KR102174854B1 - A composition comprising microRNA-1260b inhibitors for inhibiting the proliferation, migration or invasion of breast cancer cell - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for inhibiting proliferation, migration, or invasion of breast cancer cells comprising a microRNA-1260b inhibitor, microRNA-1260b inhibits the expression of CASP 8 of apoptosis to prevent proliferation, migration and invasion of breast cancer cells. It can be used to inhibit and prevent, treat or predict the prognosis of abnormal proliferation, migration or invasion of breast cancer cells.

Description

A composition comprising microRNA-1260b inhibitors for inhibiting the proliferation, migration or invasion of breast cancer cell}

The present invention relates to a pharmaceutical use of microRNA-1260b for inhibiting proliferation, migration or invasion of breast cancer cells by regulating the expression of caspase-8.

Breast cancer is a disease that kills about 522,000 people every year worldwide, and is the second highest mortality rate after lung cancer among all female cancers. Effective management of breast cancer depends on early diagnosis of the disease and on appropriate monitoring and appropriate treatment of prognostic factors such as hormone receptors and metastasis factors. For this reason, there is a need to develop new biomarkers that help early diagnosis, prognosis and treatment targets of breast cancer.

MicroRNA (miRNA or miR) is an 18-25 nucleotide single-stranded RNA molecule that binds to mRNA 3'UTR and inhibits gene expression in eukaryotes. The generation of microRNA is made into a stem-loop precursor microRNA by Drosha (RNase III), migrates to the cytoplasm, and is cleaved by Dicer to make a mature microRNA. Recently, microRNAs are being studied as potential biomarkers that regulate gene expression and regulate cellular mechanisms to form tumors through metastasis and invasion.

TNF-related apoptosis-inducing ligand (TRAIL), a core ligand of the TNF family, selectively induces apoptosis of cancer cells without damaging normal cells. Several cancer cells, including breast cancer, are often resistant to TRAIL, in part by lack of expression of caspase-3, caspase-8, and caspase-10, and regulation of microRNAs targeting these caspases.

[Prior patent literature]

Korean Patent Publication No. 10-2014-0079255

The present invention is conceived by the above necessity, and an object of the present invention is to provide a composition that inhibits the proliferation, migration, and invasion of breast cancer cells.

Another object of the present invention is to provide a composition for preventing, prognosing or treating metastasis due to abnormal proliferation, migration, and invasion of breast cancer cells.

Another object of the present invention is to provide a method for screening a therapeutic agent for abnormal proliferation, migration and invasive diseases of breast cancer cells.

In order to achieve the above object, the present invention provides a pharmaceutical composition for inhibiting the proliferation of breast cancer comprising a microRNA-1260b inhibitor as an active ingredient.

In one embodiment of the present invention, the microRNA-1260b inhibitor is preferably a compound or an oligonucleotide, and the microRNA-1260b inhibitor is more preferably an oligonucleotide described in SEQ ID NO: 1, but is not limited thereto. No.

In another embodiment of the present invention, the microRNA-1260b inhibitor is preferably included in the form of a recombinant plasmid or viral vector expressing it, or included with a non-viral delivery system, but is not limited thereto.

In another embodiment of the present invention, the microRNA-1260b inhibitor is preferably inducing apoptosis of breast cancer cells by inhibiting the inhibition of caspase-8 expression by microRNA-1260b, but is not limited thereto.

In addition, the present invention provides a pharmaceutical composition for inhibiting migration and invasion of breast cancer comprising a microRNA-1260b inhibitor as an active ingredient.

In one embodiment of the present invention, the microRNA-1260b inhibitor is preferably a compound or an oligonucleotide, and the microRNA-1260b inhibitor is more preferably an oligonucleotide described in SEQ ID NO: 1, but is not limited thereto. No.

In another embodiment of the present invention, the microRNA-1260b inhibitor is preferably included in the form of a recombinant plasmid or viral vector expressing it, or included with a non-viral delivery system, but is not limited thereto.

In another embodiment of the present invention, the microRNA-1260b inhibitor is preferably inducing apoptosis of breast cancer cells by inhibiting the inhibition of caspase-8 expression by microRNA-1260b, but is not limited thereto.

In addition, the present invention provides a food composition for improving breast cancer comprising a microRNA-1260b inhibitor as an active ingredient.

In one embodiment of the present invention, the microRNA-1260b inhibitor is preferably a compound or an oligonucleotide, and the microRNA-1260b inhibitor is more preferably an oligonucleotide described in SEQ ID NO: 1, but is not limited thereto. No.

