have been developed that enable the study of bio-diversity at the DNA level. Through this, it is possible to perform simple and rapid analysis of useful traits, species identification of organisms, breed classification and identification, and relationship analysis of population populations.

InDel (insertion/deletion) markers complement the shortcomings of simple sequence repeat (SSR) markers, which are not sufficient for high-density genetic mapping, while maintaining the advantage of causing polymorphism when amplified by PCR reaction. This is a method of making PCR primers based on the insertion or deletion of nucleotide sequences between varieties through nucleotide sequence analysis. In addition, CAPS (Cleaved amplified polymorphic sequences) are also referred to as restriction amplified polymorphic sequences, and are polymorphic fragments generated by treatment with restriction enzymes for monomorphic PCR products between individuals. Detection is performed for genes that are known to have a difference in base sequence between varieties in advance, and only the corresponding gene is selected from the genome of the species by PCR and amplified. In most markers, there is no difference between the length of the amplified gene and the variety, but because the sequence inside the gene is different, a restriction enzyme that recognizes the difference in the sequence is selected and processed. It is possible to distinguish between varieties with DNA cut by restriction enzymes and those with DNA that cannot be cut, and the difference in length is easily detected by electrophoresis.

On the other hand, Korean Patent No. 1955074 discloses a'SNP marker for no discrimination', and Korean Patent No. 1241482 discloses'a marker for discriminating sarcocytoplasmic male sterility of cabbage family crops and a discrimination method using the same.' The genotype of the turnip of the present invention or the molecular marker for subspecies discrimination of Brassica rapa and the use thereof have not been described.

The present invention was derived from the above requirements, and the present inventors performed next-generation sequencing on the heterozygous genotype strengthened turnip and the double haploid strengthened turnip made therefrom, and then mapped to the cabbage standard genome (Chiifu-401). And aligned to identify single nucleotide polymorphism (SNP) representing heterozygous, and after producing a CAPS (cleaved amplified polymorphic sequences) marker based on the SNP, doubling of the heterozygous genotype and the homozygous genotype As a result of performing PCR on a haploid turnip individual, it was confirmed that the CAPS marker can accurately distinguish between a heterozygous genotype turnip and a homozygous genotype turnip. In addition, by analyzing the genome sequence of the cabbage standard genome and the double haploid turnip individual, a CAPS marker based on SNP and an InDel marker based on the nucleotide sequence showing insertion or deletion were prepared and PCR targeting cabbage and turnip As a result of performing, the SNP-based CAPS marker and InDel marker are Chinese cabbage ( Brassica rapa subsp. pekinensis ) and turnip ( B. rapa subsp. rapa ) By confirming that it can be clearly distinguished, the present invention was completed.

In order to solve the above problems, the present invention provides a heterozygotic genotype and a homozygous genotype comprising at least one primer set selected from the group consisting of 7 primer sets consisting of oligonucleotide primers of SEQ ID NOs: 1 to 14 ( We provide a primer set for distinguishing turnips of homozygotic genotype).

In addition, the present invention is a set of primers for distinguishing turnips of the heterozygous genotype and the homozygous genotype; Reagents for carrying out an amplification reaction; And it provides a heterozygous genotype and a kit for differentiating turnips of the homozygous genotype comprising a restriction enzyme.

In addition, the present invention comprises the steps of separating genomic DNA from a turnip sample; Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using a primer set for distinguishing turnips of the heterozygous genotype and the homozygous genotype; Cutting the product of the amplification step with a restriction enzyme; And separating the cut product by size by electrophoresis of the product of the restriction enzyme cleavage step. It provides a method for distinguishing between a heterozygous genotype and a homozygous genotype turnip comprising.

In addition, the present invention is SEQ ID NO: 15 and 16; SEQ ID NOs: 17 and 18; SEQ ID NOs: 19 and 20; And SEQ ID NO: 21 and 22; Chinese cabbage comprising one or more primer sets selected from the group consisting of the oligonucleotide primer set ( Brassica rapa subsp. pekinensis ) and turnips ( Brassica rapa subsp. rapa ) provides a primer set for identification.

