KR102174017B1 - Composition for predicting color of full ripe fruit of Capsicum genetic resource and uses thereof - Google Patents

Abstract

The present invention relates to: a composition for predicting a color of full ripe fruit of Capsicum sp. genetic resources, comprising, as active ingredients, an oligonucleotide capable of detecting a mutation of a phytoene synthase 1 (PSY1) gene derived from pepper consisting of the nucleotide sequence of SEQ ID NO: 1 and an oligonucleotide capable of detecting a mutation of a capsanthin-capsorubin synthase (CCS) gene derived from pepper consisting of the nucleotide sequence of SEQ ID NO: 2; and a use thereof.

Description

Composition for predicting color of full ripe fruit of Capsicum genetic resource and uses thereof}

The present invention relates to a composition for predicting ripeness and color of genetic resources in capsicum genus, and to a use thereof.

The ripening and color of various peppers is due to the accumulation of carotenoids that proceed with the breakdown of chlorophyll. Carotenoids belong to a subgroup of isoprenoids, typical of a polyene skeleton composed of 40 carbons. Carotenoids play a variety of essential roles in plants, including photosynthesis and light protection. It also provides precursors for the synthesis of plant hormones, including ascorbic acid (ABA) and strigolactone. On the other hand, the carotenoid biosynthetic pathway and the enzymes related thereto are particularly well elucidated in eggplant crops. Carotenoid biosynthesis begins when phytoene is synthesized by PSY (phytoene synthase). Subsequently, through continuous unsaturation and isomerization reactions, phytoene becomes lycopene, a major component of ripe tomato fruit. The red color of tomatoes is due to the accumulation of lycopene, whereas the red color of peppers is due to the accumulation of capsanthin and capsorubin, and this pepper-specific reaction is caused by an enzyme called CCS (capsanthin-capsorubin synthase). Controlled by The enzyme converts anteraxanthin and violaxanthin into capxanthin and capsorubin, respectively.

Three loci models ( Y , C1 , C2 ) have been proposed to explain the genetic phenomena of red pepper color (Hurtado-Hernandez and Smith, (1985) J. Hered. 76, 211-213). Afterwards, analysis of candidate genes for carotenoid biosynthesis genes revealed that the Y and C2 loci encode CCS and PSY1, respectively. However, the identity of the last locus, C1 , has not been identified. Since the identification of these loci, many researchers have tried to explain the hypercolor mutation through mutations in the PSY1 and CCS alleles. In general, it is known that red peppers with yellow fruits have structural mutations in the CCS coding region to form an early termination codon. However, early termination of CCS can also lead to orange fruit, as in Capsicum annuum'Fogo'. Therefore, reports to date imply that the variation of CCS , although playing a decisive role in hypercolor, does not define a specific color. On the other hand, in the case of C. chinense'Habanero ', the activity of the corresponding protein is impaired by the splicing mutation of PSY1 , resulting in orange fruit. From these previous studies, it can be concluded that the mutations in PSY1 and CCS alone cannot sufficiently explain the hyperchromic mutations in pepper. Therefore, it is necessary to identify the last locus to complement the existing trigenic locus model, and in this context, the effects of other genes involved in carotenoid biosynthesis on hypercolor have been studied. Representatively, there is a case of suppressing the expression of the capsantin biosynthetic gene through virus-induced gene silencing (VIGS). In this case, Lcyb (Lycopene beta cyclase) and CrtZ- as well as PSY1 and CCS. 2 (Beta-carotene hydroxylase 1, chloroplastic) also proved to play an important role in carotenoid biosynthesis. Furthermore, there are cases in which the red capsicum annium'Maor' became orange due to the substitution of nucleotides in the CrtZ-2 gene organic by using EMS (Ethyl methanesulfonate), and the name'high- pigment 3'was renamed due to increased coloring. In the pasted tomato mutant, it has been reported that amino acid substitutions exist in the conserved sequence of ZEP (zeaxanthin epoxidase). Therefore, it can be said that a thorough analysis of various candidate carotenoid biosynthetic genes is necessary to more clearly understand the color variation.

Next-generation sequencing (NGS) has made it possible to decipher the entire genome and has revolutionized genetic research and crop breeding. Next-generation sequencing methods are also used to search for mutations in specific gene sites or candidate genes in a variety of samples. In this context, this technique, also called targeted sequencing, is achieved through a first amplification using a partially specific primer and a second amplification that gives a barcode sequence to each sample. However, since Illumina's next-generation sequencing method only obtains short-length reads, it is limited to secure all of the intact sequence of the target site. This problem can be solved through the single-molecule real-time (hereinafter, SMRT) sequencing method developed by Pacific BioSciences. The SMRT sequencing method generally boasts a read length of more than 10 kb, and has the advantage of faster execution time than other sequencing methods. If the length of the target gene is shorter than 10 kb, the target gene sequence can be obtained through one run.

On the other hand, Korean Patent Publication No. 2018-0065785 discloses a'marker for discriminating peppers with a high lutein and beta-carotene content', and Korean Patent No. 0331183 discloses'Psy modified genes involved in red crystals of peppers and Although the'selective breeding method' is disclosed, there is no description of the composition for predicting ripeness and color of genetic resources in the capsicum genus of the present invention and the use thereof.

The present invention was derived from the above requirements, and the present inventors quickly identified mutations within the PSY1 , PSY2 , Lcyb , CrtZ-2 , ZEP , and CCS coding sites in 94 types of capsicum gene sources through SMRT sequencing. Then, representative genetic resources were selected and UPLC (ultra-performance liquid chromatography) was performed to investigate the relationship between the allele mutation and hypercolor. As a result, it was found that the mutations of PSY1 and CCS in different combinations could explain the variance in carotenoid content in non-red and hyper-colored genetic resources.In particular, in a specific chromatogram group having a PSY1/ccs genotype, carotene (carotene), cryptoxanthin, and zeaxanthin were subdivided into two subgroups based on the content. Through the above results, the present invention was completed by demonstrating that the SMRT sequencing method can successfully detect genetic variations in the target site even when targeting a large number of samples.

In order to solve the above problem, the present invention is an oligonucleotide capable of detecting a mutation in the PSY1 ( phytoene synthase 1 ) gene derived from pepper consisting of the nucleotide sequence of SEQ ID NO: 1 and CCS derived from pepper consisting of the nucleotide sequence of SEQ ID NO: 2 (capsanthin-capsorubin synthase) provides a mature color and composition of the prediction kaepsi kyum in (Capsicum) genetic resources, including the oligonucleotide that is capable of detecting a mutation of a gene nucleotide as an active ingredient.