In another embodiment of the present invention, the microRNA-1260b inhibitor is preferably included in the form of a recombinant plasmid or viral vector expressing it, or included with a non-viral delivery system, but is not limited thereto.

In another embodiment of the present invention, the microRNA-1260b inhibitor is preferably inducing apoptosis of breast cancer cells by inhibiting the inhibition of caspase-8 expression by microRNA-1260b, but is not limited thereto.

In addition, the present invention provides a composition for inhibiting caspase-8 expression comprising a microRNA-1260b inhibitor as an active ingredient.

In one embodiment of the present invention, the microRNA-1260b inhibitor is preferably the oligonucleotide of SEQ ID NO: 1, but is not limited thereto.

In addition, the present invention provides a method of inhibiting caspase-8 expression in cells by treating cells with a microRNA-1260b inhibitor in vitro.

In one embodiment of the present invention, the microRNA-1260b inhibitor is preferably the oligonucleotide of SEQ ID NO: 1, but is not limited thereto.

In addition, in the present invention, when the expression of caspase-8 is increased by measuring caspase-8 expression in the breast cancer cells after treating a candidate material in breast cancer cells in vitro, the candidate material is miR- It provides a method of determining that 1260b is suppressed.

In the present invention, the composition may be administered orally or parenterally (intramuscular, subcutaneous, intravenous, suppository, etc.). The appropriate dosage can be appropriately adjusted according to the patient's condition, for example, age and severity of symptoms, but for adults, usually 0.1 to 1,000 per day divided into one or several doses in the range of 0.001 to 500 mg/kg weight. It is administered in an amount of mg, preferably 3 to 1,000 mg per day.

When the composition of the present invention is prepared as an oral preparation, an excipient, and if necessary, a binder, a disintegrant, a lubricant, a coloring agent, a mating agent, etc. are added, and then a tablet, a coated tablet, a granule, or a capsule by a conventional method. Etc.

Carriers, excipients and diluents that may be included in the composition of the present invention include lactose, corn starch, sucrose, glucose, sorbit, crystalline cellulose, mannitol, xylitol, erythritol, maltitol, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate. , Polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oils, and as binders, polyvinyl alcohol, polyvinyl ether, ethylcellulose, methylcellulose, gum arabic , Tragacanth, gelatin, shellac, hydroxypropylcellulose, hydroxypropyl starch, polyvinylpyridone, and the like are used.

In addition, starch, agar, gelatin powder, crystalline cellulose, calcium carbonate, sodium hydrogen carbonate, calcium citrate, dextran, pectin, etc. are used as disintegrants, and magnesium stearate, talc, polyethylene glycol, silica, hydrogenated vegetable oil, etc. are used as lubricants. do.

In addition, as a coloring agent, what is permitted to be added to pharmaceuticals, and as a mating agent, for example, cocoa powder, peppermint brain, aromatic acid, peppermint oil, dragon brain, cinnamon powder, and the like are used. In the case of granules, these tablets do not exclude sugar, gelatin, or other appropriate coating as required.

In addition, when the composition of the present invention is prepared as an injection, if necessary, a pH adjuster, a buffer, a stabilizer, a preservative, and the like are added, and the composition is subcutaneously, intramuscularly, or intravenously injected by a conventional method.

The inhibitor of the present invention is also effective as a pharmaceutically acceptable acid addition salt, such as inorganic salts such as hydrochloric acid, sulfuric acid, and phosphoric acid, and organic salts such as hydroxyl acid, fumaric acid, maleic acid, neunggeum acid, citric acid, tartaric acid, glutamic acid, etc. Can be fully exhibited.

The composition of the present invention can be administered to mammals such as mice, mice, livestock, and humans by various routes. All modes of administration can be expected and can be administered by, for example, oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dura mater or intracerebroventricular injection.

The composition comprising the inhibitor of the present invention can be used as a main ingredient or additive and adjuvant of food in the manufacture of various functional foods and dietary supplements.

In the present specification, the term'functional food' refers to a food in which the functionality of a general food is improved by adding the inhibitor of the present invention to a general food. Functionality can be broadly classified into physical properties and physiological functions. When the inhibitor of the present invention is added to general foods, the physical properties and physiological functions of general foods will be improved, and the present invention comprehensively refers to foods with such improved functions as'functional foods. It is defined as'.

For example, an anticancer functional food can be prepared by using the inhibitor of the present invention to inhibit cancer cell growth. In addition, it will be possible to manufacture functional enhanced foods and cancer prevention beverages using cancer cell growth inhibitory effects.

In addition to the above, the composition of the present invention includes various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and heavy weight agents (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid and its Salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and the like may be contained.