In addition, the present invention provides a kit for distinguishing cabbage and turnip comprising a primer set for distinguishing cabbage from turnip and a reagent for performing an amplification reaction.

In addition, the present invention comprises the steps of separating genomic DNA from a suspected cabbage or turnip sample; Using the isolated genomic DNA as a template, performing an amplification reaction using a primer set for distinguishing between cabbage and turnip, and amplifying a target sequence; And it provides a method of distinguishing the cabbage and turnip comprising the step of detecting the product of the amplification step.

The primer set of the present invention comprises a heterozygous genotype and a homozygous genotype of turnip individuals; Or, since it is possible to accurately distinguish between cabbage and turnip, it can be very useful in breeding turnip individuals with genetically uniform, stable, and excellent traits, and also used for genetic studies of cabbage and turnip with very high genetic similarity among Chinese cabbage family crops. Can be.

1 is a PCR result of a doubling haploid turnip individual (G14, G31, or G36) having a heterozygous genotype using a SNP-based CAPS marker for discriminating a homozygous or heterozygous genotype of turnip to be. H ₂ O; Before restriction enzyme treatment.
Figure 2 is a PCR of Chinese cabbage (CF), double haploid turnip (G14) using SNP-based CAPS marker (A) and InDel marker (B) for distinguishing cabbage from turnip, and hybrid first generation (F ₁ ) of cabbage and turnip It is the result. H ₂ O; Before restriction enzyme treatment.

In order to achieve the object of the present invention, the present invention provides an oligonucleotide primer set of SEQ ID NOs: 1 and 2; An oligonucleotide primer set of SEQ ID NO: 3 and 4; An oligonucleotide primer set of SEQ ID NOs: 5 and 6; An oligonucleotide primer set of SEQ ID NOs: 7 and 8; An oligonucleotide primer set of SEQ ID NOs: 9 and 10; An oligonucleotide primer set of SEQ ID NOs: 11 and 12; And an oligonucleotide primer set of SEQ ID NO: 13 and 14; comprising at least one primer set selected from the group consisting of, a heterozygotic genotype and a homozygous genotype of turnip discrimination primer set is provided. .

The primer set was subjected to a next-generation sequencing analysis on the heterozygous genotype strengthened turnip individual and the dougar haploid turnip (G14) produced therefrom, and then mapped and aligned to the standard Chinese cabbage (Chiifu-401) and aligned. After confirming the SNP of, among the parts showing heterozygous in the SNP information of Ganghwa turnip, the nucleotide sequence of the allele located at the same locus by the same restriction enzyme can be cut off on one side and the other is not cut off, and select It is a set of primers to amplify the non-restriction enzyme after checking whether there is a site where the same restriction enzyme can act within the 2 Kb nucleotide sequence section centered on the site (Table 2). In addition, in the primer set of the present invention, heterozygous and homozygous refer to heterogeneous or homogenous of one nucleotide sequence on a homologous chromosome.

In addition, in the present invention, the turnip of the homozygous genotype refers to a turnip of a doubled haploid system obtained through microspore culture. The'doubling haploid' refers to an individual in which the haploid is multiplied by chromosomes.In plants, colchicine is treated with colchicine on the haploid derived from male spouse obtained by methods such as anther culture and interbreeding. Can be induced to be created. It is genetically homozygous for the whole genome, and genetic fixation is possible at once as the doubling haploid of the F ₁ generation is used in the breeding of auto-reproductive crops, which helps to drastically shorten the breeding period.

The primer set of the present invention preferably comprises at least one primer set selected from the group consisting of the seven primer sets, and includes seven primer sets, that is, an oligonucleotide primer set of SEQ ID NOs: 1 and 2; An oligonucleotide primer set of SEQ ID NO: 3 and 4; An oligonucleotide primer set of SEQ ID NOs: 5 and 6; An oligonucleotide primer set of SEQ ID NOs: 7 and 8; An oligonucleotide primer set of SEQ ID NOs: 9 and 10; An oligonucleotide primer set of SEQ ID NOs: 11 and 12; And oligonucleotide primer sets of SEQ ID NOs: 13 and 14; may include all. When seven primer sets are used at the same time, it is possible to more efficiently distinguish between a heterozygous genotype and a homozygous genotype turnip.