In addition, the present invention provides a kit for predicting maturity and color of the genetic resources of the genus Capsicum , including the composition.

In addition, the present invention comprises the steps of determining the genotype of the red pepper-derived PSY1 ( phytoene synthase 1 ) gene consisting of the nucleotide sequence of SEQ ID NO: 1 and the red pepper-derived CCS ( capsanthin-capsorubin synthase ) gene consisting of the nucleotide sequence of SEQ ID NO: 2; Comprising, Capsicum genus ( Capsicum ) provides a method for predicting maturity and color of genetic resources.

The mutations in the PSY1 , PSY2 , Lcyb , CrtZ-2 , ZEP , and CCS coding regions explored in the present invention are expected to be useful in the development of molecular markers for predicting hypercolor in red pepper resources. It is also expected to be used to study the process of carotenoid biosynthesis.

1 shows a library construction process for SMRT sequencing analysis, and the SMRT sequencing method consists of a total of 5 steps. First, a target gene site is amplified using a primer containing a gene-specific binding sequence and a universal tag sequence. After that, secondary amplification is performed with a primer containing a universal tag sequence and a barcode sequence for distinguishing each sample. The final library is composed by mixing the amplification products, and at this time, a hairpin adapter is attached to enable sequential sequencing. The light blue and the yellow pearl squares each represent a general purpose tag used in the first polymerase chain reaction, and the deep blue pearl yellow squares represent the barcode sequence used in the second polymerase chain reaction.
2 is a result of comparison of coding regions between the structure of the PSY1 and CCS genes and the Capsicum gene source, and the black squares and the thick lines represent exons and introns, respectively. The allele name was given only in the case of causing a change in the amino acid sequence among the mutations in the exon portion. Insertion/deletion mutations occurring in the intron portion were indicated only at that location. ATG and TGA represent the start and stop codons, respectively, and the numbers represent the nucleotide positions on the cDNA sequence. (a) PSY1 consists of 6 exons and 5 introns, and a total of 13 mutant alleles were found. The asterisk (-) represents the 1 bp deletion that forms the early termination codon, and the hollow inverted triangle (▽) represents the frame shift caused by the 2 bp insertion. (b) CCS consists of a single exon, and a total of 13 allelic mutations were found. The asterisk (*) means the stop codon formed by the stop mutation. The asterisk (-) indicates a 1 bp deletion that forms an early termination codon, and a hollow inverted triangle (▽), a filled inverted triangle (▼), and a check (√) indicate 1, 8, and 76 bp insertions, respectively. . These insertional mutations cause structural migration mutations.
3 is a result of comparing the structure of the PSY2 and Lcyb genes and the coding region between the capsicum gene source, and the black square and the bold line represent exons and introns, respectively, and only mutations expected to bring about changes in amino acid sequence among mutations in exons Allele names were given. Insertion/deletion mutations within the intron indicated only the location. ATG and TGA/TAA represent the start and stop codons, respectively, and the numbers represent the nucleotide positions on the cDNA sequence. (a) PSY2 consists of 6 exons and 5 introns, and 3 allelic mutations were found. (b) Lcyb consists of a single exon, and 7 mutations were found. An asterisk (-) indicates a 12 bp deletion.
4 is a result of comparing the structure of the CrtZ-2 and ZEP genes and the coding region between the capsicum gene source, and the black square and the bold line represent exons and introns, respectively, and are expected to bring about a change in amino acid sequence among mutations in exons. Only the mutation was given an allele name. Only the position of the insertion/deletion mutation in the intron was indicated, and the ZEP was omitted due to space constraints. ATG and TGA/TAA represent the start and stop codons, respectively, and the numbers represent the nucleotide positions on the cDNA sequence. (a) CrtZ-2 consists of 7 exons and 6 introns, and a total of 11 mutations were detected. (b) ZEP consists of 16 exons and 15 introns, and a total of 16 mutations were found.
5 schematically illustrates structural mutations in the promoter and coding region of CCS found in the non-red capsicum gene source. The hollow squares and the black squares represent the promoter and the coding region, respectively, and the gray-shaded regions with question marks represent regions where the sequence has not been fully analyzed. 4,879 bp from -3,686 nt to 1,193 nt are deleted in ccs-p1 , and 2,968 bp from -3,010 to -42 nt are deleted in ccs-p2 . There are several sizes of insertions and deletions in ccs-p3 . Finally, the ccs-in allele has an insertion of 2,828 bp at 898 nt. The black inverted triangle (▼) and the hollow inverted triangle (▽) represent deletion and insertion, respectively. Black arrows indicate the binding sites of the primers.
6 is a heatmap of 10 types of carotenoids prepared for 43 types of genetic resources. The color of each square reflects the absolute amount of carotenoid, and the content of each component is expressed as the intensity of color from blue to red according to the scale located at the bottom right of the schematic diagram. Group numbers are listed in the left column, and genotypes expressed based on PSY1 and CCS are listed in the right column. The names of carotenoids are abbreviated to the first three letters. The chromatogram group and genotype are highly correlated except for the four gene sources (ACN 38, 79, 7, 67).

In order to achieve the object of the present invention, the present invention is derived from pepper consisting of an oligonucleotide capable of detecting a mutation of the PSY1 ( phytoene synthase 1 ) gene derived from pepper consisting of the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 2 of CCS (capsanthin-capsorubin synthase) provides a mature color and composition of the prediction kaepsi kyum in (Capsicum) genetic resources, including the oligonucleotide that is capable of detecting a mutation of a gene nucleotide as an active ingredient.

In the composition for predicting ripeness and color of genetic resources in Capsicum according to the present invention, the PSY1 gene mutation is the 120th base of the nucleotide sequence of SEQ ID NO: 1 is deleted or the 679th base adenine (A) is thymine (T). It may be substituted, but is not limited thereto.

In addition, in the composition for predicting maturity and color of genetic resources in the genus Capsicum according to the present invention, the CCS gene mutation is the 374th base guanine (G) of the nucleotide sequence of SEQ ID NO: 2 is substituted with adenine (A); The 599th base cytosine (C) is substituted with adenine; Guanine at position 883 is substituted with thymine; 1,009th base deletion; Base deletion at 1,265th base; And 1,337th base guanine substituted with adenine; may be one or more selected from the group consisting of mutations, but is not limited thereto.