In addition, the inhibitor of the present invention may contain natural fruit juice and flesh for the production of fruit juice beverages and vegetable beverages. These components may be used independently or in combination. The proportion of these additives is not so important, but it is generally selected from 0.01 to 20 parts by weight per 100 parts by weight of the composition of the present invention.

The present invention will be described below.

The present inventors confirmed the effect of proliferation, migration and invasion of breast cancer cells by inhibiting the expression of miR-1260b as a novel molecular target treatment method, and the result of miR-1260b expression was determined by analyzing 102 breast cancer patient tissues. The results were derived.

The present invention can inhibit the proliferation, migration and invasion of breast cancer cells by inhibiting miR-1260b, and can predict the prognosis of breast cancer patients by measuring the expression change of miR-1260b as a biomarker, as well as breast cancer treatment and As a new treatment for prevention, it was confirmed that it can be applied to the development of a new drug that regulates miR-1260b.

As a mature form of miR-1260b, a single-stranded molecule, it may have a stem-loop structure capable of forming a double-stranded portion.

The miR-1260b of the present invention is basically a complete form in which two strands of RNA are paired to form a double strand, that is, a form that is introduced into cells through transfection after directly synthesizing miR-1260b in vitro. Or, it may be in a form modified into a structure having a short hairpin so that it can be used for transfection using a plasmid-based pre-microRNA vector and a PCR-induced miRNA expression cassette.

Inventive miR-1260b used in various embodiments provided herein may be included in a complex form with various nucleic acid delivery systems (viral or non-viral delivery systems) known in the art in order to increase delivery efficiency in vivo.

The present invention inhibits microRNA-1260b to inhibit proliferation, migration, and invasion of breast cancer cells to prevent metastasis, and by measuring the expression change of microRNA-1260b as a prognostic biomarker, it is possible to provide prognostic information for breast cancer patients. In addition, it is applicable to the development of new treatments.

1 is an example of the analysis result of miR-1260b expression pattern in breast cancer cells compared to normal breast cells,
Figure 2 shows the effect of miR-1260b on the proliferation of breast cancer cells (MDA MB-231).(A) shows miR-1260b in MDA MB-231 transfected with miR-1260b inhibitor (80 nM). Expression was measured by real-time PCR and electrophoresis to show the transfection efficiency.(B) is the result of confirming the number of MDA MB-231 viable cells according to the inhibition of miR-1260b expression on a microscope. It shows the change in proliferation of MDA MB-231 according to the inhibition of 1260b expression,
Figure 3 shows the apoptosis change ratio (B) of breast cancer cells (MDA MB-231) according to the inhibition of miR-1260b expression through flow cytometry (PI and Annexin V) analysis (A),
Figure 4 shows the effect of miR-1260b on the migration of breast cancer cells (MDA MB-231), (A) is observed from 0 hours to 24 hours by damage-healing analysis using a microscope. It is a representative image of the cell migration result, and (B) shows the mobility of MDA MB-231 analyzed in the representative field at 24 hours,
Figure 5 shows the effect of miR-1260b on breast cancer cell (MDA MB-231) invasion, (A) is a picture of MDA MB-231 seen from the bottom by infiltrating the chamber and (B) representative field using a microscope It shows the number of migrating cells of MDA MB-231 counted in,
Figure 6 shows the identification results of CASP 8 as a direct target of miR-1260b in breast cancer cells (MDA MB-231), (A) is a schematic showing the miR-1260b binding site of CASP 8 confirmed through the targetScan online analysis program Figure (B) shows the result of measuring CASP 8 gene expression by real-time PCR in MDA MB-231 transfected with a negative control, miR-1260b inhibitor (80 nM), and (C) is negative It shows the results of analyzing the levels of caspase-8 and cleaved caspase-8 proteins using Western Brat in MDA MB-231 transfected with a control or miR-1260b mimic (β-actin used as a control) (D) It is the result of analyzing the correlation between miR-1260b expression and CASP 8 gene expression in breast cancer patient tissue samples, (E) is the CASP 8 3'UTR containing the miR-1260b binding sequence was cloned into a luciferase reporter gene, (F) It shows the result of evaluating the luciferase activity by dual luciferase assay,
7 is an analysis of the prognosis according to the expression of miR-1260b using tissues of breast cancer patients, (A) is the survival rate according to the expression of miR-1260b for a total of 102 breast cancer patients, (B) is stage I-II The survival rate according to the expression of miR-1260b in, (C) shows the survival rate according to the expression of miR-1260b in stage III.

