KR102173586B1 - Expression host strains for proteins display on spore surface and method for proteins display on spore surface - Google Patents

Abstract

The present invention relates to an expression host strain for displaying a target protein on a spore surface and a method for displaying a target protein on a spore surface using the same. More particularly, the present invention relates to: an expression host strain in which a target protein is displayed on a spore surface in a non-fused natural state, as a mutant strain of a spore-forming strain transformed with a promoter in a gene encoding a target protein to be displayed on the spore surface; and a method for displaying a target protein on the spore surface using the same. In addition, the present invention further provides spores in which the target protein is displayed on the surface in a non-fused natural state, and a method for producing the same.

Description

Expression host strain for the display of the spore surface of the target protein and the method of displaying the spore surface of the target protein {EXPRESSION HOST STRAINS FOR PROTEINS DISPLAY ON SPORE SURFACE AND METHOD FOR PROTEINS DISPLAY ON SPORE SURFACE}

The present invention relates to an expression host strain for displaying the spore surface of a target protein and a method for displaying the spore surface of the target protein.

Surface display technology that attaches and expresses proteins such as desired peptides and polypeptides on the surface of microorganisms can be applied to various biotechnology fields (Georgiou et al., 1993, 1997; Fischetti et al., 1993; Schreuder et al. al., 1996). Such surface display technology has been developed using various single-celled organisms such as bacteriophage, bacteria, yeast or mammalian cells as host cells.

In the surface display display technology, since the gene of the protein displayed on the surface is contained in the host organism, the host organism that is surface-expressed can be selectively selected using the properties of the surface-expressed protein, and the desired gene can be selected from the selected host organism. It is characterized by being readily available, providing a powerful means for the molecular evolution of proteins (WO 98/49286, U.S. Patent No. 5837500).

Ultra-fast screening

When the phage surface-expressed with an antibody having a desired avidity is bound to the immobilized antigen, eluted, and re-proliferated, the gene encoding the target antibody can be obtained from the phage (U.S. Patent No. 5837500). Such a panning method can provide a means for selecting a target antibody by surface-expressing a library of antibodies on phage in large quantities, and (1) preparing a library; (2) surface expression step of the library; (3) binding to the immobilized antigen; (4) eluting the bound phage; Finally, it consists of a continuous process including (5) propagating the selected clones.

The above-described phage surface display technology is advantageous in obtaining the desired monoclonal variant most rapidly from a large amount of libraries (106-1012 variants), and has become very important as it is applied to the field of ultra-high-speed screening of antibodies. Meanwhile, in order to provide a simpler and more effective method than the panning method using the above-described phage surface expression technology, a library is expressed on the surface of bacteria or yeast, and cells with the desired target protein surface-expressed quickly are purified using a flow cytometer. Separation techniques have also been developed. According to this technique, antibodies having a desired binding ability are purely isolated using a flow cytometer capable of analyzing 10(8) or more cells per hour by contacting and binding an antigen labeled with a fluorescent substance with the surface-expressed cells. Francisco et al. showed the usefulness of microbial surface expression technology by confirming that the monoclonal antibody surface-expressed by this flow cytometer can be concentrated at a ratio of 10(5) or more, and finally 79% or more of the cells are the desired cells (Daugherty et al. , 1998).

Live vaccine

The above-described surface display technology provides a means of delivering a live recombinant vaccine by displaying an antigen or a portion thereof on the cell surface. Vaccines to date have mainly used attenuated pathogenic bacteria or viruses. In particular, in the case of bacteria, antigens are secreted and expressed intracellularly, intracellularly or extracellularly, and delivered to host cells. On the other hand, the surface-displayed live vaccine is attracting attention as a new vaccine delivery method because it exhibits a very strong immune response and can continuously express antigens while proliferating in host cells. In particular, it is known that a more sustained and strong immune response is obtained when oral administration of a pathogenic antigen epitope is expressed on the surface of non-pathogenic E. coli or Salmonella bacteria in a living state (Georgiou et al., 1997; Lee et al., 2000 ).

Whole cell biotransformation

In the case of using the entire cell displayed on the surface as a biocatalyst with an enzyme that can be used in a chemical reaction, there is an advantage that there is no need for processes such as direct expression, separation and stabilization of the enzyme. In the case of expressing an enzyme used for biotransformation in cells, it is essential to cultivate the cells, recover them, and then use a chemical substance such as toluene to allow the substrate to permeate. In addition, when used continuously, there is a problem in that the enzyme is deactivated or there is a problem of material transfer of a substrate and a product, so that the productivity of the entire process is deteriorated. Meanwhile, the aforementioned problems can be eliminated by continuously displaying the enzyme on the cell surface (Jung et al, 1998a: 1998b). Phosphodiesterase decomposes the highly toxic organophosphorus parathion and paraoxon using all cells displayed on the surface. This is a typical example showing that it can be used in (Richins et al., 1997).

Anti-peptide antibody

Martineau et al. reported a very simple method of producing anti-peptide antibodies using E. coli surface display technology (Martineau et al., 1991). Looking at the contents disclosed in this document, the desired peptide was expressed at the protruding portion of the surface of MalE and the extracellular membrane protein LamB, and then whole cells or pulverized cells were administered to animals to induce the production of anti-peptide antibodies. In some cases, the antibody can be produced without chemically synthesizing the peptide or attaching it to the delivery protein.

Whole cell adsorbent

In order to immobilize an antibody or protein used for adsorption chromatography on a suitable carrier, it is necessary to produce the protein through fermentation, separate and purify it in a pure state, and then undergo immobilization on the carrier. However, in most cases, the production process of these bioadsorbents is not simple. On the other hand, adsorbed proteins were displayed on the surface of microorganisms, and the entire cell was developed as a kind of adsorbent. The most well-known whole cell adsorbent is Staphylococcus aureus, in which protein A with high affinity with the Fc domain of mammalian antibodies is naturally expressed on the surface. In addition, recently, using a microbial surface display technology, metal adsorption proteins such as metallothionein, or several histidine residues, especially six histidine peptides (6 x His), have been mass-expressed on the cell surface. A new method of removal and recovery has been published (Sousa et al., 1996, 1998; Samuelson et al., 2000). According to the above method, it is possible to remove or recover heavy metals from pollutants in a much more aggressive and effective method than the conventional method using metal adsorption microorganisms.

As described above, in order to express, attach and display a foreign protein on the surface of a cell using a surface protein of a certain organism, the fusion protein is biosynthesized by linking the appropriate surface protein and the foreign protein to each other at the gene level. It must pass through and adhere to the cell surface to be maintained.

Meanwhile, according to the conventional surface display method described above, the surface display parent is genetically manipulated to select an appropriate surface protein present on the spore surface according to the spore and insert it at the N-terminus or C-terminus or the center of the protein. need. Synthesis of a fusion protein in which all proteins expressed and displayed on the surface are linked to the surface-exhibiting parent is essential. In this case, they are essentially fused to each other at the genetic level, and as they are introduced into host cells, a genetically modified organism (GMO) is produced. As a result, the modified target protein, not the wild-type protein, is attached and displayed on the surface. Until now, surface display systems capable of surface display of a target protein using surface proteins as a surface display matrix include phage surface display systems (Chiswell and McCarferty, 1992), and bacterial surface display systems (Georgiou et al., 1993; Little et al. al., 1993; Georgiou et al., 1997), Gram-negative bacteria surface display system (Francisco et al., 1992; Fuchs et al., 1991; Klauser et al., 1990, 1992; Hedegaard et al., 1989) ), Gram-positive bacteria surface display system (Samuelson et al., 1995; Palva et al., 1994; Sleytr and Sara, 1997), yeast surface display system (Ferguson, 1988; Schreuder et al., 1996), etc. It is known.