The mutations in the PSY1 and CCS genes of the present invention may refer to knock-out mutations inducing the loss of function of each gene due to the occurrence of an early termination or stop mutation due to substitution or deletion of a specific base in the protein coding sequence, but the mutation It does not limit its scope.

In the composition for predicting maturity and color of genetic resources in capsicum according to the present invention, the oligonucleotide capable of detecting the mutation of the gene is a primer capable of amplifying a nucleotide sequence including the mutation base of each gene, each gene It may be one or more selected from the group consisting of probes capable of hybridizing with mutant bases and combinations thereof, but is not limited thereto.

In the present invention, the term "primer" is a nucleic acid sequence having a short free 3'hydroxyl group, which can form a complementary template and a base pair, and is the starting point for template strand copying. It refers to a short nucleic acid sequence that functions as. Primers can initiate DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature. The PCR conditions, the length of the sense and antisense primers can be modified based on those known in the art.

In the present invention, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to a few bases to a few hundred bases for a specific binding to mRNA, and is labeled to confirm the presence or absence of a specific mRNA. I can. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, or an RNA probe. Selection of suitable probes and conditions for hybridization can be modified based on those known in the art.

The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well known methods. Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, e.g., uncharged linkers (e.g., methyl phosphonate, phosphorester, phosphoro Amidates, carbamates, etc.) or to charged linkers (eg phosphorothioate, phosphorodithioate, etc.).

The present invention also provides a kit for predicting maturity and color of the genetic source of Capsicum , comprising the composition according to the present invention.

The kit of the present invention detects a mutation in the PSY1 ( phytoene synthase 1 ) gene derived from pepper consisting of the nucleotide sequence of SEQ ID NO: 1 and the CCS ( capsanthin-capsorubin synthase ) gene derived from pepper consisting of the nucleotide sequence of SEQ ID NO: 2 It is possible to predict the ripeness and color of the genus ( Capsicum ) genetic resources. The kit for predicting ripeness and color of genetic resources in the capsicum of the present invention includes primers and probes for detecting PSY1 and CCS gene mutations, as well as one or more other constituent compositions, solutions, or devices suitable for analysis methods. I can.

When the kit of the present invention is an RT-PCR kit, a test tube or other suitable container, reaction buffer (various pH and magnesium concentration), deoxynucleotide (dNTPs), in addition to each primer set specific for mutations in PSY1 and CCS genes. ), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water, sterile water, and the like. In addition, a primer set specific to a gene used as a quantitative control may be included. In addition, the kit of the present invention may be a diagnostic kit including essential elements necessary to perform a DNA chip. The DNA chip kit may include a substrate to which cDNA corresponding to a gene or a fragment thereof is attached as a probe, and reagents, agents, enzymes, etc. for producing a fluorescently labeled probe. In addition, the substrate may include cDNA corresponding to a quantitative control gene or a fragment thereof.

The present invention further comprises the steps of determining the genotype of the red pepper-derived PSY1 ( phytoene synthase 1 ) gene consisting of the nucleotide sequence of SEQ ID NO: 1 and the red pepper-derived CCS ( capsanthin-capsorubin synthase ) gene consisting of the nucleotide sequence of SEQ ID NO: 2; Comprising, Capsicum genus ( Capsicum ) provides a method for predicting maturity and color of genetic resources.

In the method for predicting ripeness and color according to the present invention, the method for determining the genotype of a gene may be sequencing analysis, but is not limited thereto, and may be performed through various techniques known in the art.

In the method for predicting ripeness and color of genetic resources in capsicum according to an embodiment of the present invention, when the genotype of the PSY1 and CCS genes is PSY1 / CCS , the red color of ripeness; If the genotype is psy1 / CCS , then dark orange (= dark orange), orange (= orange) or pink ripe fruit color; When the genotype is PSY1 / ccs , it is orange, bright orange (=pale orange) or yellow ripe fruit color; And when the genotype is psy1 / ccs , it can be predicted as bright yellow (= light yellow) or ivory color (= ivory color). The uppercase letters PSY1 and CCS refer to the wild type genotype, and the lowercase letters psy1 and ccs refer to the mutant genotype.

The psy1 mutant genotype may include a gene in which the 120th base of the nucleotide sequence of SEQ ID NO: 1 is deleted or the 679th base adenine (A) is substituted with thymine (T), and the ccs mutant genotype is the base of SEQ ID NO: 2 Guanine (G) at the 374th base in the sequence is substituted with adenine (A); The 599th base cytosine (C) is substituted with adenine; Guanine at position 883 is substituted with thymine; 1,009th base deletion; Base deletion at 1,265th base; And guanine at the 1,337th base is substituted with adenine; It may have a gene including one or more mutations selected from the group consisting of mutations, but is not limited thereto.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Materials and methods

1. Plant material

C. annuum , C. baccatum, C. chacoense , C. chinense , C. eximium , C. eximium , A total of 94 genetic resources were used, including C. frutescens , C. praetermissum , and C. pubescens . These genetic resources were sold at the Agricultural Genetic Resource Center, of which 62 species belong to capsicum annium. All plants were cultivated in an experimental farm attached to Seoul National University. The color of the genetic resources is classified into 8 groups based on the color specified in QPcard 203, and the colors are composed of red, pearly yellow, orange, golden yellow, yellow, light yellow, ivory, and pink.

2. Library construction for SMRT sequencing analysis

A polymerase chain reaction (PCR) was performed using 100 ng of a DNA template and 10 pmol of a gene-specific primer. Each primer was designed to amplify products of similar size in order to secure a sequence analysis result with similar reliability. The library was constructed through a polymerase chain reaction over a total of two steps (Fig. 1). First, the target gene site was amplified through primary amplification, and the primers contain a common sequence necessary for binding of the primers to be used in the secondary amplification (Table 1). The conditions for the first polymerase chain reaction are as follows. After heating at 95°C for 4 minutes, a program consisting of three conditions of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute and 40 seconds was repeated 35 times. The second amplification proceeds using the first amplification product as a template, and the primer contains a barcode sequence to distinguish each sample. The secondary PCR conditions are as follows. After heating at 95° C. for 4 minutes, a program consisting of three conditions of 95° C. 30 seconds, 60° C. 30 seconds, and 72° C. 1 minute 50 seconds was repeated 30 times. The product obtained through amplification over two steps was purified using a QiaQuick PCR purification kit, and then quantified using NanoDrop. Based on the measured concentration, all products were calculated to contain the same amount and then mixed in a single tube.