Hereinafter, the present invention will be described in more detail through non-limiting examples. However, the following examples are described with the intention of illustrating the present invention, and the scope of the present invention is not to be construed as being limited by the following examples.

Example 1. In breast cancer cells miR Pharmaceutical uses of -1260b

1) Culture of breast cancer cells

Normal breast cells (MCF-10A) were cultured at 37 °C in MEGM medium supplemented with MEGM Single Quots and cholea toxin (Lonza, Basel, Switzerland). Among breast cancer cells, MDA MB-231 and SKBR-3 are Roswell Park Memorial Institute media (RPMI; Gibco, 100 U/mL penicillin and 100 μL streptomycin solution added and 10% fetal bovine serum (FBS)). Carlsbad, USA) at 37 °C.

For the remaining breast cancer cells MCF-7 and BT-474, Dulbecco's modified Eagle's Medium (DMEM; Gibco, Carlsbad, 10% fetal bovine serum (FBS)) and 100 U/mL penicillin and 100 μL of streptomycin solution were added. USA) at 37 °C.

2) microRNA transfection

A miR-1260b inhibitor, miR-1260b mimic, and a negative control RNA oligomer (negative control) (Ambion, USA) were used at a final concentration of 80 nM. The base sequence of miR-1260b is 5'-AUCCCACCACUGCCACCAU-3'. In RPMI without FBS, breast cancer cells (MDA MB-231) were transfected with miR-1260b inhibitor, miR-1260b mimic, or negative control using O,O'-dimyristyl-N-lysyl glutamate (DMKE). Then, after incubating for 4 hours at 37 °C in a CO 2 incubator, the medium containing 10% FBS was changed and cultured for 24 hours, followed by analysis.

The sequence of the miR-1260b inhibitor is shown in Table 1.

gene Sequence number Base sequence (5'->3')* miR-1260b inhibitor SEQ ID NO: 1 AUGGUGGCAGUGGUGGGAU

Table 1 is the sequence of the miR-1260b inhibitor

3) Cell proliferation assay

MDA MB-231 was cultured in a 96 well plate by repeating three cells at 2x 10 ⁴ cells/well. Cells transfected with the miR-1260b inhibitor or negative control were incubated with 10% FBS RPMI for 24 hours and then measured using the WST assay kit EZ-Cytox (DaeilLab, Seoul, Republic of Korea).

After adding 10 μL of WST solution to each well, it was incubated at 37 °C for 2 hours. The absorbance of the sample was measured with a wavelength of 450 nm using a spectrometer (Tecan, Salzburg, Austria).

3) Apoptosis assay

Annexin V and propidium iodide (PI) staining was performed according to the manufacturer's instructions using Annexin V-FITC Apoptosis Detection Kit 1 (BD Biosciences, Sparks, MD, USA). The cultured cells were treated with Trysin-EDTA, washed twice with cold PBS, and then centrifuged at 600 x g for 5 minutes.

L의 Annexin V-FITC 및 5 μL의 PI를 세포 현탁액에 첨가하였다. 혼합물을 어두운 곳에서 37 °C에서 10분 동안 배양하고 BD FACSCalibur (BD Biosciences, Sparks, MD, USA)로 분석 하였다.Resuspend the cells in 500 μL of binding buffer at a concentration of 5 * 10 ⁵ cells/mL and 5

L of Annexin V-FITC and 5 μL of PI were added to the cell suspension. The mixture was incubated for 10 minutes at 37 °C in the dark and analyzed with BD FACSCalibur (BD Biosciences, Sparks, MD, USA).

4) Real-time-PCR

4-1) Total RNA isolation from tissue samples

3-4 sections of FFPE tissue were taken in a scrolled state, deparaffinization solution (Qiagen, Hilden, Germany) was added to deparaffin, and total RNA was extracted using the protocol of Qiagen RNeasy FFPE kits (Qiagen, Hilden, Germany). .

4-2) cDNA synthesis for amplification of miR-1260b gene

5 μL of extracted RNA and TaqMan microRNA reverse transcription reagent (Applied Biosystem, USA) (100mM dNTPs (0.15 μL), Reverse transcriptase (50 U/μL) (1 μL ), 10x reverse transcription buffer (1.5 μL ), RNase inhibitor (20) U/μL) (0.19 μL), nuclease free water (4.16 μL) and miR-1260b specific RT primer (3 μL)) were synthesized by reacting at 16° C. for 30 minutes, 42° C. for 30 minutes, and 85° C. for 5 minutes.

