KR102146932B1 - Medium composition for the differentiation of bile duct cells of liver stem cells and uses thereof - Google Patents

Abstract

The present invention relates to a medium composition for inducing bile duct cell differentiation of liver stem cells and uses thereof, and more specifically, to provide a medium composition for differentiating liver stem cells into bile duct cells without going through an endoderm step, and the medium composition It relates to a method capable of rapidly obtaining bile duct cells by applying them during culture.
According to the present invention, by adding a medium composition containing HGF, sodium taurocholate hydrate, and CHIR99021 in the process of culturing liver stem cells, bile duct cells can be quickly obtained without going through the endoderm step, When the bile duct cells are differentiated, gelatin is used as a cell support, so that clinically applicable bile duct cells can be obtained, which is expected to be useful in the treatment of cholangiopathy.

Description

Medium composition for the differentiation of bile duct cells of liver stem cells and uses thereof {Medium composition for the differentiation of bile duct cells of liver stem cells and uses thereof}

The present invention relates to a medium composition for inducing bile duct cell differentiation of liver stem cells and a use thereof, and more specifically, to provide a medium composition for differentiating liver stem cells into bile duct cells without going through an endoderm step, and the medium composition It relates to a method capable of rapidly obtaining bile duct cells by applying them during culture.

The liver is one of the most complex organs in the body and consists of hepatocytes, biliary epithelial cells, Kupfer cells, stellate cells, and hepatic progenitor cells. do. Among them, hepatocytes account for the largest proportion, and they account for 95% of the total liver. The remaining 5% are biliary epithelial cells, also known as cholangiocytes.

Bile epithelial cells (Cholangiocytes) are actively involved in changes in the amount and composition of bile, are activated by interaction with endogenous and exogenous stimuli, and are involved in liver damage recovery.

Cholangiopathy refers to a category of chronic liver disease, and is a disease related to biliary epithelial cells. Common cholangiopathies include primary biliary cirrhosis, primary sclerosing cholangitis, liver-related cystic fibrosis, biliary atresia, polycystic liver disease, and bile duct cancer. The disease progresses rapidly, and there is no medical treatment including clinical management capable of treating the disease, and thus, serious morbidity and mortality are recorded. To date, the most suitable treatment for cholangiopathy is liver transplantation, but there is a shortage of donors and a high risk of complications during transplantation.

To overcome this problem, many researchers have studied a medium composition for producing cells similar to bile duct cells and a method of differentiating bile duct cells, but conventional induced pluripotent stem cells (iPSCs) and embryonic stem cells (Embryonic stem cells) have been studied. cell, ESC) is inefficient temporally and economically by differentiating into bile duct cells after going through the endoderm stage and hepatic progenitor cell stage, and it is not applicable to clinical use using matrigel extracted from cancer cells. There was a limit. In addition, studies on the method of generating hepatocytes and bile duct cells from pluripotent stem cells have been conducted (Korean Laid-Open Patent Publication No. 10-2015-0119427), but differentiation of hepatic stem cells induced using low-molecular compounds into bile duct cells Research on the composition of the medium to be used is still insufficient.

The present invention was devised to solve the above problems, and it was experimentally confirmed that the differentiation into bile duct cells is possible by culturing liver stem cells reprogrammed from liver cells in a medium containing specific compounds. Based on this, the present invention was completed.

Accordingly, an object of the present invention is to provide a medium composition for inducing differentiation of liver stem cells into bile duct cells, characterized in that it comprises HGF, sodium taurocholate hydrate, and CHIR99021.

Another object of the present invention is (a) placing liver stem cells on a gelatin-coated plate; And (b) culturing hepatic stem cells by adding the medium composition to the method for differentiating liver stem cells into bile duct cells.

Another object of the present invention is to provide bile duct cells differentiated by the above method.

Another object of the present invention is to provide a composition for preventing or treating bile duct disease, characterized in that it comprises the bile duct cells.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems that are not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the above object, the present invention

It provides a medium composition for inducing the differentiation of liver stem cells into bile duct cells, characterized in that it comprises HGF, sodium taurocholate hydrate and CHIR99021.