Primer information used in the present invention name Sequence information (5'→3') (SEQ ID NO) Target gene PSY1-P1-pacbio-F TCGTCGGCAGCGTC GAGGTCGCTATAGGAGCCGA (3) N-PSY1 PSY1-P1-pacbio-R GTCTCGTGGGCTCGG AACCCAACCGTACCAGCAAC (4) PSY1-P2-pacbio-F TCGTCGGCAGCGTC CTGTTTCACAGTTTTGCGAACTC (5) C-PSY1 PSY1-P2-pacbio-R GTCTCGTGGGCTCGG TATTGGCTTCATTGGCCTTG (6) PSY2-P1-pacbio-F TCGTCGGCAGCGTC TGGGATAAACTAGGCTGAGGTG (7) N-PSY2 PSY2-P1-pacbio-R GTCTCGTGGGCTCGG CAACTGGAAATCTGGAAACG (8) PSY2-P2-pacbio-F TCGTCGGCAGCGTC GGTGCAGGAGAACTGATGAG (9) C-PSY2 PSY2-P2-pacbio-R GTCTCGTGGGCTCGG CATTCATGTCTTTGTTAGTGAAGA (10) LCYB-pacbio-F TCGTCGGCAGCGTC AGGACCCCATTTGCTGTTTT (11) Lcyb LCYB-pacbio-R GTCTCGTGGGCTCGG TCCGATCATTCTCCCGAGTT (12) CRTZ2-P1-pacbio-F TCGTCGGCAGCGTC CCTGTGCATCAAGTCCTATTCA (13) N-CrtZ-2 CRTZ2-P1-pacbio-R GTCTCGTGGGCTCGG ATGAGAACACGTACAGCGCC (14) CRTZ2-P2-pacbio-F TCGTCGGCAGCGTC GCCCTAACCTTTTTCCCAAA (15) C-CrtZ-2 CRTZ2-P2-pacbio-R GTCTCGTGGGCTCGG GCTGCTTTTTCGTGGTGTTC (16) ZEP-P1-pacbio-F TCGTCGGCAGCGTC TCCTTTCACTTCCTTTGGCCT (17) N-ZEP ZEP-P1-pacbio-R GTCTCGTGGGCTCGG AGCTTCACTGTGTCCGAACA (18) ZEP-P2-pacbio-F TCGTCGGCAGCGTC CAAACATTTCCGTTGTGTTG (19) M-ZEP ZEP-P2-pacbio-R GTCTCGTGGGCTCGG CAAACCACAGGATATCAACTTCC (20) ZEP-P3-pacbio-F TCGTCGGCAGCGTC GGACTTGGGAATGCCTCTAATG (21) C-ZEP ZEP-P3-pacbio-R GTCTCGTGGGCTCGG ATGCTGTACAAATTTCCCGTTT (22) CCS-pacbio-F TCGTCGGCAGCGTC TGATTCCCCTAGTTCGGTATTTC (23) CCS CCS-pacbio-R GTCTCGTGGGCTCGG GCTTTTGTTTCACTTTTGCATTG (24) CDF4000 CCCCTGGCACACCACTCTTGGAGCC (25) CCS The underlined sequence represents the universal tag sequence.

3. SMRT sequence analysis

In order to analyze a total of 6 carotenoid biosynthetic genes, SMRT sequencing was performed twice. In the case of PSY1 , Lcyb , CrtZ-2 and CCS , the analysis was performed in Macrogen Co., Ltd. using the P5-C3 chemistry method, and in the case of PSY2 and ZEP , the analysis was performed in DNA Link based on the P6-C4 chemistry method. The SMRT bell library was produced through the process of end-calibration, ligation, and nucleic acid-terminating enzyme purification of the library completed in 2 above. Finally, the SMRT bell library and the polymerase molecule were reacted at 25° C. for 4 hours, and the polymerase-template complex thus completed was immobilized on the SMRT cell. The SMRT cell contains a zero-mode waveguide (ZMW), and sequencing is performed in that part to produce reads.

4. Processing of nucleotide sequence analysis results

Information obtained through SMRT sequencing was processed using SMRT analysis software v2.3.0. First, the unprocessed leads were filtered, and then separated into leads for each sample through a demultiplexing process. Then, the reads for each sample were compared to the reference sequences of 6 carotenoid biosynthetic genes. For the basic setting in this process, refer to the RS_Resequencing_Barcode.1 protocol included in SMRT Portal. Only mutations with a minimum coverage and reliability of 20 or more were used for subsequent analysis, and matching sequences and mutations for each gene were extracted using Quiver.

5. Carotenoid extraction and saponification

After harvesting the fruits at the ripening stage, only the skin samples excluding the placenta were obtained. Extraction of the carotenoid pigment was performed using acetone (Collera-Zuniga et al., (2005) Food Chem. 90, 109-114), but the volume of the added solvent was adjusted according to the conditions. After adding 20 mL of acetone per 1 g of freeze-dried and pulverized sample, it was allowed to stand at 4° C. for 20 hours to extract the pigment. Thereafter, the extract was dried using a nitrogen concentrator, and then 3 mL of acetone, 3 mL of methanol, and 1 mL of a 30% potassium hydroxide/methanol mixture were added and reacted in a dark room for 2 hours and 30 minutes. After the saponification process was completed, the extract was transferred to the fractionation filter. Thereafter, 20 mL of diethyl ether was added, mixed, and allowed to stand to induce layer separation. In addition, 2 mL of a 10% calcium chloride mixture and 2 mL of a 2% sodium sulfate mixture were sequentially added to induce layer separation, and all water remaining in the diethyl ether layer was removed. The finally obtained diethyl ether was completely evaporated using a vacuum concentrator, and then re-dissolved with 2 mL of acetone. Samples that had been redissolved were filtered using an Acrodisc syringe filter (0.2 μm) before UPLC analysis.

6. Carotenoid analysis through UPLC

Carotenoids were analyzed using the Acquity UPLC-H-Class system, and a T3 column (1.8 μm) was used to separate components. As the mobile phase, phase B composed of acetonitrile/methanol/methylene chloride in a volume ratio of 65/25/10 and distilled water was used. The composition of the A/B mobile phase over time followed the conditions of the previous study, and the UV wavelength was set to 450 nm (Kim et al., (2016) Food Chem. 201, 64-71). For the qualitative and quantitative analysis of carotenoids, 10 carotenoid standards were purchased from Sigma-Aldrich, and the carotenoids were anteraxanthin, capsanthin, lutein, neoxanthin, and viola. Violaxanthin, zeaxanthin, alpha-carotene, alpha-cryptoxanthin, beta-carotene and beta-cryptoxanthin.