The primers may include oligonucleotides consisting of segments of 16 or more, 17 or more, 18 or more, 19 or more, 20 or more consecutive nucleotides in the sequence of SEQ ID NOs: 1 to 14, depending on the sequence length of each primer. have. For example, the primer of SEQ ID NO: 1 (20 oligonucleotides) may include an oligonucleotide consisting of segments of 16 or more, 17 or more, 18 or more, 19 or more contiguous nucleotides in the sequence of SEQ ID NO: 1. . In addition, the primer may include an addition, deletion or substitution of the nucleotide sequences of SEQ ID NOs: 1 to 14.

In the present invention, "primer" refers to a single-stranded oligonucleotide sequence that is complementary to a nucleic acid strand to be copied, and can serve as an initiating point for the synthesis of a primer extension product. The length and sequence of the primers should allow the synthesis of the extension product to begin. The specific length and sequence of the primers will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the DNA or RNA target required.

In the present specification, the oligonucleotide used as a primer may also comprise a nucleotide analogue, for example, phosphorothioate, alkylphosphorothioate or peptide nucleic acid, or It may include an intercalating agent.

The present invention also includes a set of primers for distinguishing turnips of a heterozygous genotype and a homozygous genotype according to the present invention; Reagents for carrying out an amplification reaction; And it provides a heterozygous genotype and a kit for differentiating turnips of the homozygous genotype comprising a restriction enzyme.

In the kit of the present invention, the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, buffer, etc., and the restriction enzyme according to the present invention may preferably be BamH I or Hind III. In addition, the kit of the present invention may further include a user's guide describing the optimum reaction performance conditions. The guide is a printout explaining how to use the kit, e.g., how to prepare PCR buffer, suggested reaction conditions, etc. The guide contains a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and a description on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

The present invention also,

Separating genomic DNA from the turnip sample;

Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using a primer set for distinguishing turnips of the heterozygous genotype and the homozygous genotype;

Cutting the product of the amplification step with a restriction enzyme; And

It provides a method for distinguishing a heterozygous genotype from a turnip of a homozygous genotype comprising a step of separating the cut product by size by electrophoresis of the product of the restriction enzyme cleavage step.

The method of the present invention includes the step of isolating genomic DNA from a turnip sample. The method of separating genomic DNA from the turnip sample may use a method known in the art, for example, the CTAB method or the Wizard prep kit (Promega). Using the isolated genomic DNA as a template, a target sequence may be amplified by performing an amplification reaction using the primer set according to an embodiment of the present invention. Methods of amplifying target nucleic acids include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, There are strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among them, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to a target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

In the present invention, the term "restriction enzyme" refers to a special enzyme as an endonuclease that identifies a specific nucleotide sequence of DNA and cuts a double chain. In a specific embodiment of the present invention, PCR was performed based on the selected primer set, purified with a PCR purification kit, and then treated within an active temperature using a restriction enzyme in combination with the primer. In the method of distinguishing the turnip genotype of the present invention, the restriction enzyme is EcoR I , Bsu36 I , Hind Ⅲ , Mbo Ⅱ , Pst I , Spe I , BamH I , Mlu I , Alu I , Dra I , Pvu I , Xho I , Bcl I , Taq I , Kpn I or It may be Msp I, preferably BamH I or Hind III, but is not limited thereto.

In the method for distinguishing turnips of a heterozygous genotype and a homozygous genotype according to an embodiment of the present invention, SEQ ID NOs: 1 and 2; SEQ ID NOs: 3 and 4; And the amplified product amplified by the oligonucleotide primer set of SEQ ID NOs: 5 and 6 may be cleaved by treatment with BamH I restriction enzyme, and SEQ ID NOs: 7 and 8; SEQ ID NOs: 9 and 10; SEQ ID NOs: 11 and 12; The amplified products amplified by the oligonucleotide primer sets of SEQ ID NOs: 13 and 14 can be cut by treatment with Hind III restriction enzymes to be differentiated into a heterozygous genotype turnip and a homozygous genotype turnip (see Table 2).