On the other hand, there was an attempt to display the target protein by fusion with the microbial spore surface coat protein to expose the target protein on the surface of the spore. As an example of the spore surface display, U.S. Patent No. 5766914 discloses a method for separating and purifying an enzyme carried out by fusing the reporter enzyme LacZ with CotC, an outer coat protein of Bacillus subtilis, or CotD, an endothelial coat protein. In addition, U.S. Patent No. 5837500 and U.S. Patent No. 5800821 also describe that CotC or CotD is suitable as a surface display matrix, but no experimental proof was shown.

In addition, the surface display system of Gram-negative bacteria brought structural limitations when foreign polypeptides were inserted, and thus could not form stable membrane proteins (Charbit et al., J. Immunol, 139:1644-1658 (1987); Agterberg et al. ., Gene, 88:37-45 (1990)), the stability and viability of the extracellular membrane of the host cell were decreased. In the case of E. coli hosts, where surface display technology has been studied the most, most of the extracellular membrane proteins have been developed as surface-expressing mothers.If the extracellular membrane protein is fused with foreign proteins and overexpressed, the extracellular membrane becomes structurally unstable and consequently the viability of the host cell. There is a disadvantage of this drop (Georgiou et al., Protein Eng. 9:239-247 (1996)).

The problem of the above-described conventional surface display system is to make a fusion protein with a surface display parent for surface display of a target protein. While this must be fused with foreign genes, the efficiency of reactions such as whole cell biotransformation, protein array and antibody production, etc., is deteriorated when the expression level of the fusion protein is small, and when overexpressed, there are problems as described above. Also, the surface expression of the target protein through the surface-exhibiting parent and the fusion protein depends on the degree to which the surface-exhibiting parent, which is the fusion partner of the target protein, is inserted into the surface of cells, spores, or phages, so the amount displayed on the surface is limited. .

As described above, the conventional surface display technology is based on the fact that the target protein constitutes the surface display parent and the fusion protein. Therefore, in the case of the conventional surface display system, (1) the parental gene sequence for surface display must be known, (2) the parental gene must be cloned for surface display, and (3) surface display in which the tertiary structure of the target protein is fused. It may be affected by the parent body, and (4) if the target protein is active only when it forms a multimer, the target protein loses its activity when the fusion protein is independently displayed on the surface, and (5) the surface display of the target protein is The amount of surface-displayed is limited because it depends on the degree to which the host cell is inserted into the surface of the host cell.(6) In the case of excessively displaying protein on the surface, structural problems occur on the surface of the host cell, and finally There is a problem in that the viability of the host cell or resistance to the environment is greatly reduced.

Therefore, in order to solve the problems of the conventional surface display technology described above, there is no need to make a fusion protein between the target protein and the surface display parent, and a new surface display system capable of surface display of the target protein in a more convenient manner is required. . In particular, there is a need for a mutant strain that enables higher surface display by improving the expression host.