Example 1. Library construction for SMRT sequencing analysis

In order to proceed with SMRT sequencing, a library was constructed for a total of 6 carotenoid biosynthetic genes. PSY1 consists of 6 exons, and the length of the coding sequence is 1,260 bp. Two pairs of primers were designed to amplify the N-terminal and C-terminal regions of PSY1 , and when PCR is performed using the primers, products of 1,695 bp and 1,690 bp, respectively, can be obtained. Of a total of 94 genetic resources, only 75 and 74 genetic resources were able to obtain an amplification product of the expected size. However, in the case of the C. baccatum gene source ACN 64, an amplification product of a different size than expected was obtained at both ends, and the amplification product itself could not be obtained at the N-terminus and C-terminus in 18 and 19 genetic resources. Next, PSY2 is composed of 6 exons and a coding sequence of 1,299 bp. Like PSY1 , two pairs of primers were designed, and the size of the expected PCR amplification products at each end was all 1,623 bp. The same type of amplification as expected was achieved in all genetic resources. Third, Lcyb consists of a single exon of 1,497 bp, and a primer was designed to obtain a fragment of 1,706 bp. Amplification products of expected size were obtained from a total of 90 genetic resources, but the amplification products could not be obtained from the remaining four C. annuum genetic resources (ACN 4, 15, 53, 58). Fourth, in the case of CrtZ-2 , it consists of 7 exons and the coding sequence reaches 948 bp. Two pairs of primers were designed to amplify each end, and the sizes of the expected amplification products are 1,677 bp and 1,634 bp. In the case of the N-terminus, a band of the expected size was secured in 75 species, but a larger band in 17 genetic resources and a smaller size in two genetic resources ( C. annuum ACN 27, C. baccatum ACN 69). The band was obtained. In the case of the C-terminus, amplification was achieved as expected for all genetic resources. Fifth, in the case of ZEP , it consists of 16 exons, and consists of a coding sequence of 1,986 bp. In order to ensure that all gene fragments have a length within a similar range, in the case of ZEP , three pairs of primers were designed to amplify the N-terminus, the central part, and the C-terminus, respectively, amplifying the fragments of 1,760 bp, 1,709 bp and 1,704 bp Let it. Bands of the expected size were obtained without exception in all genetic resources. Finally, in the case of CCS , it is composed of a single exon of 1,497 bp, and a primer was designed to secure an amplification product of 1,674 bp. Bands of the expected size were secured only in 62 genetic resources, and amplification products could not be obtained from 32 genetic resources. In the present invention, a secondary polymerase chain reaction was performed in which a barcode sequence was attached to only normal-sized bands, and the mixture was mixed and SMRT sequence analysis was performed through the procedure shown in FIG. 1.

Example 2. SMRT sequence analysis and allele mutation analysis

Sequence analysis was performed using two SMRT cells to obtain sufficient information from all six carotenoid biosynthetic genes. As a result of analyzing the sequence of PSY1 , Lcyb , CrtZ-2, and CCS using the first cell, 300,584 raw reads were obtained, and 94,318 reads were selected through a filtering process. The average read length was 13,551 bp, and the total data size was 1,278,193,633 bp. Next, as a result of analyzing the sequence of PSY2 and ZEP using the second cell, 150,292 unprocessed reads were obtained, and only 108,181 reads were selected through a filtering process. The average length of the reads was 18,871 bp, and the size of the total data was 2,041,520,976 bp. The reads were compared to the reference sequence for each gene, and only data with a minimum coverage and reliability exceeding 20 were used for later analysis. Single nucleotide polymorphism (SNP) mutations and insertion/deletion (indel) mutations found in genetic resources with red ripeness and color were all removed.

2-1. PSY1 Variation within alleles

Through SMRT sequencing analysis, 36 and 60 mutations in the exon and intron of PSY1 were detected, respectively. Among a total of 96 mutations, only the mutations present in the exon resulting in a change in the amino acid sequence and the insertion/deletion mutations present in the intron are shown in FIG. 2A. In addition, the allelic mutations found in the exon were given names based on the location of the mutation. Of the 12 mutations found in the PSY1 coding sequence, 9 were missense mutations. Of the remaining three mutations, two were frame-shift mutations, and the last one was a nonsense mutation. The structural shift mutation due to the 1 bp deletion occurring at the 120th nucleotide (nt) position was named psy1-c5 , and the mutation was found only in three C. frutescens genetic resources (ACN 87, 90, 91). . In the case of psy1-c10 , another structure-shifting mutation, it was caused by 2 bp insertion at the 714th nt, and only in two C. chinense gene sources (ACN 79, 80) and one C. frutescens gene source (ACN 88). Was found. Finally, the stop mutation occurring at 679th nt was found only in two C. chinense gene sources (ACN 81, 82).

2-2. CCS Variation within alleles

SMRT sequencing was able to detect a total of 29 mutations within CCS . Among these, 13 mutations, including 6 structural shift mutations, 4 stop mutations, and 3 overmutations, induced changes in the amino acid sequence (FIG. 2B). The most frequently found mutation was the structural shift mutation, already named ccs-3. This mutation was caused by a 1 bp deletion occurring at 1,265 nt, and was found in 18 C. annuum gene sources and one C. baccatum gene source (ACN 67). The next frequently detected mutation was a structural shift mutation ( ccs-c7 ) by 1 bp insertion occurring at the 1,024th nt, and was found in five C. annuum genetic resources (ACN 16, 21, 23, 41, 61). Became. In the case of ccs-c11 , another structure-shifting mutation, it was identified in one C. annuum gene source (ACN 47) and one C. chinense gene source (ACN 77) as a result of 8 bp insertion occurring at the 1,431th nt. . Of the quiescent mutations, ccs-c3 , which occurred at the 599th nt, was found in two C. chinense gene sources (ACN 75 and 76) and two C. frutescens gene sources (ACN 90 and 91). However, for the rest of the mutations, it was difficult to discuss species-specific trends because they were found only in a few limited genetic resources. Three conformational mutations, including ccs-c2 , ccs-c6 , and ccs-c10 , were found in only one gene source, ACN 94, 67, and 78, respectively. Similarly, three stop mutations, including ccs-c1 , ccs-c5 , and ccs-c9, were also found only in one gene source, ACN 89, 36, and 38, respectively. Of the 10 knockout mutations discussed above, ccs-c3 , ccs-3 , and ccs-c11 have already been reported.