The present invention also provides a set of oligonucleotide primers of SEQ ID NOs: 15 and 16; And the oligonucleotide primer set of SEQ ID NO: 17 and 18; Chinese cabbage comprising one or more primer sets selected from the group consisting of ( Brassica rapa subsp. pekinensis ) and turnips ( Brassica rapa subsp. rapa ) provides a primer set for amplification of the SNP-based CAPS marker to differentiate.

The present invention also provides a set of oligonucleotide primers of SEQ ID NOs: 19 and 20; And it provides a primer set for InDel marker amplification for distinguishing between Chinese cabbage and turnip, comprising at least one primer set selected from the group consisting of: a set of oligonucleotide primers of SEQ ID NOs: 21 and 22.

The primer set for distinguishing Chinese cabbage and turnip of the present invention preferably comprises one or more primer sets selected from the group consisting of the four Chinese cabbage and turnip different primer sets, and four primer sets, that is, SEQ ID NO: 15 And 16; SEQ ID NOs: 17 and 18; SEQ ID NOs: 19 and 20; And it may include all of the oligonucleotide primer set of SEQ ID NO: 21 and 22. Using four sets of primers at the same time makes it possible to distinguish between cabbage and turnip more efficiently.

The primers may include oligonucleotides consisting of segments of 16 or more, 17 or more, 18 or more, 19 or more, and 20 or more consecutive nucleotides in the sequence of SEQ ID NOs: 15 to 22, depending on the sequence length of each primer. have. For example, the primer of SEQ ID NO: 15 (20 oligonucleotides) may include an oligonucleotide consisting of fragments of 16 or more, 17 or more, 18 or more, 19 or more consecutive nucleotides in the sequence of SEQ ID NO: 15. . In addition, the primer may include an addition, deletion or substitution of the nucleotide sequences of SEQ ID NOs: 15 to 22.

The present invention also provides a kit for distinguishing cabbage from turnip, comprising a primer set for distinguishing cabbage from turnip according to the present invention and a reagent for performing an amplification reaction.

In the kit of the present invention, the reagent for performing the amplification reaction may include DNA polymerase, dNTPs, buffer, etc., and the kit according to the present invention may further include a restriction enzyme. The restriction enzyme may be preferably Hind III. In addition, the kit of the present invention may further include a user's guide describing the optimum reaction performance conditions. The guide is a printout explaining how to use the kit, e.g., how to prepare PCR buffer, suggested reaction conditions, etc. The guide contains a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and a description on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

The present invention also provides a method of distinguishing cabbage from turnip using a primer set for distinguishing the cabbage from turnip. Specifically,

Separating genomic DNA from the suspected cabbage or turnip sample;

Amplifying a target sequence by performing an amplification reaction using the isolated genomic DNA as a template and using a primer set for amplifying a SNP-based CAPS marker for distinguishing cabbage from turnip;

Cutting the product of the amplification step with a restriction enzyme; And

It provides a method for distinguishing between cabbage and turnip comprising a step of separating the cut product by size by electrophoresis of the product of the restriction enzyme cleavage step.

In the method for distinguishing between cabbage and turnip according to an embodiment of the present invention, the primer set for amplifying CAPS markers based on the SNP is an oligonucleotide primer set of SEQ ID NOs: 15 and 16 and an oligonucleotide primer set of SEQ ID NOs: 17 and 18. It may be one or more primer sets selected from the group consisting of, but is not limited thereto.

Another method of distinguishing between cabbage and turnip of the present invention,

Separating genomic DNA from the suspected cabbage or turnip sample;

Performing an amplification reaction using the isolated genomic DNA as a template and using a primer set for amplifying an InDel marker for distinguishing cabbage from turnip and amplifying a target sequence; And

It provides a method of discriminating between cabbage and turnip comprising the step of detecting the product of the amplification step.