Agterberg, M., Adriaanse, H. and Tommassen, J. Use of the outer membrane protein PhoE as a carrier for the transport of a foreign antigenic determinant to the cell surface of Escherichia coli K-12. Gene 59:145-150 (1987) Agterberg, M., Adriaanse, H., van Bruggen, A., Karperien, M. and Tommassen, J. Outer membrane PhoE protein of Escherichia coli K-12 as an exposure vector: possibilities and limitations. Gene 88:37-45 (1990) Arnold, F.H. and Volkov, A.A. Directed evolution of biocatalysis. Curr. Opin. Chem. Biol. 3:54-59 (1999). Charbit, A., Molla, A., Saurin, W. and Hofnung, M. Versatility of a vector for expressing foreign polypeptides at the surface of Gram-negative bacteria. Gene 70:181-189 (1988) Charbit, A., Sobczak, E., Michel, M.-L., Molla, A., Tiollais, P. and Hofnung, M. Presentation of two epitopes of the preS2 region of hepatitis B virus on live recombinant bacteria. J. Immunol 139:1644-1658 (1987) Chiswell, D.J. and McCafferty, J. Phage antibodies: will new'coliclonal' antibodies replace monoclonal antibodies. TIBTECH 10:80-84(1992) Daugherty, P.S., Chen G., Olsen, M.J., Iverson, b.L., Georgiou, G. Antibody affinity maturation using bacterial surface display. Protein Eng. 11:825-832 (1998). d'Enfert, C., Ryter, A. and Pugsley, A.P. Cloning and expression in Escherichia coli of the Klebsiella pneumoniae genes for the production, cell surface localization and secretion of the lipoprotein pullulanse. EMBO J. 6:3531-3538 (1987). Driks, A. Bacillus subtilis spore coat. Microbiol. Mol. Biol. Rev. 63(1):1-20 (1999) Ferguson, M.A.J. and Williams, A.F. Cell-surface anchoring of proteins via glycosyl-phosphatidylinositol structures. Ann. Rev. Biochem. 57:285-320 (1988). Fischetti, V.A., Medaglini, D., Oggioni, M. and Pozzi, G. Expression of foreign proteins on Gram-positive commensal bacteria for mucosal vaccine delivery. Curr. Opin. Biotechnol. 4:603-610 (1993). Francisco, J.A., Earhart, C.F. and Georgiou, G. Transport and anchoring of b-lactamase to the external surface of Eshcherichia coli. Proc. Natl. Acad. Sci. USA 89:2713-2717 (1992). Freeman, A., Abramov, S., and Georgiou G. Site-protected fixation and immobilization of Escherichia coli cells displaying surface-anchored beta-lactamase. Biotechnol. Bioeng. 62(2):155-159 (1999). Fuchs, P., Breitling, F., Dubel, S., Seehaus, T. and Little, M. Targeting recombinant antibodies to the surface of Escherichia coli: fusion to a peptidoglycan associated lipoprotein. Bio/Technology 9:1369-1372 (1991) Georgiou, G. Analysis of large libraries of protein mutants using flow cytometry. Adv. Protein Chem. 55:293-315 (2000). Georgiou, G., Poetschke, H.L., Stathopoulos, C. and Francisco, J.A. Practical applications of engineering Gram-negative bacterial cell surfaces. TIBTECH 11:6-10 (1993). Georgiou, G., Stathopoulos, C., Daugherty, P.S., Nayak, A.R., Iverson, B.L. and Curtiss III, R. Display of heterologous proteins on the surface of microorganisms: From the screening of combinatorial libraries to live recombinant vaccines. Nature Biotechnology 15:29-34 (1997). Georgiou, G., Stephens D., Stathopoulos, C., Poetschke H.L., Mendenhall J. and Earhart C.F. Display of β-lactamase on the Escherichia coli surface: outer membrane phenotypes conferred by Lpp'-OmpA'-β-lactamase fusions. Protein Eng. 9:239-247 (1996). Hedegaard, L. and Klemm, P. Type 1 fimbriae of Escherichia coli as carriers of heterologous antigenic sequences. Gene 85:115-124 (1989). Jung, H.C., Lebeault, J.M. and Pan, J.G. Surface display of Zymomonas mobilis levansucrase by using the ice-nucleation protein of Pseudomonas syringae. Nature Biotechnol. 16:576-580 (1998a). Jung, H.C., Park, J.H., Park, S.H., Lebeault, J.M. and Pan, J.G. Expression of carboxymethylcellulase on the surface of Escherichia coli using Pseudomonas syringae ice-nucleation protein. Enzyme Microb. Technol. 16:576-580 (1998b). Kim, E.J. and Yoo, S.K. Cell surface display of CD8 ecto domain on Escherichia coli using ice-nucleation protein. Biotechnol. Tech. 12:197-201 (1998). Kim, E.J. and Yoo, S.K. Cell surface display of hepatitis B virus surface antigen on Escherichia coli using Pseudomonas syringae ice-nucleation protein. Lett. Appl. Microbiol. 29:292-297 (1999). Kim, Y.S., Jung, H.C. and Pan, J.G. Bacterial cell surface display of an enzyme library for selective screening of improved cellulase variants. Appl. Environ. Microbiol. 66:788-793 (2000). Kwak, Y.D., Kim, E.J. and Yoo, S.K. Cell surface display of human immunodeficiency virus type I gp120 on Escherichia coli by using ice-nucleation protein. Clinic. Diag. Lab. Immun. 6:499-503 (1999). Klauser, T., Kramer, J., Otzelberger, K., Pohlner, J. and Meyer, T.F. Characterization of the Neisseria Iga -core: The Essential unit for outer membrane targeting and extracellular protein secretion. J. Mol. Biol. 234:579-593 (1993). Klauser, T., Pohlner, J. and Meyer, T.F. Extracellular transport of cholera toxin B subunit using Neisseria IgA protease -domain: conformation-dependent outer membrane translocation. EMBO J. 9: 1991-19 99 (1990). Kornacker, M.G. and Pugsley, A.P. The normally periplasmic enzyme -lactamase is specifically and efficiently trnaslocated through the Escherichia coli outer membrane when it is fused to the cell-surface enzyme pullulase. Mol. Microbiol. 4(7):1101-1109 (1990). Lee, J.S., Shin, K.S., Pan, J.G. and Kim, C.J. Nature Biotechnol. 18:645-648 (2000). Lewis P.J. and Errington J. Use of green fluorescent protein for detection of cell specific gene expression and subcellular protein localization during sporulation in Bacillus subtilis. Microbiology 142:733-740 (1996). Little, M., Fuchs, P., Breitling, F. and Dubel, S. Bacterial surface presentation of proteins and peptides: an alternative to phage display technology, TIBTECH 11:3-5 (1993). Martineau, P., Charbit, A., Leclerc, C., Werts, C., O'Callaghan, D. and Hofnung, M. A genetic system to elicit and monitor antipeptide antibodies without peptide synthesis. Bio/Technology 9: 170-172 (1991). Newton, S.M., Jacob, C.O. and Stocker, B.A.D. Immune response to cholera toxin epitope inserted in Salmonella flagellin. Science 244:70-72 (1989). Ochs, M., Angerer, A., Enz, S. and Braun, V. Surface signaling in transcriptional regulation of the ferric citrate transport system of Escherichia coli: mutational analysis of the alternative sigma factor FecI supports its essential role in fec transport gene transcription. Mol. Gen. Genet. 250:455-465 (1996). Palva, A.M. and Palva, I.A. Lactobacillus expression system using surface protein gene sequences, WO94/00581 (1994). Richins, R.D., Kaneva, I., Mulchandani, A., and Chen, W. Biodegradation of organophosphorus pesticides by surface-displayed organophosphorus hydrolase. Nature Biotechnol. 15:984-987 (1997). Samuelson, P., Hansson, M., Ahlborg, N., Androoni, C., Gotz, F., Bachi, T., Nguyen, TN, Binz, H., Ulhen, M. and Stahl, S. Cell surface display of recombinant proteins on Stapholococcus carnosus. J. Bacteriol. 177(6):1470-1476 (1995). Samuelson, P., Wernerus, H., Svedberg, M. and Stahl S. Staphylococcal surface display of metal-binding polyhistidyl peptides. Appl. Envir. Microbiol. 66: 1243-1248 (2000). Schreuder, M.P., Mooren, A.T.A., Toschka, H.Y., Theo Verrips, C. and Klis, F.M. Immobilizing on the surface of yeast cells. TIBTECH 14:115-120 (1996). Schulz, G.E. Bacterial porins: structure and function. Curr. Opin. Cell Biol. 5:701-707 (1993). Sleytr, U.B. and Sara, M. Bacterial and archaeal S-layer protein: structure-function relationships and their biotechnological applications. TIBTECH 15:1-9 (1997). Stathopoulos, C., Georgiou G., and Earhart C.F. Characterization of Escherichia coli expressing an Lpp'OmpA(46-159)-PhoA fusion protein localized in the outer membrane. Appl. Microbiol. Biotechnol. 45(1-2):112-119 (1996). Sousa, C., Cebolla, A., and de Lorenzo, V. Enhanced metal loads orption of bacterial cells displaying poly-His peptides. Nature Biotechnol. 14:1017-1020 (1996). Sousa, C., Kotrba, P., Ruml, T. Cebolla, A., and de Lorenzo, V. Metalloadsorption by Escherichia coli displaying yeast and mammalian metallothioneins anchored to the outer membrane protein LamB. J. Bacteriol. 180:2280-2284 (1998). Taylor, I.M., Harrison, J.L., Timmis, K.N. and O'Conor, C.D. The TraT lipoprotein as a vehicule for the transport of foreign antigenic determinants to the cell surface of Escherichia coli K12: structure-function relationships in the TraT protein. Mol. Microbiol. 4(8):1259-1268(1990). Webb, C.D., Decatur A., Teleman A. and Losick R. Use of green fluorescent protein for ivsualization of cell specific gene expression and subcellular protein localization during sporulation in Bacillus subtilis J. Bacteriol. 177:5906-5911 (1995). Zheng L and Losick R., Cascade regulation of spore coat gene expression in Bacillus subtilis J. Mol. Biol. 212: 645-660 (1990). Park, S.H., Koo, B.T., Shin, B.S., Choi, S.K., Jeong, Y.M., Pan, J.G. Kim, J.I., 1997. Characterization of 1,925 Bacillus thuringiensis isolates from plants in Korea. Kor. J. Appl. Microbiol. Biotechnol. 25,159-165. Dunn, A. K. & J. Handelsman, (1999) A vector for promoter trapping in Bacillus cereus. Gene 226: 297-305.

The present invention is to solve the above-described problems, by applying systematic mutations to a strong expression system and an expression host strain, to increase the expression amount of the target protein in the host, and to display the target protein on the spore surface without making a fusion protein in its natural state. And, to provide an expression host strain that can improve the display efficiency.

The present invention is to provide a spore in which a protein of interest obtained from the expression host strain according to the present invention is displayed on the surface in a non-fused natural state.

The present invention is to provide a method for producing an expression host strain according to the present invention.

The present invention improves the expression amount of the target protein, and the amount of the target protein exhibited on the spore surface in a non-fused natural state can also be increased, using the expression host strain according to the present invention, the spore surface of the target protein It is about how to display.

