KR102146921B1 - Primer set, composition and kit for detecting genetically modified crops introduced EPSPS gene, and methods using the same - Google Patents

Abstract

The present invention relates to a primer set for detecting genetically modified corn into which the EPSPS gene has been introduced, and a method for detecting genetically modified corn into which the EPSPS gene has been introduced using the same, and when the primer set according to the present invention is used, an inherent gene of genetically modified corn And the introduced mEPSPS gene can be detected simultaneously, so only genetically modified corn containing the EPSPS gene can be specifically detected.

Description

[Primer set, composition and kit for detecting genetically modified crops introduced EPSPS gene, and methods using the same}

The present invention relates to a primer set for detecting genetically modified corn into which the EPSPS gene has been introduced, a composition for detection, a kit, and a method for detecting the genetically modified corn using the same.

To meet the food needs of a growing population around the world, biotech technologies are using specific crops in agriculture to help build the foundation for sustainable food production. Crops, known as genetically modified organisms (GMOs) or living modified organisms (LMOs), were first cultivated on 1.7 million hectares in 1996, reaching 185.1 million hectares in 2016, and 26 countries were in production. I am engaged (non-patent document 1).

Genetically modified crops are herbicide-tolerant (HT) crops with 57% of the cultivated area, and glyphosate and gluforsinate-resistant varieties account for most of them. Herbicide-tolerant crops include cotton, canola, soybean, corn, wheat, sugar beet, potato, rice, flax, alfalfa, etc. Genes used to produce herbicide-tolerant crops include gox, als, bar, pat, and EPSPS. . EPSPS (5-enolpyruvylshikimate-3- phosphate synthase) is separated by a mEPSPS derived from Agrobacterium (Agrobacterium) cp4-epsps and corn (Zea mays) derived from the CP4 strains. Among these genes, cp4 - epsps is a commonly used herbicide tolerance gene, and herbicide-tolerant crops using mEPSPS having similar functions and protein structures have been developed. Currently, genetically modified crop varieties containing mEPSPS include soybean (FG72 and Das44406-6), corn (GA21, HCEM485, MZHGOJG and VCO-01981-5), cotton (GHB614), potato (RBMT22-238 and RBMT22-262). ) And later hybrids of the above varieties.

Since mEPSPS is a maize-derived gene, in the case of maize, it exhibits a detection reaction in PCR analysis by an inherent nucleotide sequence. However, in other crops, the detection reaction according to the intrinsic base does not appear, and when several crops such as food or feed are mixed, it may be difficult to distinguish whether or not the foreign introduced mEPSPS is included by the intrinsic sequence of corn. For this reason, there are currently no reports that can specifically detect and differentiate only the mEPSPS gene.

Genetically modified crops (Genetically Modified Crops) have been commercialized and used for more than 20 years, and import permits and cultivation are strongly regulated in accordance with national regulations, but there is still a popular debate about potential human and environmental risks. In Korea, environmental risk assessment must be completed before importing genetically modified crops, and potential harmful effects to the environment and public health are prevented in advance through the “Integrated Notification on Transboundary Movement of Genetically Modified Organisms”. In order to fulfill the purpose of the handling and management of genetically modified organisms for agriculture, genetically modified crops are not unintentionally released to the environment during distribution and use (Notification No. 2007-8 of the Ministry of Agriculture, Food and Rural Affairs).

The environmental risk assessment screening of genetically modified crops is handled on a case-by-case basis. In the environmental risk assessment, the molecular biological analysis of the transgene, the detection and expression of the transgene, and the assay method for the product of genetic modification are specified. In particular, the detection or assay method can be applied as a post-environment monitoring technology in order to secure safety according to the unintentional environmental release of genetically modified crops (Non-Patent Document 2). As the main assay method for genetically modified organisms, polymerase chain reaction (PCR), which detects the DNA of the transgene, is recommended as an international standard analysis method, and screening to detect genes on T-DNA introduced by qualitative analysis. (screening), gene-specific and structure-specific methods, and events that create and analyze specific markers based on adjacent sequences in the genome into which T-DNA is inserted and the nucleotide sequence of the carrier- It is classified into an event-specific or system-specific method (Non-Patent Document 3).

In Korea, imports of genetically modified organisms for agriculture and food have been increasing in recent years and are being used for various purposes. There will be no denying the possibility that these genetically modified crops will be exposed to the general environment through unintentional release during unloading, transportation, storage and distribution. Continuous environmental monitoring and safety management measures will be required to prevent the safe use of genetically modified crops and their spread to the ecosystem.

Therefore, this study proposes a method of detecting mEPSPS , a herbicide resistance gene whose detection method has not been established because the transgene is derived from corn among the growing domestic and foreign commercially approved genetically modified crops, and commercialization approved and unapproved genes including mEPSPS . We tried to develop a gene-specific detection method for safety management and post-environment monitoring for modified crops.

James Clive, 2016, Global Status of Commercialized Biotech/GM Crops: 2016, ISAAA Brief No. 52-2016 Jae Kyun Rho et al., Qualitative and Quantitative PCR Methods for Detection of Three Lines of Genetically Modified Potatoes, J Agric Food Chem., 2004, 52(11), pp 3269-3274 Nelson Marmiroli et al., Methods for detection of GMOs in food and feed, Anal Bioanal Chem, 2008, 392:369-384

An object of the present invention is to provide a primer set and a composition for detecting genetically modified corn into which the EPSPS gene has been introduced, and a method for detecting genetically modified corn into which the EPSPS gene has been introduced using the primer set.