In the method of distinguishing cabbage from turnip according to an embodiment of the present invention, the primer set for amplifying the InDel marker is a group consisting of an oligonucleotide primer set of SEQ ID NOs: 19 and 20 and an oligonucleotide primer set of SEQ ID NOs: 21 and 22 It may be one or more primer sets selected from, but is not limited thereto.

In the method of distinguishing between cabbage and turnip according to an embodiment of the present invention, the sample of suspected cabbage or turnip may use a seed or seedling (sprout or young seedling) as a sample, and the appearance of seeds or seedlings of cabbage and turnip Since the characteristics are very similar, if it is possible to distinguish between cabbage and turnip before cultivation, there is an effect of saving time and effort required for cultivation.

In the method of the present invention, the restriction enzyme is EcoR I , Bsu36 I , Hind III , Mbo II , Pst I , Spe I , BamH I , Mlu I , Alu I , Dra I , Pvu I , Xho I , Bcl I , Taq I , Kpn I or It may be Msp I, preferably Hind III, but is not limited thereto.

In the method of the present invention, the amplified target sequence may be labeled with a detectable labeling material. In one embodiment, the labeling material may be a material emitting fluorescence, phosphorescence, or radioactivity, but is not limited thereto. Preferably, the labeling material is Cy-5 or Cy-3. When performing PCR by labeling Cy-5 or Cy-3 at the 5'-end of the primer when amplifying the target sequence, the target sequence may be labeled with a detectable fluorescent labeling material. In addition, for labeling using a radioactive material, when a radioactive isotope such as 32P or 35S is added to the PCR reaction solution when performing PCR, the amplification product is synthesized and radioactivity is incorporated into the amplification product, so that the amplification product can be radiolabeled. The SSR primer set used to amplify the target sequence is as described above.

The method of the present invention includes the step of detecting the product of the amplification step. The detection of the amplification product may be performed through capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement, but is not limited thereto. As one of the methods for detecting the amplification product, gel electrophoresis may be performed, and the gel electrophoresis may use acrylamide gel electrophoresis or agarose gel electrophoresis depending on the size of the amplification product. In addition, capillary electrophoresis can be performed. For capillary electrophoresis, for example, an ABi sequencer can be used. In addition, the fluorescence measurement method is to label Cy-5 or Cy-3 at the 5'-end of the primer and perform PCR, and the target sequence is labeled with a detectable fluorescent labeling material, and the thus labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactivity measurement method includes labeling the amplified product by adding a radioactive isotope such as 32P or 35S to the PCR reaction solution when performing PCR, and then labeling the amplified product, and then using a radioactivity measuring instrument such as a Geiger counter or a liquid scintillation counter ( Liquid scintillation counter) can be used to measure radioactivity.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Materials and methods

One. Ganghwa Turnip Genomic analysis and Molecular marker quest

After sowing and harvesting Ganghwa turnip seeds (Dongwon Agricultural Seed Co., Ltd., Korea), leaves of Ganghwa turnip plant (heterozygous genotype turnip) were collected and used. Genomic DNA was extracted from the collected Ganghwa turnip leaf samples by CTAB method.

The genome analysis was performed through filtering and trimming processes using manual python code and trimmomatic program for the read produced by the Illumina sequencing method. The filtered fragments were aligned by mapping to the cabbage standard genome using BWA (Burrows-Wheeler Alignment tool)-MEM, and after searching for SNP and InDel regions using HaplotypeCaller in the Genome Analysis Toolkit (GATK), filtering was performed. . A marker was prepared using the SNP or InDel region obtained through this process.