As an embodiment of the present invention, HGF may be included in a concentration of 50 to 160 ng/mL with respect to the medium composition.

In another embodiment of the present invention, sodium taurocholate hydrate may be included in a concentration of 1 to 10 μM with respect to the medium composition.

In another embodiment of the present invention, CHIR99021 may be included in a concentration of 0.75 to 7.5 μM for the medium composition.

In addition, the present invention comprises the steps of: (a) placing liver stem cells on a gelatin-coated plate; And (b) it provides a method for differentiating liver stem cells into bile duct cells, comprising the step of culturing liver stem cells by adding the medium composition.

In one embodiment of the present invention, the gelatin may be coated on a plate at a concentration of 0.05 to 0.15%.

In another embodiment of the present invention, the stem cells may be cultured for 7 to 17 days.

In addition, the present invention provides bile duct cells differentiated by the above method.

In addition, the present invention provides a composition for preventing or treating bile duct disease, including the bile duct cells.

In one embodiment of the present invention, the bile duct disease is Alagille syndrome (AGS), primary biliary cirrhosis (PBC), primary sclerosing cholangitis (PSC), cystic fibrosis. fibrosis), biliary atresia or cholangiocarcinoma.

In addition, the present invention provides a method for preventing or treating bile duct disease comprising administering the composition to an individual.

In addition, the present invention provides a use of the composition for preventing or treating bile duct diseases.

According to the present invention, by adding a medium composition containing HGF, sodium taurocholate hydrate and CHIR99021 in the culture process of liver stem cells, bile duct cells can be obtained quickly without going through the endoderm step, When the bile duct cells are differentiated, gelatin is used as a cell support, so that clinically applicable bile duct cells can be obtained, which is expected to be useful in the treatment of cholangiopathy.

1 shows a schematic diagram of a process of inducing differentiation of bile duct cells from the liver.
FIG. 2 shows the results of observing the morphology of liver stem cells and differentiated bile duct cells according to the present invention. FIG. 2A shows the results of observing the morphology of liver stem cells, and FIG. 2B is an enlarged result of FIG. 2A. 2C shows the results of observing the morphology of differentiated bile duct cells, and FIG. 2D shows the enlarged results of FIG. 2C (scale bar = 100 μm, hCdH is liver stem cells, hCdH-Chol is differentiated Refers to bile duct cells).
Figure 3 shows the gene expression pattern of the bile duct cell marker in the differentiated bile duct cells according to the present invention compared to liver stem cells (hCdH represents liver stem cells, hCdH-Chol represents differentiated bile duct cells).
Figure 4 shows the expression pattern of bile duct cell markers in differentiated bile duct cells according to the present invention in comparison with liver stem cells (scale bar = 50 μm, hCdH represents liver stem cells, hCdH-Chol represents differentiated bile duct cells. ).
5 shows the results of confirming the enzyme activity in hepatic stem cells and differentiated bile duct cells according to the present invention by a Fluorescein diacetate (FD) assay (hCdH represents liver stem cells, hCdH-Chol represents differentiated bile duct cells) .

Hereinafter, the present invention will be described in detail.

The present inventors have experimentally confirmed that liver stem cells reprogrammed from liver cells are differentiated into bile duct cells when cultured in a medium containing specific compounds, and based on this, the present invention has been completed.

Thus, the present invention provides a medium composition for inducing differentiation of liver stem cells into bile duct cells, characterized in that it comprises HGF, sodium taurocholate hydrate and CHIR99021.

The term "differentiation" as used in the present invention refers to a phenomenon in which a cell divides and proliferates, and a structure or function of a cell is specialized during the growth of an entire individual. In other words, it refers to a process in which cells, tissues, etc. of living organisms are transformed into suitable shapes and functions to perform the roles given to each. For example, pluripotent stem cells, such as embryonic stem cells, are differentiated into ectoderm, mesoderm, and endoderm cells, and narrowly, the process of transforming hematopoietic stem cells into red blood cells, leukocytes, platelets, etc. also corresponds to differentiation. It is also referred to as "natural differentiation".