4-3) Amplification of miR-1260b gene and confirmation of expression level

The composition of the experimental procedure is 10 μL 2x Tunderbird probe qPCR (Toyobo, Osaka, Japan), 1 μL 20 x miR-1260b specific primer, 7.6 μL nuclease-free water, 1.4 μL template cDNA, final volume 20 μL. The PCR reaction can be performed in 40 cycles at 95° C. for 10 minutes, 95° C. for 15 seconds, and 60° C. for 1 minute to check the amount of expression in real time.

Expression of miR-1260b was quantified by measuring C _T , defined as the number of PCR cycles required for the fluorescence to exceed a value much higher than the background fluorescence. The amount of miR-1260b was determined using a comparative C _T method (ΔΔC _T method) in which microRNA relative to a reference gene was measured using CFX Manager Software v1.6 (Bio-Rad, Hercules, CA, USA) (Livak, KJ and TD Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(- Delta Delta C(T)) Method.Methods, 2001. 25 (4): p. 402-8).

In the present invention, ΔΔC _T is

ΔΔC _T = 2^-[patient group (miR-1260b-reference) C _T -normal group (miR-1260b-reference) C _T ].

Here, the C _T value means the number of cycles at which amplification starts to increase significantly during the PCR process.

miRNA ID Primer/probe Sequence miR-1260b RT primer SEQ ID NO: 2 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATGGTG Forward primer SEQ ID NO: 3 CAGATCCCACCACTGC Reverse primer SEQ ID NO: 4 GTGCAGGGTCCGAGGT Probe SEQ ID NO: 5 (6-FAM) GGATACGACATGGTGG (MGB)

Table 2 shows miR-1260b primer and probe information used in the present invention

4-4) cDNA synthesis for CASP8 gene

Extracted RNA and cDNA synthesis reagent (0.25㎍ of random hexamer (Invitrogen, Carlsbad, California, USA), dNTP Mixture (2.5mM each), DEPC-treated water, 5 * buffer (Invitrogen, Carlsbad, California, USA), 0.1 Synthesis by reacting M DTT (Invitrogen, Carlsbad, California, USA) and 200 U reverse transcriptase (MMLV-RT, Invitrogen, Carlsbad, California, USA) at 25°C for 10 minutes, 37°C for 50 minutes, and 70°C for 15 minutes I did.

4-5) CASP8 gene amplification and expression level confirmation

Real-time polymerase chain reaction was performed to detect the CASP8 gene of a breast cancer patient from cDNA of the patient prepared in Example 4-1) and Example 4-4).

The composition of the experimental procedure is 10 μL 2 x Tunderbird probe qPCR mix (Toyobo, Osaka, Japan), 3 μL primer and TaqMan probe mixture, 2 μL template cDNA and distilled water (DW) at a final volume of 20 μL per sample.

The PCR reaction is performed at 94 ℃ for 3 minutes in the pre-denaturation process, 94 ℃ for 3 seconds in the denaturation process, and 40 cycles in the annealing and elongation process at 55 ℃ for 30 seconds, so that the amount of expression can be confirmed in real time. -126bp.

The CASP8 primer and probe (synthesized by requesting Bioneer Korea) sequences used in the present invention are shown in Table 3.

gene Oligomer Sequence number Base sequence (5'->3')* Remark CASP 8 CASP8-F SEQ ID NO: 6 GCTAAATTCCACACTACC casp8 amplification CASP8-R SEQ ID NO: 7 CTTGGGTTCAAGCAATC

5) Cell migration analysis

Cell migration analysis was performed using SPLScar TM (SPL, Pocheon, Republic of Korea) according to the manufacturer's instructions. Cells transfected with miR-1260b inhibitor, negative control, or blank 5 * 10 ⁵ were cultured in a 6 well plate at 37° C. for 24 hours. Then, the confluent monolayer cells were scraped in a straight line by 500 μm SPLScar ^™ , and the cells were allowed to close the wound.

Wound healing images were captured using a microscope up to 0, 12, and 24 hours. The percentage of the area with migrated cells compared to the initial wound was defined as the wound closure.

6) Cell invasion assay

Cell invasion analysis was performed according to the manufacturer's poem using SPLInsert ^TM Hanging (SPL, Pocheon, Republic of Korea). The chamber was inserted into a 24-well plate and cells transfected with miR-1260b inhibitor or negative control, 5 * 10 ⁴ were cultured in the upper chamber. A medium containing 0.1% FBS was inserted into the upper chamber and a medium containing 20% FBS was attached to the lower well. The cells were cultured at 37° C. and 5% CO ₂ for 24 hours. After incubation, the membrane of the chamber was trimmed, stained with 0.1% crystal violet, and observed using an optical microscope (Olympus, Tokyo, Japan). 3 randomly selected from each membrane, and counted the number of invading cells.