The present invention relates to a method for producing spores in which a target protein is displayed on the surface in a non-fused natural state, using the expression host strain according to the present invention.

However, the problems to be solved by the present invention are not limited to those mentioned above, and other problems that are not mentioned will be clearly understood by those skilled in the art from the following description.

According to an embodiment of the present invention, it is a mutant strain of a spore-forming strain transformed with a promoter in a gene encoding a target protein to be displayed on the spore surface, and the target protein is displayed on the spore surface in a non-fusion natural state. It relates to an expression host strain.

According to an embodiment of the present invention, the mutant strain of the spore-forming strain is derived from a Bacillus subtilis microorganism, and the mutant strain of the spore-forming strain, fmnP, yoqZ, secD, ndoA, yqfZ, tig, yvzC, It may be a mutant strain including at least one or more selected from the group consisting of copB, gltT yqeK and lrpC genes.

According to an embodiment of the present invention, the promoter is a cry promoter of an insecticidal crystal protein, lac promoter, ara promoter, tet promoter, trp promoter, λ promoter, λPR promoter, T7 promoter, tac promoter, PT5 Promoter, trc promoter, lacUV5 promoter, lpp promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, and may include at least one selected from the group consisting of another Bacillus sporulation promoter.

According to an embodiment of the present invention, the target protein is an enzyme, an enzyme inhibitor, a hormone, a hormone analogue, a hormone receptor, a signaling protein, an antibody, a monoclonal antibody, an antigen, an adhesion protein, a structural protein, a regulatory protein, a toxin protein. , Cytokines, transcriptional regulatory factors, blood coagulation factors, and plant biodefensive induction proteins may include at least one selected from the group consisting of.

According to an embodiment of the present invention, the target protein may include a monomeric protein, a multimeric protein, or both.

According to an embodiment of the present invention, a target protein obtained from the expression host strain according to the present invention is displayed on the surface in a non-fused natural state, and relates to a spore.

According to an embodiment of the present invention, the target protein may be non-covalently attached to the spore surface.

According to an embodiment of the present invention, selecting a mutant strain of the spore-forming strain; And constructing a vector including a promoter in the gene encoding the protein of interest to be displayed on the spore surface of the mutant strain. And transforming the mutant strain with the vector. Including, and the protein of interest is displayed on the surface of the spore in a non-fused natural state, relates to a method for producing an expression host strain.

According to an embodiment of the present invention, obtaining an expression host strain; Culturing the expression host strain to express the target protein in the expression host strain; And displaying the expressed target protein on the surface of the spores of the expression host strain. Including, wherein the expression host strain is a mutant strain of a spore-forming strain transformed with a promoter in a gene encoding a protein of interest to be displayed on the spore surface, and the protein of interest is in a non-fusion natural state on the spore surface. It relates to a method for displaying the surface of spores of a target protein that is displayed on display.

According to an embodiment of the present invention, the step of obtaining the expression host strain comprises: selecting a mutant strain of the spore-forming strain; And constructing a vector including a promoter in the gene encoding the protein of interest to be displayed on the spore surface of the mutant strain. And transforming the mutant strain with the vector. It may be to include.

According to an embodiment of the present invention, adsorbing the target protein-containing liquid to the spores that have already exhibited the target protein with a liquid containing a target protein secreted or exposed to the outside during the sporulation during, after or both during the steps displayed on the spore surface; It may be to further include.

According to an embodiment of the present invention, the mutant strain of the spore-forming strain is derived from a Bacillus subtilis microorganism, and the mutant strain of the spore-forming strain, fmnP, yoqZ, secD, ndoA, yqfZ, tig, yvzC, It may be a mutant strain including at least one selected from the group consisting of copB, gltT yqeK and lrpC genes.

According to an embodiment of the present invention, the promoter is a cry promoter of an insecticidal crystal protein, lac promoter, ara promoter, tet promoter, trp promoter, λ promoter, λPR promoter, T7 promoter, tac promoter, PT5 Promoter, trc promoter, lacUV5 promoter, lpp promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, and may include at least one selected from the group consisting of another Bacillus sporulation promoter.

According to an embodiment of the present invention, the target protein is an enzyme, an enzyme inhibitor, a hormone, a hormone analogue, a hormone receptor, a signaling protein, an antibody, a monoclonal antibody, an antigen, an adhesion protein, a structural protein, a regulatory protein, a toxin protein. , Cytokines, transcriptional regulatory factors, blood coagulation factors, and plant biodefensive induction proteins may include at least one selected from the group consisting of.

According to an embodiment of the present invention, obtaining an expression host strain; Culturing the expression host strain to express the target protein in the expression host strain; Displaying the expressed target protein on the spore surface of the expression host strain; And separating spores on which the target protein is surface-displayed from the expression host strain; including, wherein the expression host strain is a spore transformed with a promoter in a gene encoding the target protein to be displayed on the spore surface- It relates to a method for producing spores in which the target protein is displayed on the surface in a non-fused natural state, which is a mutant strain of the forming strain.

The present invention applies a novel mutant host transformed with a powerful expression system of a target protein, increases the display efficiency of the non-fusion spore surface display method, and displays display on the spore surface by non-fusion of the natural state of the target protein. It is possible to provide an expression host strain and a method of displaying the spore surface of a target protein using the same, which can improve the process.

In the present invention, if the amount of expression of the target protein to be displayed in the spore-forming microorganism is increased, the amount of the target protein to be displayed on the surface of the non-fused spore can also be increased, thereby improving display-display efficiency.

In the present invention, through a relatively simple process, a larger amount of spores on which a target protein is displayed can be obtained, and the application range of the spores can be expanded.

FIG. 1 shows the analysis results of Bacillus subtilis 168 strain and pD5D GFP-expressing spores (blue) in an example of the present invention through a flow cytometer according to an embodiment of the present invention.
2 shows a region selected by FACSorting of pD5D gfp Tn-library spore in an embodiment of the present invention, according to an embodiment of the present invention.
3 is, according to an embodiment of the present invention, fluorescent plates and micrographs (A, pD5D_gfp control; B, Tn 16; C, Tn 30; D, of three mutant strains selected from the library in the example of the present invention) Tn 53).
4 shows the results of FACSorting of a library spore in which the Tn mutation was introduced again to the ΔyqeK-deficient mutant in the example of the present invention, according to an embodiment of the present invention.
5 is, according to an embodiment of the present invention, the fluorescence intensity ( B.subtilis 168 (black), pD5D-gfp (blue), ΔyqeK (green)) of the double mutant strain selected in the second Tn mutation round in the example of the present invention ), ΔyqeKΔlrpC (red)).
6 is a result of comparing the fluorescence intensity of the cotH mutant strain and the yqeK mutant strain through a flow cytometer according to an embodiment of the present invention ( B.subtilis 168 (black), pD5D-gfp (blue), ΔyqeK (green), ΔcotH (red)).

Hereinafter, exemplary embodiments of the present invention will be described in detail with reference to the accompanying drawings. In describing the present invention, if it is determined that a detailed description of a related known function or configuration may unnecessarily obscure the subject matter of the present invention, a detailed description thereof will be omitted. In addition, terms used in the present specification are terms used to properly express a preferred embodiment of the present invention, which may vary depending on the intention of users or operators, or customs in the field to which the present invention belongs. Accordingly, definitions of these terms should be made based on the contents throughout the present specification. The same reference numerals in each drawing indicate the same members.