2-3. PSY2 Variation within alleles

Through SMRT sequence analysis, 7 and 20 mutations in the exon and intron of PSY2 were detected, respectively. Notably, compared to other genes, the number of mutations found was significantly smaller. Only 3 of the 7 exon mutations brought about a change in amino acid, but all did not form an early stop codon (FIG. 3A). Psy2-c1 , an over- mutant found in the first exon, was only found in two C. chinense gene sources (ACN 79, 80), and psy2-c3 , another over- mutant found in the fifth exon, was found in two C. pubescens genetic resources (ACN 93, 94).

2-4. Lcyb Variation within alleles

Through SMRT sequencing analysis, 31 kinds of allelic mutations in Lcyb could be detected, but only 7 of them resulted in amino acid changes (FIG. 3B). Most of the mutations were over-error mutations, but in the case of lcyb-c1 , a 12 bp deletion occurred at the 140 th nt position. This mutation was found in two C. pubescens genetic resources (ACN 93, 94). Furthermore, there was also a mutation ( lcyb-c6 ) specifically found in 16 C. annuum genetic resources, and the mutation was a mutation in which asparagine located at 379 on the amino acid sequence was converted to aspartic acid. Genetic resources carrying the lcyb-c6 mutation showed a variety of hypercolors , ranging from pink to orange.

2-5. CrtZ-2 Variation within alleles

Through SMRT sequencing, 16 and 58 mutations in the exons and introns of CrtZ-2 were detected, respectively. Of the 16 mutations present in the coding sequence, only 9 mutations induced amino acid changes, but none of them formed a stop codon (FIG. 4A). Two of these mutations, crtz-c1 and crtz-c5 , were continuously found in four C. annuum gene sources (ACN 22, 24, 39, 51), and four over- mutations, crtz-c2. , crtz-c3 , crtz-c4 , and crtz-c6 were specifically found in three C. baccatum genetic resources (ACN 65, 66, 67). Finally, crtz-c8 and crtz-c9 were found in two C. pubescens genetic resources (ACN 93, 94).

2-6. ZEP Variation within alleles

Through SMRT sequencing, 30 and 61 mutations in the exons and introns of ZEP were detected, respectively. Of the 30 mutations present in the coding sequence, only 16 mutations resulted in amino acid changes. All of the 16 types of mutations corresponded to the false mutations (Fig. 4b). Seven mutations including zep-c6 , zep-c9 , zep-c12 , zep-c13 , zep-c14 , zep-c15 and zep-c16 were found exclusively in two C. pubescens gene sources (ACN 93, 94). Became. On the other hand, zep-c5 and zep-c11 include one C. annuum gene resource (ACN 47), four C. chinense user resources (ACN 76, 77, 78, 72), and two C. frutescens. It has been found in a variety of species, such as genetic resources (ACN 90, 91).

Example 3. Structural mutation found through polymerase chain reaction

Of the 94 genetic resources, the PSY1 N-terminus, PSY1 C-terminus, Lcyb and CCS libraries were not able to obtain amplification products from 18, 19, 4 and 32 genetic resources, respectively. Since SMRT sequencing could not be performed for genetic resources exhibiting such abnormal amplification patterns, as an alternative, polymerase chain reaction was performed under different conditions. The amplification time was increased to 10 minutes, and at the same time, amplification was attempted using primers that bind to other regions of the gene (promoter, etc.) for some genes. In the case of PSY2 and ZEP , the amplification was as expected in all genetic sources.

3-1. PSY1 My structural mutation

In the process of constructing a library for SMRT sequencing analysis, the band corresponding to the PSY1 N-terminus was not amplified in 18 genetic resources, and in the case of ACN 64, a C. baccatum gene source, a band within 3 kb larger than the expected size was amplified. Became. In the case of the C-terminus, the band was not amplified in 19 genetic sources, and in the case of ACN 64, a band larger than the expected size was amplified. Meanwhile, in the case of ACN 69, another C. baccatum gene source, fragments were obtained only at the N-terminus. In the case of ACN 64 through PCR, it was found that 1,395 bp was inserted into the third intron ( psy1-in1 ). Since the site where the insertion took place is located between the binding site of the reverse primer used for the first amplification and the forward primer used for the second amplification, it was considered that a band larger than the expected size was secured at both ends. In the case of ACN 69, it succeeded in securing the amplification product through long-range PCR that increased the amplification time to 10 minutes, and it was found that there existed insertions of around 7 kb in the gene resource ( psy1- in2 ). However, it was not possible to clarify what mutations exist in the 18 genetic resources in which the amplification of PSY1 itself failed, which was presumably due to the presence of large insertions or deletions.

3-2. Lcyb My structural mutation

During the library construction process for SMRT sequencing analysis, the amplification products of Lcyb could not be obtained from a total of 4 C. annuum genetic resources (ACN 4, 15, 53, 58). Since the ripe fruit color of the gene resource varies in pearl yellow, orange, yellow, and pale yellow, respectively, the mutation itself that has not been identified does not seem to be closely related to the fruit color. Even in previous studies, it was not possible to obtain a clue about the mutation of Lcyb , but we are considering the possibility that the amplification failed because the mutation present near the primer binding site inhibits the polymerase chain reaction.

3-3. CrtZ-2 My structural mutation

While constructing the N-terminal library of CrtZ-2 , an unexpectedly large amplification product was obtained from a total of 19 genetic resources. Among them, it was found that there was an insertion of 960 bp in the first intron in 17 kinds of genetic resources ( crtz-in ), and all of the genetic resources carrying the mutation of the corresponding type belonged to the C. annuum line. Their maturity and color ranged from light yellow to red. On the other hand, 84 bp deletion was found in the first intron in the other two genetic resources (ACN 27, 69), and these genetic resources corresponded to C. annuum and C. baccatum , respectively.