2. CAPS Marker And InDel Of the marker Verification

PCR reactions were genomic DNA 1 µl (50 ng), forward primer (100 pmol) 1 µl, reverse primer (100 pmol) 1 µl, 200 mM dNTP (Takara) 2 µl, 5 units of Taq polymerase (Takara) 0.2 Μl and distilled water were mixed to make a total of 20 µl. PCR amplification conditions consisted of 30 cycles by combining the initial denaturation step (95° C., 5 minutes) followed by a binding step at 95° C. for 30 seconds, 60° C. for 30 seconds, and an extension step at 72° C. for 1 minute and 30 seconds. In the case of CAPS marker, the amplified PCR product was digested with restriction enzymes BamH I or Hind III. Restriction enzyme reactions were carried out in a total of 30 µl, and the reaction mixture consisted of 6 µl of PCR amplification product, 3 µl of NEB Cutsmart buffer, 1 µl of restriction enzyme (20 units), and 20 µl of purified water.

Example 1. SNP-based CAPS to distinguish between heterozygous genotype and homozygous genotype turnip Marker Verification

Next-generation sequencing was performed on the heterozygous genotype fortified turnip individuals (GH) and dougar haploid turnips (G14) produced therefrom, and then the cabbage standard genome (Chiifu-401, http://brassicadb.org/) And aligned. In particular, among the parts showing heterozygous in the SNP information of Ganghwa Turnip, the nucleotide sequence of the allele located at the same locus by the same restriction enzyme was selected for one that can be cut off and the other is not cut off. After checking whether there is a site in which the same restriction enzyme can act in the 2 Kb nucleotide sequence section, a primer set was prepared to amplify the other site. SNP information and primer set information for each allele are shown in Tables 1 and 2 below.

SNP information for each allele Primer name
chromosome
location
genotype allele 1 allele 2 marker GB1 A01 26,029,895 C T marker GB2 A02 1,629,193 G T marker GB9 A09 13,400,146 A T marker GH3 A03 26,717,794 A C marker GH4 A04 11,461,885 C T marker GH6 A06 15,802,544 C A marker GH9 A09 15,350,026 A T

Primer set information for distinguishing genotype of strengthened turnip Primer name
Sequence information (5'→3') (SEQ ID NO)
Tm(℃)
Expected siza(bp) Restriction
enzyme Genotype 1 Genotype 2 marker GB1 F: CTTAGGACGTGCGAGGAAGG (1) 59.2 696
696
(547/149)

BamH I


R: TCCCACGTTCTCCAATGACG (2) 59.1 marker GB2
F: TCGTTAAGACCAGCCACCAC (3) 59.0 736
736
(449/287) R: CCAAGCATCCTCTATCCGGG (4) 58.7 marker GB9
F: ACAAGGTAGATGGGGCGTTG (5) 59.1 784
784
(489/295) R: AACTCAGCCGTCTCATGTCC (6) 58.8 marker GH3
F: TGCAAAGGCTAGTGGAGAGC (7) 59.1 2,162
2,162
(1,297/865)


Hind III


R: CAGCTACGCGTTTGACGATG (8) 59.1 marker GH4
F: ACCCGCAAACACACAAATGG (9) 58.9 2,156
2,156
(1,272/884) R: TCCAGATGATCGTTGAGCCG (10) 58.9 marker GH6 F: CAGCCGCCATTAGAAAAGGC (11) 58.9 2,091
2,091
(1,297/794) R: TCATCGGCAAGGGTTGACTC (12) 59.1 marker GH9
F: CACATCGGCCAAGAGGAGAG (13) 59.2 2,086
2,086
(1,244/842) R: TAGGGGTGGGCATTTTTCCC (14) 59.0

Genotype 1; When there is no SNP in the restriction enzyme recognition site

Genotype 2; When SNP is present in the restriction enzyme recognition site

After performing PCR using the above-made primer set for strengthened turnip (GH) used as a parent and doubling haploid lines (G14, G31 or G36) made therefrom, CAPS analysis was performed by treatment with restriction enzymes. As a result, in the case of the heterozygous genotype enhanced turnip (GH), it has both a site that does not recognize a restriction enzyme and a site that recognizes it, showing both a single-sized band and two double-bands by cleavage of the restriction enzyme. , The homozygous genotype of the double haploid turnip line showed a single-sized band according to each line, or two bands by digestion of a restriction enzyme. In particular, markers GB2, GB9, GH4, GH6, and GH9 were markers that could confirm that there was a difference in genotype between different douploid lineages, and markers GB1 and GH3 did not show any difference between ploid haploid lineages, but were different from fortified turnips. It was confirmed that the double haploid individuals are markers that can confirm that they are homozygous at the corresponding locus (Fig. 1A).