7) Luciferase analysis

Constructed a plasmid using the pmirGLO double luciferase miRNA target expression vector (Promega, San Luis Obsipo, CA) for the binding site in 3'UTR from the potential target gene ( CASP 8) based on the information of TargetScan 7.2 through the request of Bioneer Korea I did. CASP8 wild type (WT): 5'-GTTTAAACATAATCCCAGCACTTTGGGAGGTTGAGGTGG GAGGATTGCTTGAACCCAAGAGGTCTAGA-3',

CASP8 mutation type (MT): 5'-GTTTAAACATAATCCCAGCACTTTGGGAGGTTGATTTT TTTTGGATTGCTTGAACCCAAGAGGTCTAGA-3'.

For the reported gene analysis, MDA MB-231 was transfected with a reporter vector ( CASP 8 WT or CASP 8 MT) with miR-1260b mimic and negative control. Luciferase and Rneilla signals were measured 24 hours after transfection using a dual luciferase system (Promega).

8) Histological analysis

8-1) Breast cancer patient tissue sample

8-2) Immunohistochemistry (IHC)

The paraffin block was cut to a thickness of 4 μm, attached to the slide, dried sufficiently, and immunohistochemical staining was performed using a BenchMark ST (Ventana medical system, USA) automatic immunostaining device. After slide staining, when the degree of staining of ER and PR proteins on the cell membrane of cancer cells was more than 10%, ER and PR were diagnosed as positive. In the case of HER2 protein, it is determined by dividing it into 4 grades, that is, 0, 1+, 2+, and 3+ depending on the degree of staining. Among them, 0 and 1+ were diagnosed as HER2 negative, 3+ were diagnosed as positive, and 2+ were diagnosed by performing positive or FISH according to the patient's clinical information.

8-3) Fluorescence in situ hybridization (FISH)

Targeting patients with 2+ in the HER2 IHC method, a tissue block fixed with paraffin is cut to a thickness of 4 μm using a microtome, attached to a slide, and then subjected to deparaffinization and hydration process, which is a commercialized HER2 DNA probe. The experiment was conducted according to the manufacturer's instructions using a kit (Vysis Inc, Downers Grove, IL, USA). HER2 expression was read as positive when the Amplification Index was 2.2 or higher according to the gene expression level.

9) Statistical analysis

Statistical analysis was performed using GraphPad Prism software version 6.0 (GraphPad, La Jolla, CA, USA) and SPSS Statistics software version 21.0 (IBM, Armonk, YN, USA). Statistical significance was determined as non-parametric statistics, respectively, using Mann-Whitney test and Kruskal-Wallis test.

Cases were divided into two groups by median miR-1260b expression level. The association between miR-1260b expression and various clinical pathological parameters was analyzed by Fisher's exact test. Survival was estimated by the Kaplan-Meier method and evaluated by the log-rank test. Multivariate analysis of prognostic value was evaluated using the Cox proportional hazard model. P values less than 0.05 were considered statistically significant.

The results of the above examples are described below.

The expression pattern of miR-1260b in breast cancer cell lines was measured by RT-qPCR to confirm the change in the expression of miR-1260b in breast cancer. To measure gene expression, microRNA gene expression was calculated using the target delta C _T (ΔC _T ) normalized to RNU6B.

As a result, it was confirmed that the expression level of miR-1260b in breast cancer cell lines (MDA MB-231, SKBR-3, BT-474 and MCF-7) was statistically higher than that of normal breast cell line (MCF-10A) ( P <0.01) [Fig. 1].

To investigate the effect of miR-1260 on the cell proliferation ability of breast cancer cells, MDA MB-231 cells were transfected with a negative control, blank, or miR-1260b inhibitor for 24 hours. Then, the expression level of miR-1260b was investigated by RT-qPCR.

It was confirmed that the expression of miR-1260b in the cells transfected with the miR-1260b inhibitor was reduced compared to the cells transfected with the negative control and blank ( p <0.01) [Fig. 2A].

In addition, a decrease in viable cells in the group inhibiting miR-1260b expression was confirmed on a microscope [Fig. 2B].

Next, cell proliferation was measured by WST analysis. The proliferation ability of MDA MB-231 cells was decreased in the miR-1260b expression inhibitory group compared to the negative control and blank ( p <0.0001) [Fig. 2C].

The cell viability of MDA MB-231 transfected with the miR-1260b inhibitor decreased to 71% compared to the negative control (100%) or blank (100%).