Throughout the specification, when a member is said to be positioned "on" another member, this includes not only the case where a member is in contact with another member, but also the case where another member exists between the two members.

Throughout the specification, when a part "includes" a certain component, it means that other components may be further included rather than excluding other components.

Throughout the specification, a number of patent documents and papers are referenced, and citations thereof are indicated in parentheses. The disclosure contents of the cited patent documents and thesis are incorporated by reference in this specification as a whole, so that the level of the technical field to which the present invention belongs and the present invention are more clearly described.

Hereinafter, the expression host strain of the present invention, the method of displaying the spore surface of the target protein, and the use thereof will be described in detail with reference to Examples and drawings. However, the present invention is not limited to these examples and drawings.

The present invention relates to an expression host strain, and according to an embodiment of the present invention, the expression host strain displays a target protein on the spore surface in a non-fusion natural state, and is a powerful expression system for the target protein. It is a transformed mutant host. The expression host strain, by using a new mutant host with a strong expression system of the target protein, high expression of the target protein in the host, and the expression of the expressed target protein on the spore surface can be achieved well.

As an example of the present invention, the expression host strain may provide spores that satisfy at least one or more of the following characteristics in order to be applied to a method for displaying a spore surface of a target protein. (1) very stable against heat; (2) relatively stable against radiation; (3) stable against toxicity; (4) very stable against acids and bases; (5) stable to lysozyme; (6) resistant to drying; (7) Stable to organic solvents; (8) no metabolic activity; And (9) can easily form spores within hours ((Driks, 1999).

In one example of the present invention, the expression host strain includes a mutant strain of a spore-forming strain, and is a mutant strain derived from a Bacillus subtilis microorganism. In the mutant strain of the spore-forming strain, the interaction between the target protein and the spore is, in principle, through a non-covalent bond, that is, one of a hydrophobic bond, an ionic bond, a hydrogen bond, and a van der Waals bond, or a complex bond thereof. The surface of the spores of the protein of interest expressed in the cell can be displayed.

As an example of the present invention, the mutant strain of the spore-forming strain may have a surface protein of the spore modified in order to increase non-covalent binding with the target protein. For example, the method of modifying the spores includes (i) a method of fusing other oligopeptides or polypeptides that help non-covalent bonding between the spore and the protein of interest with the surface protein of the spore; (Ii) a method of site-specific mutating a spore surface protein; (Iii) including, but not limited to, a method of randomly mutating a spore surface protein.

As an example of the present invention, the mutant strain of the spore-forming strain may be modified so as not to produce an intracellular proteolytic enzyme or an extracellular protease related to the degradation of a protein of interest expressed for surface display.

As an example of the present invention, the mutant strain of the spore-forming strain, genetic method (Popham DL, et al., J. Bacteriol., 181: 6205-6209 (1999)), chemical method (Setlow TR, et al. , J. Appl. Microbiol., 89: 330-338 (2000)) and physical methods (Munakata N, et al., Photochem. Photobiol., 54: 761-768 (1991)) at least one selected from the group consisting of It is possible to provide spores that have been modified to make reproduction impossible by the method of This is because spores do not need to be regenerated when spores are used as a simple display means of a target protein as in the present invention. In particular, if it is treated as a genetically engineered organism, it is appropriate to use a mutant that cannot be reproduced because it may be subject to use restrictions. The genetic method for disabling spore reproduction may be implemented through a deficiency of a gene involved in spore reproduction of a host cell. For example, in Bacillus subtilis, a non-renewable mutant strain lacking the cwlD gene can be used in the present invention.

As an example of the present invention, the mutant strain of the spore-forming strain is a mutant strain comprising at least one or more selected from the group consisting of fmnP, yoqZ, secD, ndoA, yqfZ, tig, yvzC, copB, gltT yqeK and lrpC genes. , More preferably, it is a mutant strain containing the yqeK or lrpC gene.

As an example of the present invention, in the mutant strain of the spore-forming strain, the spores are subjected to a physical method (Wienc KM, et al., Appl. Environ. Microbiol., 56: 2600-2605 (1990)), a chemical method, and a genetic method. It can be modified to increase cohesiveness by at least one method selected from the group consisting of. The reason for increasing the cohesiveness is that the reaction products and spores are easily separated during bioconversion reactions on an industrial scale.

According to an embodiment of the present invention, the strong expression system of the target protein is to use a strong promoter (hereinafter, a strong promoter) for the expression of the target protein, for example, the strong expression system, the spore surface It is introduced by transforming a mutant strain of a spore-forming strain with a vector containing the strong promoter in the gene encoding the protein of interest to be displayed on the display. Accordingly, the expression level of the target protein in the cells of the spore-forming strain is increased, and a larger amount of the target protein is displayed on the surface of the spores in the cell.

As an example of the present invention, the gene encoding the protein of interest used in the transformation may be one, repeated two or more times, or the same or different genes of the target protein repeated two or more times, and the like. Any combination can be used. In addition, the gene encoding the target protein used for transformation may be present in the cells of the mutant strain of the spore-forming strain independently or intercalated into the chromosome of the mutant strain of the spore-forming strain.

As an example of the present invention, the strong promoter refers to a promoter that expresses a protein at least to the same extent as an endogenous protein, and preferably refers to a promoter that expresses a protein at least twice or more than an endogenous protein.

As an example of the present invention, the strong promoter may include various strong promoters known in the technical field of the present invention. For example, the strong promoter is an insecticidal crystal protein promoter, a lac promoter, ara promoter, tet promoter, trp promoter, λPL promoter, λPR promoter, T7 promoter, tac promoter, PT5 promoter, trc promoter, lacUV5 promoter, lpp promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter and Bacillus sporulation promoter It may include at least one selected from the group consisting of. It is preferably a promoter of an insecticidal crystal protein.

As an example of the present invention, the strong promoter may include a cry promoter of promoters of all insecticidal crystal proteins known in the art. For example, the promoter of the insecticidal crystal protein is from cry1 group to cry59 group. It may include at least one selected from the group consisting of a cry gene group including a promoter of a cyt gene group including a cyt1Aa group to a cyt2Ca group, but is not limited thereto. More preferably, a promoter of cry3Aa, cry3Ba, cry3Bb or cry3Ca may be included.

According to an embodiment of the present invention, the target protein may be applied without limitation as long as it is applicable to the display display process of the spore surface in the technical field of the present invention. The target protein includes any protein or peptide, for example, a hormone, a hormone analogue, an enzyme, an enzyme inhibitor, a signaling protein or a portion thereof, an antibody or a portion thereof, a single chain antibody, a binding protein or a binding domain thereof, a peptide, Antigens, adhesion proteins, structural proteins, regulatory proteins, toxin proteins, cytokines, transcriptional regulatory factors, blood coagulation factors, plant bio-defense inducing proteins, or those including a part thereof, and the like, but are not limited thereto.

As an example of the present invention, in the case of using the spore surface display display process using the expression host strain, monomeric and multimeric (including homo-multimer and hetero-multimer) target proteins may be displayed on the spore surface. In the case of the multimer, it is common to exhibit complete activity only when all monomers constituting the multimer are combined. In the conventional surface display method, since the monomers are independently surface-displayed, it is difficult to obtain a target protein exhibiting activity. However, in the case of performing the spore surface display display process using the expression host strain according to the present invention, the multimeric protein may be displayed on the surface of the spore while forming a complete structure.