In addition, as a result of performing nucleotide sequence analysis on the PCR products of the markers GB2 and GH9, it was confirmed that peaks were overlapped at the restriction enzyme site of the strengthened turnip, but only one peak was present at the restriction enzyme site of the doubling haploid lines. (Figure 1B). Through this, it was considered that when the above markers were used, it could be confirmed that the doubling haploid lines G14 and G36 were homozygous at the corresponding locus, so that the genotype of turnip could be successfully identified.

Example 2. SNP-based CAPS to distinguish between cabbage and turnip Marker And InDel Marker Verification

Using the SNP information (Table 3) between the Chinese cabbage standard genome (CF; chiifu-401, http://brassicadb.org/) and the double haploid turnip (G14) analyzed above, a restriction enzyme can act on only one subspecies SNP And the selection process in the same manner as the marker for distinguishing the genotype of the strengthened turnip of Example 1. In addition, by using InDel information between the cabbage standard genome (CF) and the double haploid turnip (G14), a site where the size difference can be confirmed between the PCR products of cabbage and turnip was selected, and a PCR primer set containing this site was prepared. (Table 4).

SNP information for cabbage and turnip Primer name
chromosome
location
genotype cabbage turnip marker SH1 A03 2,562,110 C T marker SH2 A07 9,123,035 G A marker SI1 A06 6,836,543~6,837,678 - 300 bp deletion marker SI2 A07 21,667,591~21,669,221 - 700 bp deletion

Primer set information for distinguishing cabbage from turnip Primer name
Sequence information (5'→3') (SEQ ID NO)
Tm(℃)
Expected siza(bp) Restriction
enzyme Genotype 1 Genotype 2 marker SH1 F: TCCGTCGTCTGAAACACCAG (15) 57.1 1,076
1,076
(636/440) Hind III

R: GCCGTATAGTCCCCGTCAAG (16) 57.4 marker SH2
F: CTCAGAGATCGCAAAAGCGC (17) 56.7 2,239 2,239
(1,333/906) R: GACGGCCCTATCCAGCTTAC (18) 57.5 marker SI1
F: TGGTGCAGAGAATCCGGTTC (19) 57.3 1,135 ~800
(835) (InDel)

R: TCGAGCTTGACGTCACAGTC (20) 57.0 marker SI2
F: CGTCGTCATATCCTAGGCGG (21) 57.1 1,630 ~900
(930) R: TCACTCCGCTGGTTGATGAG (22) 57.0

Restriction after performing PCR using the prepared primer set (SEQ ID NOs: 15 to 18) for the cabbage standard genome (GF), turnip of the doubling haploid line (G14), and the hybrid first generation of cabbage and turnip (F ₁ ) As a result of performing the CAPS assay by treatment with the enzyme, it was confirmed that Chinese cabbage and double haploid turnip G14 can be distinguished according to the band pattern, and the first generation of hybrids showed both CF and G14 band patterns, indicating that they are heterozygous turnip individuals. It was found (Fig. 2A). In addition, as a result of performing PCR using a primer set (SEQ ID NO: 19 to 22) for amplifying the InDel marker, CF and G14 were clearly distinguished due to the difference in band size due to deletion of some nucleotides in the turnip genome sequence. , In the first generation of hybrids, both CF and G14 band patterns appeared, indicating that they were heterozygous genotype turnip individuals (FIG. 2B).