The term "culture media" as used in the present invention means a medium capable of supporting stem cell growth and survival in-vitro, and is used in the art suitable for culturing cells. Includes all of the media. The medium and culture conditions can be selected according to the cell type.

In the present invention, the medium composition may include HGF, sodium taurocholate hydrate and CHIR99021, and HGF may be included in a concentration of 50 to 160 ng/mL with respect to the medium composition for inducing differentiation of liver stem cells into bile duct cells, and , Preferably, it may be included in a concentration of 75 ng/mL, but is not limited thereto.

In the present invention, the sodium taurocholate hydrate is known to play a role of inhibiting spontaneous differentiation of hepatic stem cells into hepatocytic lineage, and 1 to 1 for the medium composition for inducing differentiation of hepatic stem cells into bile duct cells It may be included at a concentration of 10 μM, and preferably may be included at a concentration of 10 μM, but is not limited thereto.

In the present invention, the CHIR99021 is known as a low-molecular inhibitor of GSK-3 (Glycogen Synthase Kinase-3), and may be included in a concentration of 0.75 to 7.5 μM with respect to the medium composition for inducing the differentiation of liver stem cells into bile duct cells. It may be included in a concentration of 7.5 μM, but is not limited thereto.

The medium used for cultivation is preferably a cell culture minimum medium (CCMM), and generally contains a carbon source, a nitrogen source, and a trace element component. For example, DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI1640, F-10, F-12, aMEM (a Minimal Essential Medium) , GMEM (Glasgow's Minimal Essential Medium), Iscove's Modified Dulbecco's Medium, and the like, but are not limited thereto. In addition, the medium may contain antibiotics such as penicillin, streptomycin, and gentamicin.

In another aspect of the present invention, the present invention comprises the steps of (a) locating liver stem cells on a gelatin-coated plate and (b) culturing liver stem cells by adding the medium composition. It provides a method for differentiating liver stem cells into bile duct cells, and bile duct cells differentiated by the method.

The term "gelatin" as used in the present invention is an derived protein obtained by hydrolyzing collagen (collagen), a natural high molecular protein constituting animal bones, leather, tendons, cartilage, and the like. The general constituents of gelatin may be about protein: 84 to 90%, water: 8 to 12%, and mineral salts: 2 to 4%. In the present invention, gelatin may have various gel strengths and viscosity. In the present invention, gelatin may be isolated or synthesized from natural materials, and the type of raw material is not limited, but preferably, collagen isolated from skins, bone skins, etc. of mammals or fish may be hydrolyzed to produce it.

In the step (a) of the present invention, the bile duct cells differentiated through a culture step using a gelatin coating instead of a matrigel extracted from cancer cells, as a step of placing the liver stem cells on a cell support for culturing Can be used directly in clinical practice. The gelatin coating may be in a concentration of 0.05 to 0.15%, preferably 0.1%, but is not limited thereto.

The step (b) of the present invention is a step of culturing liver stem cells in the differentiation medium for differentiation into bile duct cells, and when the stem cells are cultured for 7 to 17 days, differentiated bile duct cells can be obtained. . Preferably, it can be cultured for 10 to 14 days, but is not limited thereto.

The bile duct cells of the present invention may have an increased expression of a bile duct cell-specific marker compared to the stem cells. Preferably, the cells may increase the expression of bile duct cell-specific markers CK19 and CK7 3 times, the expression of AE2 and AQP1 12 times, and the expression of CFTR 20 times or more compared to liver stem cells, but are limited thereto. It is not.

In one embodiment of the present invention, 0.1 μM dexamethasone, 10 mM nicotinamide, 1% ITS (insulin-transferrin-selenium), 75 ng/mL HGF, 10 μM sodium taurocholate hydrate, As a result of culturing liver stem cells for 10 to 14 days using DMEM/F-12 medium supplemented with 7.5 μM CHIR99021 and 75 ng/mL EGF (Epidermal Growth Factor), it was confirmed that differentiated bile duct cells can be obtained. (See Example 2-1).