As an example of the present invention, the target protein may be modified to increase display efficiency on the spore surface and improve non-covalent bonding with spores. That is, the target protein is, (i) a method of removing a part of the amino acid sequence of the target protein; (Ii) a method of fusing a target protein or another oligopeptide or polypeptide that helps non-covalent bonding between a target protein from which a part of the amino acid sequence has been removed by the method of (i) above and a spore surface protein; (Iii) a method of site-specific mutating a protein of interest; (Iv) It can be improved by using a method of random mutation of the target protein, but is not limited thereto. For example, the method of removing a part of the amino acid sequence of the target protein may be carried out, for example, by removing the ionic amino acid sequence of the N-terminus of the target protein, such as a signal peptide, and the modified target protein is hydrophobic with spores. The interaction is enhanced and can be displayed on the surface with a lower dissociation constant. In addition, since the surface of spores is known to have anions, fusing a cationic oligopeptide to a protein of interest may be advantageous for the surface display of the protein of interest.

The present invention relates to spores in which a protein of interest is surface-displayed, and according to an embodiment of the present invention, the spores on which the target protein is surface-displayed are obtained from the expression host strain according to the present invention, and the target protein is The surface display may be exhibited in a non-fused natural state. The target protein and spores are as mentioned in the description of the expression host strain, and the surface display process will be described in more detail below. That is, spores on which the target protein is displayed on the surface may be generated based on the non-covalent bonding and adsorption of the spore surface and the target protein. More specifically, a host cell is transformed with a vector having a sequence encoding the target protein, and then the target protein is expressed intracellularly at or before the spore is formed in the cell, and finally formed in the cell. The surface of the spore and the protein of interest are naturally bound and displayed in a non-covalent way.

In the finally obtained complex of protein of interest-spore, the target protein is displayed on the surface in a non-fusion natural state, and drugs, vaccines (eg, live vaccines), sensors, biocatalysts (eg, for biotransformation) It can be applied to various fields such as biocatalysts, anti-peptide antibodies, adsorbents (eg, whole cell adsorbents).

The present invention relates to a method for preparing an expression host strain according to the present invention, and according to an embodiment of the present invention, the preparation method can form a new mutant host transformed with a strong expression system, which is an object It is possible to provide an expression host strain capable of displaying and displaying the protein on the spore surface in a non-fusion natural state, and improving the intracellular expression level of the target protein and the display efficiency on the spore surface.

According to an embodiment of the present invention, the manufacturing method includes the steps of selecting a mutant strain of a spore-forming strain; And constructing a vector including a promoter in a gene encoding a protein of interest to be displayed on the spore surface of the mutant strain. And it may include the step of transforming the mutant strain with a vector. The mutant strain of the spore-forming strain, as mentioned in the description of the expression host strain according to the present invention, may be a mutant strain containing a specific gene by modifying the surface protein to increase non-covalent binding with the target protein. Genes and promoters encoding the target protein are as mentioned in the description of the expression host strain according to the present invention.

The present invention relates to a method for displaying a spore surface of a protein of interest, and according to an embodiment of the present invention, the method comprises: applying the expression host strain according to the present invention, obtaining an expression host strain; Culturing the expression host strain to express the target protein in the expression host strain; And displaying the expressed target protein on the spore surface of the expression host strain.

In the method of displaying the spore surface of the target protein, the host cell is transformed with a vector having a sequence encoding the target protein, and then the target protein is expressed intracellularly at or before the spore is formed in the cell. As a result, the surface of the spore formed in the cell and the target protein can be naturally bound and displayed in a non-covalent way. In addition, the spore surface display method of the target protein does not require a surface display matrix for surface display, which was necessary for conventional protein surface display, so proteins that are difficult to pass through cell membranes can be biosynthesized within the host cell. It is bonded to the surface and exposed to the surface. This can be effectively applied to the spore surface display of the target protein which is limited to the existing spore surface display, which is hardly achieved, or which has a low display efficiency or intracellular expression level. Finally, when the host cell is degraded and the spores are exposed from the host cell, spores with a target protein attached to the surface in a non-fusion natural state can be obtained.

As an example of the present invention, the step of obtaining the expression host strain proceeds in the same manner as the method for preparing the expression host strain according to the present invention.

In an example of the present invention, the step of expressing in the expression host strain is a step of intracellular expression of the target protein at or before the time when spores are formed in the cell, and transformation with the strong fmomotor vector according to the present invention It is possible to increase the amount of expression of the target protein in the expressed host strain.

As an example of the present invention, the step displayed on the spore surface is a step in which the surface of the spore formed in the cell during the culture process and the expressed target protein are naturally bound by a non-covalent method and displayed on the spore surface. The non-covalent bond may be formed through one of a hydrophobic bond, an ionic bond, a hydrogen bond, and a van der Waals bond, or a complex bond thereof.

In another example of the present invention, the surface display through non-covalent bonding between the target protein and the spore in the step of displaying on the spore surface is the basis, but when more stable bonding is desired, the target protein is displayed on the spore surface through non-covalent bonding. Then, the bond between the target protein and the spore or the bond between the target protein may be changed into a covalent bond by at least one method selected from the group consisting of a physical method, a chemical method, and a biochemical method. Among the methods of treatment to form the covalent bonds, the chemical method is treatment with glutaraldehyde (DeSantis G. and Jones JB Curr. Opin. Biotechnol. 10: 324-330 (1999)), and the physical method is treatment with ultraviolet light (Graham). L., and Gallop PM Anal.Biochem. 217: 298-305 (1994)) and biochemical methods are treatment of enzymes that help form covalent bonds (Gao Y., and Mehta K., J. Biochem. 129: 179-183 (2001)) may be used, but the present invention is not limited thereto.

As an example of the present invention, the step of expressing in the expression host strain and the step of being displayed on the spore surface includes culturing the expression host strain continuously for expression and surface display, and adjusting the total culture time so that the target protein is The culture can be stopped at the point where it is optimally displayed. For example, the culture of the expression host strain is cultured until the late sporulation stage, and the optimum culture time may be determined according to the type of strain used. For example, when Bacillus subtilis is used as a host, it can be cultured for 16-25 hours.

In another example of the present invention, adsorbing the target protein-containing liquid to the spores already exhibiting the target protein with a liquid containing the target protein secreted or exposed to the outside during the sporulation during, after or both of the steps displayed on the spore surface; It may further include. This is to increase the amount of target protein displayed on the surface.

The present invention relates to a method for producing spores in which a target protein is displayed on the surface, and according to an embodiment of the present invention, the production method includes a target protein on the spore surface by the surface display method of the target protein. By separating the spores from the expression host strain after display display, the expression host strain and spores are easily separated, and a larger amount of the target protein can be obtained through a relatively simple process.

According to an embodiment of the present invention, the manufacturing method comprises the steps of obtaining an expression host strain; Culturing the expression host strain to express the target protein in the expression host strain; Displaying the expressed target protein on the spore surface of the expression host strain; And separating spores on which the target protein is surface-displayed from the expression host strain. It may include.