<110> Seoul National University R&DB Foundation <120> Molecular marker for discriminating genotype of turnip or subspecies of Brassica rapa and uses thereof <130> PN19220 <160> 22 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 cttaggacgt gcgaggaagg 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 tcccacgttc tccaatgacg 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 tcgttaagac cagccaccac 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ccaagcatcc tctatccggg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 acaaggtaga tggggcgttg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 aactcagccg tctcatgtcc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 tgcaaaggct agtggagagc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 cagctacgcg tttgacgatg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 acccgcaaac acacaaatgg 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tccagatgat cgttgagccg 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 cagccgccat tagaaaaggc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 tcatcggcaa gggttgactc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 cacatcggcc aagaggagag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 taggggtggg catttttccc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 tccgtcgtct gaaacaccag 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 gccgtatagt ccccgtcaag 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ctcagagatc gcaaaagcgc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gacggcccta tccagcttac 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 tggtgcagag aatccggttc 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 tcgagcttga cgtcacagtc 20 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 cgtcgtcata tcctaggcgg 20 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 tcactccgct ggttgatgag 20

Claims (13)

An oligonucleotide primer set of SEQ ID NO: 1 and 2; An oligonucleotide primer set of SEQ ID NO: 3 and 4; An oligonucleotide primer set of SEQ ID NO: 5 and 6; An oligonucleotide primer set of SEQ ID NOs: 7 and 8; An oligonucleotide primer set of SEQ ID NOs: 9 and 10; An oligonucleotide primer set of SEQ ID NOs: 11 and 12; And an oligonucleotide primer set of SEQ ID NOs: 13 and 14; comprising at least one primer set selected from the group consisting of, a heterozygotic genotype and a homozygous genotype of turnip discrimination primer set,
The oligonucleotide primer sets of SEQ ID NOs: 1 and 2 can detect the C or T base located at the 26,029,895 th of the standard genome (chiifu-401, http://brassicadb.org/) A01 chromosome; The oligonucleotide primer sets of SEQ ID NOs: 3 and 4 can detect the G or T base located at the 1,629,193 position of the A02 chromosome; The oligonucleotide primer sets of SEQ ID NOs: 5 and 6 can detect the A or T base located at the 13,400,146th position of the A09 chromosome; The oligonucleotide primer set of SEQ ID NOs: 7 and 8 can detect base A or C located at 26,717,794 of chromosome A03; The oligonucleotide primer sets of SEQ ID NOs: 9 and 10 can detect the C or T base located at the 11,461,885 position of the A04 chromosome; The oligonucleotide primer sets of SEQ ID NOs: 11 and 12 can detect C or A base located at 15,802,544 of chromosome A06; The set of oligonucleotide primers of SEQ ID NOs: 11 and 12 detects the A or T base located at the 15,350,026 th of the A09 chromosome. The method of claim 1, wherein the oligonucleotide primer set of SEQ ID NO: 1 and 2; An oligonucleotide primer set of SEQ ID NO: 3 and 4; An oligonucleotide primer set of SEQ ID NOs: 5 and 6; An oligonucleotide primer set of SEQ ID NOs: 7 and 8; An oligonucleotide primer set of SEQ ID NOs: 9 and 10; An oligonucleotide primer set of SEQ ID NOs: 11 and 12; And SEQ ID NO: 13 and 14 oligonucleotide primer set; Heterozygous genotype and a homozygous genotype of turnip distinct primer set comprising. The oligonucleotide primer set according to claim 1 or 2; Reagents for carrying out an amplification reaction; As a kit for distinguishing turnips of a heterozygous genotype and a homozygous genotype comprising a restriction enzyme,
When the oligonucleotide primer set is SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4 or SEQ ID NO: 5 and 6, BamH I is included as a restriction enzyme; In the case of SEQ ID NOs: 7 and 8, SEQ ID NOs: 9 and 10, SEQ ID NOs: 11 and 12 or SEQ ID NOs: 13 and 14, including Hind III as a restriction enzyme; kit, characterized in that. delete Separating genomic DNA from the turnip sample;
Amplifying a target sequence using the isolated genomic DNA as a template and performing an amplification reaction using the oligonucleotide primer set according to claim 1 or 2;
Cutting the product of the amplification step with a restriction enzyme; And
The method of distinguishing a heterozygous genotype and a homozygous genotype turnip comprising the step of separating the cut product by size by electrophoresis of the product of the restriction enzyme cleavage step. delete delete delete delete delete delete delete delete

Images