3-4. CCS My structural mutation

In the case of CCS , it failed to construct a library for SMRT sequencing in a total of 32 genetic resources. In consideration of the possibility that there is a structural variation in CCS , a forward primer that binds to a portion present 4.3 kb upstream from the start codon was designed. When PCR is carried out using the same reverse primer used to construct the library and the newly designed forward primer, a 5.9 kb amplification product must be secured from the red genetic resource. However, in 23 genetic resources, bands of around 1 kb were secured ( ccs-p1 ). As a result of sequence analysis, it was found that a total of 4,879 bp of sequence from -3,686 nt to 1,193 nt was deleted. All genetic resources carrying this type of mutation belonged to the C. annuum family. On the other hand, from 5 C. baccatum genetic resources (ACN 64, 66, 67, 68, 69), 2.5 kb of amplification product was obtained ( ccs-p2 ), and the mutation ranged from -3,010 nt to -42 nt. It was found that a total of 2,968 bp was deleted. In the present invention, mutations in the promoter were also detected in 9 kinds of genetic sources. In this case, since the primer binding site itself is intact, amplification and SMRT sequencing were performed without problems. However, in PCR targeting the promoter portion, a band of about 6 kb larger than the expected size was amplified ( ccs-p3 ). Various insertion/deletion mutations, including 11 bp deletion, 197 bp deletion, and 5 bp insertion, existed in the allele, and C. annuum gene source (ACN 12), C. chinense gene source (ACN 75, 78, 79, 80) , 81, 82), C frutescens genetic resources (ACN 90, 91). After finding the structural mutation occurring in the CCS promoter, the amplification time was increased to 10 minutes to proceed with the polymerase chain reaction. As a result, a fragment of about 9 kb was amplified from ACN 42, which is a C. annuum gene source, and it was confirmed that this was caused by the insertion of 3 kb generated at 898 nt (FIG. 5). However, in the present invention, mutations present in C. annuum ACN 27, C. baccatum ACN 65 and C. pubescens ACN 93 were not identified. Perhaps other types of mutations were predicted to be present in the genetic resource.

Example 4. Classification of carotenoid profiles

Of the 94 genetic resources, 43 genetic resources were selected that could sufficiently reflect the variation within the allele of the candidate gene. UPLC was performed for the genetic resources to obtain a profile of carotenoids, and the process was repeated twice. In the present invention, 43 kinds of genetic resources were classified into 4 groups based on the aspect of the chromatogram. In the case of Group I, where 8 kinds of genetic resources are applicable, capsantin was the main carotenoid component and lutein was not detected. In Group II to which 26 kinds of genetic resources belong, all carotenoid components except capxanthin were detected, and the three most common carotenoids were lutein, anteraxanthin, and violaxanthin. In the case of group III to which 7 kinds of genetic resources belong, most carotenoids were detected in very small amounts. As in group II, a high proportion of lutein was detected, but unlike group II, cryptoxanthin and carotene were hardly found. Lastly, in the case of group IV, which contained two kinds of genetic resources, α-cryptoxanthin and anteraxanthin were the main carotenoids, and lutein and capxanthin were not detected. In summary, the genetic resources belonging to Group I show reddish colors ranging from pink to red according to the accumulation of capxanthin, and the genetic resources of Group II are yellow according to the combination of lutein, anteraxanthin, and violaxanthin. The color ranges from orange to orange. Finally, it can be seen that the genetic resources of group III exhibit hypercolor from ivory to light yellow due to lutein and the remaining carotenoid components accumulated in small amounts.

Example 5. Correlation between carotenoid profile and genotype

To confirm the correlation between the carotenoid profile and genotype, first, knockout mutations predicted to impair the function of the corresponding gene in PSY1 , PSY2 , Lcyb , CrtZ-2 , ZEP , and CCS were selected. These mutations include stop mutations and structural shift mutations resulting from insertion/deletion occurring in the coding region, and in the case of CCS , even large-scale deletions occurring in the promoter region. On the other hand, since genes satisfying the above criteria (early termination) were found only in PSY1 and CCS , a heatmap was created based on the carotenoid component and then compared with the PSY1 / CCS genotype (Fig. 6). In the heatmap, the content of carotenoids was expressed in the order of blue (minimum), white (medium), and red (maximum). Genetic resources belonging to group I all had normal functioning CCS except for C. annuum ACN 38. Meanwhile, group I could be subdivided into two subgroups according to the genotype of PSY1 . The group possessing the normal functioning PSY1 accumulated a large amount of capxanthin , but the group possessing the abnormal functioning PSY1 showed non-red red color as the amount of capsantin decreased. The hypercolors of the genetic resources belonging to the subgroup were pearl yellow (ACN 5), orange (ACN 15), and pink (ACN 82). Genetic resources belonging to group II had normal PSY1 and mutant CCS except for C. chinense ACN 79. Their supercolors ranged from yellow to orange. The genetic resources of group III had impaired functions of both PSY1 and CCS , and exhibited excessive color ranging from ivory to light yellow. Finally, C. annuum ACN 7 and C. baccatum ACN 67 belonging to group IV exhibited psy1 / CCS and PSY1 / ccs genotypes, respectively. In this case, the number of samples was limited, so it was difficult to discuss the correlation between carotenoid content and genotype. Through the above results, it was found that chromatogram groups I to III were closely related to genotypes represented by PSY1 and CCS , excluding ACN 38 and 79 genetic resources.