As an example of the present invention, the steps of obtaining, expressing, and surface-displaying the expression host strain are as mentioned in the method for surface display and display of the target protein.

In an example of the present invention, the step of obtaining spores on which the target protein is surface-displayed is a step of separating and recovering spores from the expression host strain. Such spores can be recovered by controlling the culture time of the expressing host strain by stopping the culture at the time when the target protein is optimally displayed on the spore surface.

In other words, the cultivation of spore-forming microorganisms is to cultivate until the late sporulation stage. The specific optimal culture time is determined according to the type of strain used, for example, in the case of using Bacillus subtilis as a host, it is preferable to culture for 16-25 hours. Recovery of spores may be carried out by a conventional method, but more preferably, the renografin gradients method (CR Harwood, et al., "Molecular Biological Methods for Bacillus." John Wiley & Sons, New York, p.416 (1990)) can be used.

The spores on which the finally obtained target protein is displayed on the surface in a non-fused natural state can be applied to various products and processes as a target protein-spore complex, and the target protein can be separated from the complex to use the pure target protein for production. have. The separation of the target protein may be performed by a method used in the technical field of the present invention, and is not specifically mentioned in the present specification.

Example 1: Spore surface display of GFP according to the Bacillus mutant strain

Plasmids pAD3aA and pA82 with cry3Aa promoter (Guangjun Wang et al., Applied Microbiology and Biotechnology, 72(5):924-930(2006)) respectively contain the gfpmut3a gene (Valdivia), which is a promoter-free gene of green fluorescent protien (GFP). , RH et al., Science, 277:2007-2011 (1977)) was cloned. Promoter cry3Aa uses the primers cry3Aa-F2 (tttgaattctcagcagtagaagttttgacc) and cry3Aa-R1 (tttggatcctttcagtagtttttattgtatc), and the promoter P82 is cry3Aa-F8 (agaattcgtgcttttttttttgacattgaagaattattaatgccatatgagattagattagattacactg, ttttttttgacattgaagatac (Css) et al. 1997. Kor. J. Appl. Microbiol. Biotechnol. 25: 159-165) was obtained using PCR. The obtained promoters were digested with EcoRI and BamHI, and then inserted into the same restriction enzyme site of the plasmid pAD123 (Bacillus Genetic Stock Center) (Dunn AK and Handelsman J. 1999. Gene 226:297-305) with the gfpmut3a gene and inserted into the same restriction enzyme site as the plasmid pAD3Aa. pA82 was prepared (Figs. 3a and 3b).

Subsequently, the pAD3aA or pA82 was used in Bacillus subtilis 168 strain (Kunst F., et al., Nature, 390:249-256 (1997)) and Bacillus thuringiensis 4Q7 (Bacillus Genetic Stock Center, Ohio, USA). Acquired) was transformed with a natural introduction method (CR Harwood, et al., Molecular Biological Methods for Bacillus, John Wiley & Sons, New York, p. 67 (1990)). Subsequently, Bacillus strain and wild-type strain transformed with plasmids pAD3Aa and pA82 were respectively used in DSM medium (Harwood CR and Cutting SM. 1990. Molecular Biological Methods for Bacillus. John Wiley & Sons Ltd. p549.) and GYS medium ((NH ₄₎ ) ₂ SO ₄ 2 g/ℓ, yeast powder 2 g/ℓ, K ₂ HPO ₄ 0.5 g/ℓ, glucose 1 g/ℓ, MgSO ₄ H ₂ O 0.41 g/ℓ, CaCl ₂₂ H ₂ O 0.08 g/ℓ And MnSO ₄₅ H ₂ O 0.07 g/ℓ) for about 52 hours in shaking culture (30° C., 200 rpm) and the expression of GFP was investigated using a flow cytometer (FACSort, Becton Dickinson, USA) at 1 hour intervals. . The results are shown in FIG. 1.

After shaking culture for 48 hours until the late sporulation stage, the rhenographene density gradient method (CR Harwood, et al., "Molecular Biological Methods for Bacillus." John Wiley & Sons, New York, p.416) (1990)), only pure spores were isolated, and GFP displayed on the surface of Bacillus spores was analyzed using a flow cytometer. The results are shown in FIG. 1. In Figure 1, pD5D GFP expression spores are blue regions.

As a result, the target protein alone can be displayed on the spore surface without fusion with the parent body during surface display. Furthermore, the target protein was displayed on the spore surface in Bacillus cells without inducing the binding of the spore and the target protein outside the cell. In addition, it was found that the higher the expression level of GFP, the greater the amount of GFP displayed on the spore surface. That is, it was found that the amount of protein expression and the amount of spore surface exhibited were proportional. Therefore, a powerful expression system such as the cry3Aa promoter can be usefully used for spore surface display.

Example 2: Bacillus Tn mutant library construction

By adding Mariner-based Tn mutagenesis to Bacillus subtilis having the above expression system, spores showing higher gfp activity were selected by FACSorting to select mutant hosts capable of displaying higher levels of protein. For ultra-high-speed screening of the expression library, B.subtilis 168 expressed by integrating gfp into the amyE site by introducing the fluorescent protein into the pD5D integration vector so that it can be expressed on the spore surface first is mariner-based with excellent randomness for transposon mutagenesis A plasmid containing a transposon was introduced. Strains including transposon were plated on LB solid medium and incubated at 50 °C to induce transposon insertion. All grown mutant colonies were collected and stored at -70 °C to complete the Tn library production.

Example 3: Selection of improved GFP expression mutant spore from Tn Bacillus mutant line

In order to secure colonies with higher activity than the control in the Tn library, spores were generated in DSM medium 37°C, which is a spore production medium, and fluorescence of spores was measured with a flowcytometer, and colonies with higher GFP activity than the control were sorted. The results are shown in Figure 2.

Among them, a number of mutants with improved GFP display activity were discovered through BioLector with improved growth and gfp activity even in the sporulation phase. Among the mutants with improved GFP display activity, three mutants were selected and streaked on a plate together with a control, and the gfp intensity of spore was compared through a Fluorescence Microscope. As a result, the highest GFP activity in Tn53 can be confirmed (FIG. 3 ).

Example 4: Construction of an improved GFP expression mutant .

To identify the Tn insertion site, Tn mutants with high gfp were grown in LB solid medium to extract genomic DNA, and then sequencing with Fusion primer & nested integrated PCR (FPNI-PCR) was confirmed. The results of confirming the mutant gene of the mutant strain are shown in Table 1.

Mutant gene Tn2 Riboflavin transporter, fmnP Tn7 Hypothetical protein, yoqZ Tn9 preprotein translocase subunit, secD Tn13 Riboflavin transporter, ndoA Tn16 Cell-wall-binding protein, yqfZ Tn31 Prolyl isomerase, tig Tn36 XRE family transcriptional regulator, yvzC Tn41 Cadmium transporter, copB Tn49 Glutamate: protein symporter, gltT Tn53 Phosphohydrolase, Nicotinate-nucleotide adenylyltransferase, yqeK

Tn53 mutant having the highest GFP activity was selected from Table 1 to produce a ΔyqeK-deficient mutant.

Example 5: Construction and selection of secondary Tn library in improved Tn mutant .