Accordingly, in order to clarify whether the differentiated cells are bile duct cells, in another embodiment of the present invention, as a result of observing the morphology of bile duct cells differentiated from liver stem cells, the branched structure characteristic of bile duct cells was confirmed ( See Example 2-2), in another embodiment of the present invention, as a result of observing mRNA of bile duct cells differentiated from hepatic stem cells, specific marker genes of CK19, CK7, CFTR, AE2 and AQPR1 It was confirmed that the expression was increased (see Example 2-3). In addition, in another embodiment of the present invention, as a result of confirming the amount of various bile duct cell markers of bile duct cells differentiated from hepatic stem cells, it was visually confirmed that the expression of CK19, CK7, CFTR and AE2 was increased (Example 2 -4).

The above results indicate that bile duct cells can be effectively obtained by using liver stem cells and the medium composition, and the bile duct cells can be usefully used as a therapeutic agent for bile duct diseases in that they can be provided for bile duct regeneration. Suggests.

Thus, the present invention provides a composition for preventing or treating bile duct disease, characterized in that it comprises the bile duct cells.

"Bile duct disease", which is a disease target in the present invention, is a generic term for diseases related to bile secreted from hepatocytes, preferably Alagille syndrome (AGS), primary biliary cirrhosis (primary biliary). cirrhosis, PBC), primary sclerosing cholangitis (PSC), cystic fibrosis, biliary atresia, or cholangiocarcinoma, but are not limited thereto.

The composition for preventing or treating bile duct disease of the present invention may further include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is commonly used in preparation, and includes, but is limited to, saline, sterile water, Ringer's solution, buffered saline, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, and the like. It is not, and other conventional additives such as antioxidants and buffers may be further included if necessary. In addition, diluents, dispersants, surfactants, binders, lubricants, and the like may be additionally added to prepare injectable formulations such as aqueous solutions, suspensions, emulsions, etc., pills, capsules, granules, or tablets. Regarding suitable pharmaceutically acceptable carriers and formulations, it can be preferably formulated according to each component using a method disclosed in Remington's literature. The pharmaceutical composition of the present invention is not particularly limited in its formulation, but may be formulated as an injection, an inhalant, an external preparation for skin, or an oral ingestion.

The composition of the present invention may be administered orally or parenterally according to a desired method (for example, intravenous, subcutaneous, skin, nasal, airway), and the dosage is the patient's condition and weight, the degree of disease , It depends on the drug form, administration route and time, but may be appropriately selected by those skilled in the art.

The composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "a pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type of disease, severity, and drug activity of the patient. , Sensitivity to drugs, time of administration, route of administration and rate of excretion, duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field. The composition according to the present invention may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with a conventional therapeutic agent, and may be administered single or multiple. It is important to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects in consideration of all the above factors, and this can be easily determined by a person skilled in the art.

Specifically, the appropriate dosage of the composition of the present invention may vary depending on factors such as formulation method, mode of administration, age, weight, sex, pathological condition, food, administration time, route of administration, excretion rate and response sensitivity of the patient. Can be prescribed. For example, at least about 10 ⁴ to 10 ⁶ and typically 1×10 ⁸ to 1×10 ¹⁰ hepatic progenitor cells may be injected intravenously or intraperitoneally to a 70 kg patient over approximately 60 to 120 minutes. In the case of administration, the bile duct cells are administered at a rate determined by the side effects depending on the type of cells at various concentrations and LD-50 according to the cell type (or other toxicity measurement method), taking into account the individual's overall health and body weight. do. Administration can be administered at one time or in several divided doses. However, since it may increase or decrease depending on the route of administration, the severity of the bile duct disease, sex, weight, age, etc., the dosage amount does not limit the scope of the present invention in any way.

On the other hand, as another aspect of the present invention, the present invention provides a method for preventing or treating bile duct disease comprising administering the composition to an individual.

In the present invention, "individual" means a subject in need of a method for treating a disease, and more specifically, a human or non-human primate, mouse, rat, dog, cat, horse, and It means mammals such as cattle.