<110> Seoul National University R&DB Foundation <120> Composition for predicting color of full ripe fruit of Capsicum genetic resource and uses thereof <130> PN19186 <160> 25 <170> KoPatentIn 3.0 <210> 1 <211> 1260 <212> DNA <213> Capsicum annuum <400> 1 atgtctgttg ccttgttatg ggttgtttct ccttgtgacg tctcaaacgg gacaggattc 60 ttggtatccg ttcgtgaggg aaaccggatt tttgattcgt cggggcgtag gaatttggcg 120 tgcaatgaga gaatcaagag aggaggtgga aaacaaaggt ggagttttgg ttcttacttg 180 ggaggagcac aaactggaag tggacggaaa ttttctgtac gttctgctat cgtggctact 240 ccggctggag aaatgacgat gtcatcagaa cggatggtat atgatgtggt tttgaggcag 300 gcagccttgg tgaagagaca gctgagatcg accgatgagt tagatgtgaa gaaggatata 360 cctattccgg ggactttggg cttgttgagt gaagcatatg ataggtgtag tgaagtatgt 420 gcagagtacg caaagacgtt ttacttagga acgatgctaa tgactccgga gagaagaaag 480 gctatctggg caatatacgt atggtgcagg agaacagacg aacttgttga tggtccgaat 540 gcatcacaca ttactccggc ggccttagat aggtgggaag acaggctaga agatgttttc 600 agtggacggc catttgacat gctcgatgct gctttgtccg acacagtttc caaatttcca 660 gttgatattc agccattcag agatatgatt gaaggaatgc gtatggactt gaggaagtca 720 agatacagaa actttgacga actataccta tattgttatt acgttgctgg tacggttggg 780 ttgatgagtg ttccaattat gggcatcgca cctgaatcaa aggcaacaac ggagagcgta 840 tataatgctg ctttggcttt ggggatcgca aatcagctga ccaacatact tagagatgtt 900 ggagaagatg ccagaagagg aagagtctat ttgcctcaag atgaattagc acaggcaggt 960 ctatccgacg aagacatatt tgctggaaga gtgaccgata aatggagaat cttcatgaag 1020 aaacaaattc agagggcaag aaagttcttt gacgaggcag agaaaggagt gaccgaattg 1080 agcgcagcta gtagatggcc tgtgttggca tctctgctgt tgtaccgcag gatactggac 1140 gagatcgaag ccaatgacta caacaacttc acaaagagag cttatgtgag caaaccaaag 1200 aagttgattg cattacctat tgcatatgca aaatctcttg tgccttctac aagaacatga 1260 1260 <210> 2 <211> 1427 <212> DNA <213> Capsicum annuum <400> 2 aacacaactc cacttttcca aatccaacca aacaaaaaga ttcaagaaag ttccattata 60 gaaacaaaag cagtacacat ttttgtagct ttcttgattt agcacccaca tcaaagccag 120 agtctttaga tgttaacatc tcatgggttg atactgatct ggaccgggct gaattcgacg 180 tgatcatcat tggaactggc cctgccgggc ttcggctagc tgaacaagtt tctaaatatg 240 gtattaaggt atgttgcgtt gacccttcac cactttccat gtggccaaat aattatggtg 300 tttgggttga tgagtttgaa aagttgggat tagaagattg tctagatcat aagtggcctg 360 tgagttgtgt tcatataagt gatcacaaga ctaagtattt ggacagacca tatggtagag 420 taagtagaaa gaagttgaag ttgaaattgt tgaatagttg tgttgaaaat agagtgaagt 480 tttataaagc caaggttttg aaagtgaagc atgaagaatt tgagtcttcg attgtttgtg 540 atgatggtag gaagataagt ggtagcttga ttgttgatgc aagtggctat gctagtgatt 600 ttatagagta tgacaagcca agaaaccatg gttatcaagt tgctcatggg attttagcag 660 aagttgataa tcatccattt gatttggata aaatgatgct tatggattgg agggattctc 720 atttaggtaa tgagccatat ctgagggtga agaatactaa agaaccaaca ttcttgtatg 780 caatgccatt tgataggaat ttggtattct tggaagagac ttccttagtg agtcggccta 840 tgttatcgta tatggaagtg aaaagaagga tggtagcaag attaagacat ttggggatca 900 aagtgagaag tgtccttgag gaagagaagt gtgtgatcac tatgggagga ccacttccgc 960 ggattcctca aaatgttatg gctattggtg ggacttcagg gatagttcat ccatcgtctg 1020 ggtacatggt ggctcgtagc atggcattgg caccagtact ggctgaggcc atcgtcgaaa 1080 gccttggctc aacaagaatg ataagagggt ctcaacttta ccatagagtt tggaatggtt 1140 tgtggccttc ggatagaaga cgtgttagag aatgttattg tttcggaatg gagactttgt 1200 tgaagcttga tttggaaggt actaggagat tgtttgatgc tttctttgat gttgatccca 1260 agtactggca cgggttcctt tcttcaagat tgtctgtcaa agaacttgct gtactcagtt 1320 tgtacctttt tggacatgcc tctaatttgg ctaggttgga tattgttaca aagtgcactg 1380 tccccttggt taaactgctg ggcaatctag caatagagag cctttga 1427 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 tcgtcggcag cgtcgaggtc gctataggag ccga 34 <210> 4 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gtctcgtggg ctcggaaccc aaccgtacca gcaac 35 <210> 5 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 tcgtcggcag cgtcctgttt cacagttttg cgaactc 37 <210> 6 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gtctcgtggg ctcggtattg gcttcattgg ccttg 35 <210> 7 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 tcgtcggcag cgtctgggat aaactaggct gaggtg 36 <210> 8 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gtctcgtggg ctcggcaact ggaaatctgg aaacg 35 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 tcgtcggcag cgtcggtgca ggagaactga tgag 34 <210> 10 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gtctcgtggg ctcggcattc atgtctttgt tagtgaaga 39 <210> 11 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 tcgtcggcag cgtcaggacc ccatttgctg tttt 34 <210> 12 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 gtctcgtggg ctcggtccga tcattctccc gagtt 35 <210> 13 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 tcgtcggcag cgtccctgtg catcaagtcc tattca 36 <210> 14 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 gtctcgtggg ctcggatgag aacacgtaca gcgcc 35 <210> 15 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 tcgtcggcag cgtcgcccta acctttttcc caaa 34 <210> 16 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 gtctcgtggg ctcgggctgc tttttcgtgg tgttc 35 <210> 17 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 tcgtcggcag cgtctccttt cacttccttt ggcct 35 <210> 18 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gtctcgtggg ctcggagctt cactgtgtcc gaaca 35 <210> 19 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 tcgtcggcag cgtccaaaca tttccgttgt gttg 34 <210> 20 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 gtctcgtggg ctcggcaaac cacaggatat caacttcc 38 <210> 21 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 tcgtcggcag cgtcggactt gggaatgcct ctaatg 36 <210> 22 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 gtctcgtggg ctcggatgct gtacaaattt cccgttt 37 <210> 23 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 tcgtcggcag cgtctgattc ccctagttcg gtatttc 37 <210> 24 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 gtctcgtggg ctcgggcttt tgtttcactt ttgcattg 38 <210> 25 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 cccctggcac accactcttg gagcc 25

Claims (7)

An oligonucleotide capable of detecting a mutation in which the 120th base of the PSY1 ( phytoene synthase 1 ) gene derived from a pepper consisting of the nucleotide sequence of SEQ ID NO: 1 is deleted, and a CCS derived from pepper consisting of the nucleotide sequence of SEQ ID NO: 2 ( capsanthin-capsorubin synthase ) Capsicum frutescens ( Capsicum frutescens ), containing an oligonucleotide capable of detecting a mutation in which the 599th base cytosine (C) is substituted with adenine (A) as an active ingredient, the ivory color of the genetic resource Composition for predicting hypercolor. The capsicum frutesense gene according to claim 1, wherein the oligonucleotide capable of detecting mutation of the gene is at least one selected from the group consisting of primers, probes, and combinations thereof specific for mutation of the gene. A composition for predicting ripeness and color of the ivory color of a circle. delete delete Capsicum frutescens ( Capsicum frutescens ) Comprising the composition for predicting the color of the ivory color of the capsicum frutesense genetic resources according to claim 1 or 2 for predicting the color of the ivory color of the genetic resources Kit. delete delete

Images