When miR-1260 expression was suppressed, apoptosis of cells was measured to determine the reason for the decrease in cell proliferation. To investigate cell death, cells 1 x 10 ⁵ were stained with Annexin V-FITC and PI and analyzed.

As a result, it was confirmed that inhibition of miR-1260b expression induces cell death in MDA MB-231 [Fig. 3A].

The rate of apoptosis of cells was increased by about 10% in the miR-1260b expression suppression group compared to the negative control and blank [Fig. 3B].

A wound healing assay was performed to investigate whether a decrease in miR-1260b expression affects cell migration ability. MDA MB-231 was transfected with miR-1260b inhibitor, negative control and blank. After transfection (24 hours), the cells were scraped to a width of 500 μm.

Wound healing analysis showed that MDA MB-231 transfected with miR-1260b inhibitor showed lower mobility than MDA MB-231 transfected with negative control or blank [Fig. 4A].

The scratch area of MDA MB-231 transfected with miR-1260b inhibitor was filled with 52.1%, and the scratch area of MDA MB-231 transfected with negative control and blank was completely filled at 24 hours ( p <0.0001) [Fig. 4B].

Transwell invasion assay was performed to determine whether the decrease in miR-1260b expression affects the cell invasion capacity. MDA MB-231 was transfected with miR-1260b inhibitor, negative control and blank.

The transfected cells were resuspended in a culture medium containing 0.1% FBS and cultured in the upper chamber of a transwell. The lower chamber was filled with culture medium containing 20% FBS and incubated for an additional 48 hours. Cells infiltrated into the chamber membrane were fixed and stained with crystal violet. The invasion capacity of the cells transfected with the miR-1260b inhibitor was much lower than that of the cells treated with the negative control and blank [Figs. 5A and B].

In order to confirm the identification of CASP 8 as a direct target of miR-1260b in MDA MB-231, FIG. 6A is a schematic diagram showing the miR-1260b binding site of CASP 8 identified through the targetScan7.2 online analysis program.

As a result of measuring CASP 8 gene expression in real-time PCR in MDA MB-2321 transfected with negative control and miR-1260b inhibitor (80 nM), statistically compared to the negative control in the miR-1260b expression suppressor group It was confirmed that the CASP 8 gene was significantly increased [Fig. 6B].

As a result of analyzing the correlation between miR-1260b expression and CASP8 gene expression in breast cancer patient tissue samples, an inverse correlation was confirmed (r = -0.6137, p <0.0001). Figure 6D is a schematic diagram showing the structure completed by cloning CASP 8 3'UTR containing the miR-1260b binding sequence into a luciferase reporter gene, MDA MB-231 as a reporter vector ( CASP 8 WT or CASP 8 MT) Was transfected with miR-1260b mimic and negative control. Luciferase and Rneilla signals were measured 24 hours after transfection using a dual luciferase system (Promega). As a result, it was confirmed that the luciferase activity in the miR-1260b mimic was statistically significantly reduced in CASP8 WT compared to the negative control ( p <0.01) [Fig. 6E].

In order to find out the relationship between the expression level of miR-1260b in breast cancer tissues and its clinical pathological characteristics, miR-1260b expression was measured by RT-qPCR using 102 breast cancer tissues. The characteristics of patients recruited from Shinchon Severance Hospital are summarized in Table 4.

The age of 102 breast cancer patients was 30-84 years (mean±SD, 49.5±11.3 years, 95% CI, 47.3-51.8). Among 102 breast cancer patients, 70 patients (63.6%) with stage I-II, 31 patients (30.4%) with stage III-IV, and one patient with unknown stage (1.0%). Histological grades were I-III grade 65 (63.7%), III grade 35 (34.3%) and unknown grade 2 (2.0%). The HER2 positive rate, ER positive rate, and PR positive rate were 28.4%, 69.9%, and 41.1%, respectively (Table 4).

Characteristics Breast cancer patients n = 102 % Age (years) <50 54 52.9 ≥ 50 48 47.1 TNM Dange Ⅰ-Ⅱ 70 68.6 Ⅲ-Ⅳ 31 30.4 Unknown One 1.0 Histological grade Ⅰ-Ⅱ 65 63.7 Ⅲ 35 34.3 Unknown 2 2.0 Tumor size (cm) <2 56 54.9 ≥ 2 46 45.1 Unknown 0 0.0 Lymph node infiltration No 55 53.9 Yes 42 44.1 Unknown 2 2.0 HER2 ^a Negative 73 71.6 Positive 29 28.4 Unknown 0 0.0 ER ^b Negative 31 30.4 Positive 71 69.9 Unknown 0 0.0 PR ^c Negative 60 58.8 Positive 42 41.2 Unknown 0 0.0 miR-1260b expression Low 50 49.0 High 52 51.0 Unknown 0 0.0