Hereinafter, a preferred embodiment is presented to aid the understanding of the present invention. However, the following examples are provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Experiment preparation and experiment method

1-1. Establishment of liver stem cells

After culturing in William's medium for 24 hours, human primary hepatocytes were cultured with 10 mM nicotinamide (Sigma-Aldrich, MO, USA), 1% penicillin/streptomycin (Gibco), and 20 ng/mL of HGF (Peprotech, NJ, USA). ), 20 ng/mL of EGF (Peprotech) and 4 μM A83-01 (Gibco) and 3 μM CHIR99021 (StemCell Technologies) in DMEM/F-12 (11965, Gibco, CA, USA) at 37° C. and CO ₂ It was cultured in an incubator, and the medium was changed every day.

1-2. Scanning electron microscope

Tissue samples were fixed with paraformaldehyde and glutaaldehyde, and then fixed with osmium tetraoxide (OsO ₄ ) once again. After filling the tissue sample fixed to the resin, ultra-thin sections were taken, stained with uranyl acetate and lead citrate, and photographed.

1-3. mRNA isolation and RT-PCR analysis

Total RNA was isolated using Trizol reagent (Gibco). 1 μg of RNA sample was reverse transcribed with Transcriptor First Strand cDNA Synthesis Kit (Roche, PA, USA) and CFX Connect Real-Time PCR using 10 μL of qPCR PreMix (Dyne bio, Korea), 1 μL of cDNA and oligonucleotide primer (Table 1). Real-time PCR was performed in a detection system (Bio-rad, CA, USA). Responses were analyzed in triplicate for each gene. The PCR cycle consists of 40 cycles of 20 seconds at 95°C and 40 seconds at 60°C. Melting curve and melting peak data were obtained to characterize the PCR product.

gene Forward primer sequence (5'-3') Reverse primer sequence (5'-3') CK19 TCCGAACCAAGTTTGAGACG CCCTCAGCGTACTGATTTCC CK7 GATAAAAGGCGCGGAGTGTC GAAACCGCACCTTGTCGATG CFTR AGTTGCAGATGAGGTTGGGC AAAGAGCTTCACCCTGTCGG AE2 GGGGAAAGTTGAGTTGGGAGA CTGGCTCTGGCGTACAGAAA AQPR1 GGCCAGCGAGTTCAAGAAGAA TCACACCATCAGCCAGGTCAT

1-4. Immunohistochemistry

Washing three times with xylene for 5 minutes each time to deparaffinize a 4 μm section. The differentiated bile duct cells were rehydrated with ethanol, and finally washed with distilled water. After washing, the slides were autoclaved in pH 6.0 and 10 mM sodium citrate buffer to expose the antigen and then recovered. The slides were incubated in distilled water for 5 minutes, and the primary antibody was added overnight at 4° C., and then placed in a chamber maintaining a constant humidity. The next day, the slides were washed three times for 5 minutes with a PBS staining solution supplemented with 1% FBS, and then incubated with a secondary antibody for 1 hour 30 minutes at room temperature. Antibodies are shown in Table 2. Nuclei were counter-stained using Hoechst 33342 (1:10000, Molecular Probes) dissolved in PBS. After incubation with the secondary antibody, the slides were washed with running tap water, dehydrated, clarified, and mounted. Samples were imaged with a TCS SP5 confocal microscope (Leica).

protein company Product number CK19 Santa Cruz Biotechnology sc-376126 CK7 Abcam ab9021 CFTR Almone Acl006 AE2 Abcam ab42687

1-5. Fluorescein diacetate(FD) assay

Several kinds of enzymes, including lipase, esterase, and protease, hydrolyze the FDA, and by the hydrolysis, the colorless FDA forms a fluorescent yellow-green fluorescein.

In FDA analysis, samples were mixed with FDA and buffer and incubated with shaking for 1-2 hours. The resulting yellow-green fluorescence intensity was used to measure the amount of enzyme cleavage of the FDA molecule and the enzyme activity in the sample. Quantification of enzyme activity was evaluated by the intensity of fluorescence formation using a spectrophotometer.