ΔyqeK was carried out in the same manner as the above Tn library production process to create a secondary Tn library.Spore was generated in the same manner as above, and the fluorescence of the spore was measured with a flowcytometer, and colonies with higher GFP activity than the control ΔyqeK were sorted. (Fig. 4). Tn insertion site was identified by fusion primer & nested integrated PCR (FPNI-PCR), and an lrpC mutant, ΔyqeKΔlrpC double mutant, was constructed using the yqeK deletion mutant as a host.

Example 6: Construction of a tertiary Tn library in an improved Tn mutant .

In ΔyqeKΔlrpC, a tertiary Tn library was prepared in the same manner as the above Tn library production process, and fluorescence of spores was measured, but colonies with higher GFP activity than the control could not be selected.

Example 7: Comparison of fluorescence intensity of improved mutant strains .

In order to compare the fluorescence intensity of the mutant strain having increased GFP activity in the same manner as in Example 1 with the control strain, spores were generated at 37°C in DSM medium and measured with a flowcytometer. The results are shown in FIG. 5. It was confirmed that the primary selected ΔyqeK had higher GFP activity than the control and the secondary selected ΔyqeKΔlrpC had higher GFP activity than the ΔyqeK.

Example 8: Comparison of fluorescence intensity in ΔcotH and ΔyqeK mutants.

In order to compare the fluorescence activity of the ΔcotH mutant (Sirec, 2012), which was already proven to have better enzyme adsorption capacity, and the ΔyqeK selected by the research team, spores were generated in DSM medium at 37°C and measured with a flowcytometer. The results are shown in FIG. 6. As shown in FIG. 6, ΔcotH showed higher GFP activity than the control group, but ΔyqeK selected by us had higher GFP activity.

As described above, although the embodiments have been described by the limited embodiments and drawings, various modifications and variations are possible from the above description by those of ordinary skill in the art. For example, even if the described techniques are performed in a different order from the described method, and/or the described components are combined or combined in a form different from the described method, or are replaced or substituted by other components or equivalents. Appropriate results can be achieved. Therefore, other implementations, other embodiments, and claims and equivalents fall within the scope of the claims to be described later.

Claims (15)

It is a mutant strain of a spore-forming strain transformed with a promoter in a gene encoding a protein of interest to be displayed on the spore surface,
The target protein is displayed on the spore surface in a non-fused natural state,
The mutant strain of the spore-forming strain is derived from a Bacillus subtilis microorganism,
The mutant strain of the spore-forming strain is a mutant strain comprising at least one or more selected from the group consisting of fmnP, yoqZ, secD, ndoA, yqfZ, tig, yvzC, copB, gltT, yqeK and lrpC genes,
Expressing host strain.
delete The method of claim 1,
The promoter is the cry promoter of the insecticidal crystal protein (insecticidal crystal protein), lac promoter, ara promoter, tet promoter, trp promoter, λ promoter, λPR promoter, T7 promoter, tac promoter, PT5 promoter, trc promoter, lacUV5 promoter, lpp Promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter and other Bacillus sporulation promoter comprising at least one selected from the group consisting of,
Expressing host strain.
The method of claim 1,
The target protein is an enzyme, an enzyme inhibitor, a hormone, a hormone analogue, a hormone receptor, a signaling protein, an antibody, a monoclonal antibody, an antigen, an adhesion protein, a structural protein, a regulatory protein, a toxin protein, a cytokine, a transcriptional regulatory factor, and blood. It contains at least any one selected from the group consisting of a coagulation factor and a plant bioprotective induction protein,
Expressing host strain.
The method of claim 1,
The protein of interest is one comprising a monomeric protein, a multimeric protein, or both,
Expressing host strain.
Obtained from the expression host strain of claim 1,
Spores with target protein displayed on the surface in a non-fused natural state.
The method of claim 6,
The target protein is non-covalently attached to the spore surface,
Spores.
Selecting a mutant strain of the spore-forming strain; And
Constructing a vector including a promoter in the gene encoding the target protein to be displayed on the spore surface of the mutant strain; And
Transforming the mutant strain with the vector;
Including,
The mutant strain of the spore-forming strain is derived from a Bacillus subtilis microorganism,
The mutant strain of the spore-forming strain is a mutant strain comprising at least one or more selected from the group consisting of fmnP, yoqZ, secD, ndoA, yqfZ, tig, yvzC, copB, gltT, yqeK and lrpC genes,
A method for producing an expression host strain, in which the target protein is displayed on the spore surface in a non-fused natural state.
Obtaining an expression host strain;
Culturing the expression host strain to express the target protein in the expression host strain; And
Displaying the expressed target protein on the spore surface of the expression host strain;
Including,
The expression host strain is a mutant strain of a spore-forming strain transformed with a promoter in a gene encoding a protein of interest to be displayed on the spore surface,
The target protein is displayed on the spore surface in a non-fused natural state,
The mutant strain of the spore-forming strain is derived from a Bacillus subtilis microorganism,
The mutant strain of the spore-forming strain is a mutant strain comprising at least one or more selected from the group consisting of fmnP, yoqZ, secD, ndoA, yqfZ, tig, yvzC, copB, gltT, yqeK and lrpC genes,
Method of displaying the spore surface of the target protein.
The method of claim 9,
The step of obtaining the expression host strain,
Selecting a mutant strain of the spore-forming strain; And
Constructing a vector including a promoter in the gene encoding the target protein to be displayed on the spore surface of the mutant strain; And
Transforming the mutant strain with the vector;
It includes,
Method of displaying the spore surface of the target protein.
The method of claim 9,
Adsorbing the target protein-containing liquid to the spores that have already exhibited the target protein with a liquid containing the target protein secreted or exposed to the outside during the sporulation during, after or both of the steps displayed on the spore surface; Which further comprises,
Method of displaying the spore surface of the target protein.
delete The method of claim 9,
The promoter is the cry promoter of the insecticidal crystal protein (insecticidal crystal protein), lac promoter, ara promoter, tet promoter, trp promoter, λ promoter, λPR promoter, T7 promoter, tac promoter, PT5 promoter, trc promoter, lacUV5 promoter, lpp Promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter and other Bacillus sporulation promoter comprising at least one selected from the group consisting of,
Method of displaying the spore surface of the target protein.
The method of claim 9,
The target protein is an enzyme, an enzyme inhibitor, a hormone, a hormone analogue, a hormone receptor, a signaling protein, an antibody, a monoclonal antibody, an antigen, an adhesion protein, a structural protein, a regulatory protein, a toxin protein, a cytokine, a transcriptional regulatory factor, and blood. It contains at least any one selected from the group consisting of a coagulation factor and a plant bioprotective induction protein,
Method of displaying the spore surface of the target protein.
Obtaining an expression host strain;
Culturing the expression host strain to express the target protein in the expression host strain;
Displaying the expressed target protein on the spore surface of the expression host strain; And
Separating spores on which the target protein is surface-displayed from the expression host strain;
Including,
The expression host strain is a mutant strain of a spore-forming strain transformed with a promoter in a gene encoding a protein of interest to be displayed on the spore surface,
The mutant strain of the spore-forming strain is derived from a Bacillus subtilis microorganism,
The mutant strain of the spore-forming strain is a mutant strain comprising at least one or more selected from the group consisting of fmnP, yoqZ, secD, ndoA, yqfZ, tig, yvzC, copB, gltT, yqeK and lrpC genes,
A method for producing spores in which the target protein is displayed on the surface in a non-fused natural state.

Images