Table 4 shows the results of clinical information of 102 breast cancer patients

In breast cancer tissues, miR-1260b expression was reduced according to the median to determine the correlation between miR-1260b and patient clinical information (age, TNM stage, histological grade, tumor size, lymph node invasion, HER2, ER, and PR). After dividing into the expression group and the expression group, the clinical association was analyzed. In the expression of miR-1260b, a statistically significant correlation with TNM stage, lymph node invasion, tumor size, HER2, and PR was confirmed (Table 5).

variable n miR-1260b expression p value Low, n (%) High, n (%) Age (years) 0.172 <50 54 30 (55.6) 24 (44.4) ≥ 50 48 20 (41.7) 28 (58.3) TNM stage <0.001 Ⅰ/Ⅱ 70 45 (64.3) 25 (35.7) Ⅲ/Ⅳ 31 5 (16.1) 26 (83.9) Histological grade 0.092 Well/moderate 65 37 (56.9) 28 (43.1) poor 35 13 (37.1) 22 (62.9) Tumor size <0.001 <2 cm 56 37 (66.1) 19 (39.9) ≥ 2 cm 46 13 (28.3) 33 (71.7) Lymph node infiltration <0.05 No 55 35 (63.6) 20 (36.4) Yes 45 15 (33.3) 30 (66.7) HER2 <0.01 Negative 73 42 (57.5) 31 (42.5) Positive 29 8 (27.6) 21 (72.4) ER 0.086 Negative 31 11 (35.5) 20 (64.5) Positive 71 39 (54.9) 32 (45.1) PR <0.05 Negative 60 24 (40.0) 36 (60.0) Positive 42 26 (61.9) 16 (38.1)

Table 5 is an analysis of the correlation between miR-1260b expression and patient clinical information.

The prognosis was analyzed through survival analysis. The association between miR-1260b expression and overall survival was investigated by Kaplan-Meier analysis and log-rank. The results showed that the high expression of miR-1260b had a significant correlation with the decrease in overall survival rate ( p <0.0001) [Fig. 7].

Analysis of the multivariate Cox proportional hazard model of miR-1260b expression shows that high expression of miR-1260b is an independent prognostic factor for overall survival (Hazard ratio = 5.112, p <0.05) (Table 6).

characteristic Univariate analysis Multivariate analysis HR 95% CI p value HR 95% CI p value Age (years) <50 vs ≥ 50 0.804 0.279-2.318 0.687 TNM stage ⅠⅡ vs ⅢⅣ 9.020 3.009-27.039 <0.001 6.053 1.935-18.932 <0.01 Histological grade Well/ moderate vs Poor 0.848 0.891-2.893 0.848 Tumor size (cm) <2 vs ≥ 2 5.622 1.567-20.169 <0.01 5.723 1.593-20.557 <0.01 Lymph node infiltration No vs Yes 4.281 1.342-13.658 <0.05 3.599 1.067-12.134 <0.05 HER2 Negative vs Positive 4.714 1.635-13.598 <0.05 3.766 1.230-11.528 <0.01 ER Negative vs Positive 0.350 0.123-0.998 <0.05 0.315 0.104-0.955 <0.05 PR Negative vs Positive 0.449 0.141-1.431 0.176 miR-1260b expression Low vs High 8.523 1.906-38.109 <0.01 5.112 1.080-24.197 <0.05

Table 6 shows miR-1260b expression and risk analysis of clinical factors in patients

Table 6 shows miR-1260b expression and risk analysis of patient's clinical factors

<110> YONSEI UNIVERSITY WONJU INDUSTRY ACADEMIC COOPERATION FOUNDATION <120> A composition comprising microRNA-1260b inhibitors for inhibiting the proliferation, migration or invasion of breast cancer cell <130> P19-0019HS <160> 7 <170> KopatentIn 2.0 <210> 1 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> mIR-1260b inhibitor <400> 1 augguggcag uggugggau 19 <210> 2 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacatggtg 50 <210> 3 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 cagatcccac cactgc 16 <210> 4 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gtgcagggtc cgaggt 16 <210> 5 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 5 ggatacgaca tggtgg 16 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gctaaattcc acactacc 18 <210> 7 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 cttgggttca agcaatc 17

Claims (17)

delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete When the expression of caspase-8 is increased by measuring caspase-8 expression in the breast cancer cells after treatment of a candidate substance in breast cancer cells in vitro, the candidate substance inhibits miR-1260b. How to judge that.

Images