1-6. Statistical analysis

Quantitative data are expressed as mean±standard deviation (SD) along with inference statistics (p values). Statistical significance was evaluated by a significant two-sided t-test set to *P<0.05, **P<0.01, and ***P<0.001.

Example 2. Confirmation of induction of differentiation of liver stem cells into bile duct cells

2-1. Induction of differentiation of liver stem cells into bile duct cells

In order to differentiate liver stem cells into bile duct cells, the liver stem cells (see Example 1-1) were placed on a plate coated with 0.1% gelatin, and 0.1 μM dexamethasone and 10 mM nicotinamide were placed on the plate. ), DMEM/F- supplemented with 1% ITS (insulin-transferrin-selenium), 75 ng/mL HGF, 10 μM sodium taurocholate hydrate, 7.5 μM CHIR99021 and 75 ng/mL Epidermal Growth Factor (EGF) The liver stem cells were cultured for 10 to 14 days by adding 12 medium.

2-2. Confirmation of the morphology of differentiated bile duct cells

As a result of observing with a scanning microscope according to Example 1-2 in order to clarify whether the differentiated cells are bile duct cells, a branched structure characteristic of bile duct cells was confirmed as shown in FIGS. 2C and 2D ( hCdH represents liver stem cells, hCdH-Chol represents differentiated bile duct cells).

2-3. Identification of differentiated bile duct cells using qRT-PCR

QRT-PCR was performed according to Example 1-3 to clarify whether the differentiated cells were bile duct cells.

As a result, compared to liver stem cells, as shown in FIG. 3, the cells increased the expression of CK19 and CK7, which are bile duct cell-specific markers, 3 times, the expression of AE2 and AQP1 12 times, and the expression of CFTR more than 20 times. (HCdH represents liver stem cells, hCdH-Chol represents differentiated bile duct cells).

2-4. Identification of differentiated bile duct cells using bile duct cell markers

To clarify whether the differentiated cells are bile duct cells, immunohistochemistry was performed according to Example 1-4, and the amounts of various bile duct cell markers were measured through the intensity of fluorescence.

As a result, as shown in FIG. 4, it was visually confirmed that the expression of CK19, CK7, CFTR, and AE2, which are markers of bile duct cells, was increased compared to liver stem cells (hCdH is liver stem cells, hCdH-Chol is differentiated bile duct cells Represents).

2-5. Identification of differentiated bile duct cells by Fluorescein diacetate assay

Fluorescein diacetate assay was performed according to Example 1-5 in order to clarify whether the differentiated cells were bile duct cells.

As a result, as shown in FIG. 5, after 30 minutes of FD absorption, fluorescence was observed only in differentiated bile duct cells excluding liver stem cells to confirm the enzyme activity of bile duct cells (hCdH is liver stem cells, hCdH-Chol is differentiated Refers to bile duct cells).

The above description of the present invention is for illustrative purposes only, and those of ordinary skill in the art to which the present invention pertains will be able to understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not limiting.

Claims (10)

HGF, sodium taurocholate hydrate (sodium taurocholate hydrate), characterized in that it comprises CHIR99021, a medium composition for inducing differentiation of liver stem cells into bile duct cells.
The method of claim 1,
With respect to the medium composition, HGF is characterized in that contained in a concentration of 50 to 160ng / mL, medium composition.
The method of claim 1,
With respect to the medium composition, sodium taurocholate hydrate is characterized in that contained in a concentration of 1 to 10 μM, medium composition.
The method of claim 1,
CHIR99021 for the medium composition, characterized in that it comprises a concentration of 0.75 to 7.5μM, medium composition.
(a) placing liver stem cells on a gelatin-coated plate; And
(b) culturing liver stem cells by adding the medium composition of claim 1;
A method for differentiating liver stem cells into bile duct cells, comprising:
The method of claim 5,
The method, characterized in that the gelatin is coated on a plate at a concentration of 0.05 to 0.15%.
The method of claim 5,
The method, characterized in that the stem cells are cultured for 7 to 17 days.
delete delete delete

Images