The inventors of the present invention were researching a gene-specific detection method for safety management and post-environment monitoring for genetically modified corn containing EPSPS. When primers were prepared using the intron site of the EPSPS gene derived from corn, It was confirmed that the intrinsic nucleotide sequence of the modified corn and the nucleotide sequence of the introduced mEPSPS can be simultaneously detected, and the present invention was completed.

Hereinafter, the configuration of the present invention will be described in detail.

The present invention provides a first primer pair consisting of the nucleotide sequences of SEQ ID NO: 1 and 2;

A second primer pair consisting of the nucleotide sequences of SEQ ID NO: 3 and 4;

A third primer pair consisting of the nucleotide sequences of SEQ ID NO: 1 and 4;

A fourth primer pair consisting of the nucleotide sequences of SEQ ID NO: 5 and 6;

A fifth primer pair consisting of the nucleotide sequences of SEQ ID NO: 7 and 8;

A sixth primer pair consisting of the nucleotide sequences of SEQ ID NO: 7 and 9;

A seventh primer pair consisting of the nucleotide sequences of SEQ ID NO: 7 and 10;

An eighth primer pair consisting of the nucleotide sequences of SEQ ID NO: 11 and 12;

The ninth primer pair consisting of the nucleotide sequences of SEQ ID NO: 13 and 12;

The tenth primer pair consisting of the nucleotide sequences of SEQ ID NO: 14 and 12;

The eleventh primer pair consisting of the nucleotide sequences of SEQ ID NO: 15 and 16;

The twelfth primer pair consisting of the nucleotide sequences of SEQ ID NO: 17 and 16;

The thirteenth primer pair consisting of the nucleotide sequences of SEQ ID NO: 18 and 16; And

It provides a primer set for detecting genetically modified corn into which the EPSPS gene including the 14th primer pair consisting of the nucleotide sequences of SEQ ID NO: 19 and 16 is introduced.

In the present invention, the primer pair consisting of the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 19 is a primer pair specific to the EPSPS gene.

In the present invention, the primer specific for the EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) gene is constructed using the sequences of both exon sites including the intron site among the base sequences of EPSPS mRNA (NCBI Accession No. X63374). It may have been. The EPSPS gene is known as a gene that induces herbicide resistance.

In one embodiment, the first to the third primer pair may generate a 98 bp amplification product when PCR is performed, and the fourth to the seventh primer pair is 283 bp when PCR is performed. Can generate an amplification product of, the eighth primer pair to the tenth primer can generate an amplification product of 162 bp when PCR is performed, and the eleventh primer pair to the 14th primer pair are when PCR is performed. An 80 bp amplification product can be produced. In the present invention, the 98 bp amplification product, the 283 bp amplification product, the 162 bp amplification product and the 80 bp amplification product may represent the intron site of the EPSPS gene.

The primer set for detecting genetically modified corn according to the present invention comprises at least one primer set selected from the group consisting of a first primer pair to a 14th primer pair consisting of the nucleotide sequences of SEQ ID NO:1 to SEQ ID NO:19. By including, it is possible to specifically detect only the EPSPS gene in genetically modified corn and genetically modified corn.

In the following examples, as a result of using a primer set made to include an intron site in the base sequence of the EPSPS gene, genetically modified corn containing the EPSPS gene by specifically detecting the EPSPS gene at the same time as the inherent base sequence of the genetically modified corn It was confirmed that only can be specifically detected.

In the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence that is complementary to the nucleic acid strand to be copied, and can serve as a starting point for the synthesis of a primer extension product. The length and sequence of the primers should allow starting the synthesis of the extension product. The specific length and sequence of the primers will depend on the conditions of use of the primer, such as temperature and ionic strength, as well as the complexity of the required DNA or RNA target. Oligonucleotides used as primers may also include nucleotide analogs, such as phosphorothioate, alkylphosphorothioate or peptide nucleic acid, or insert material. (intercalating agent) may be included. Preferably, the primer is deoxyribonucleotide and is single chain. The primers used in the present invention may include naturally occurring dNMR (ie dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primer may also include a ribonucleotide.

The primer used in the present invention includes a hybridization nucleotide sequence that is complementary to a target nucleic acid. The term “complementary” means that a primer or probe is sufficiently complementary to selectively hybridize to a target nucleic acid sequence under a predetermined annealing or hybridization condition, and is substantially complementary and completely It has the meaning of inclusive of all that is perfectly complementary, and preferably means that it is completely complementary.

The primer set of the present invention fully considers the size of the primer, the Tm value, the GC content of the primer, and the prevention of the formation of a dimer by the self-complementary sequence in the primer, and the genetically modified crop It is carefully designed to maximize the sensitivity and specificity of detection.

In the present invention, the term "genetically modified organism" refers to a crop that has been given new properties not found in nature by genetic modification technology, in particular, productivity is improved and product quality is enhanced. GMO (genetically modified organism) is an abbreviation of'genetically modified organism', but it is commonly referred to as'genetically modified crop' because it mainly targets crops. In 1994, Calgene in the US commercialized stubborn tomatoes for the first time. In 1996, Monsanto commercialized soybeans, and Novartis commercialized corn. Genetically modified crops accounted for more than 50% of sorghum, soybeans and cotton in the United States in five years since it first appeared in the consumer market. The above genetically modified crops are resistant to pests and diseases and have the advantage of solving food shortages due to their high yield, but it has not been clearly verified that they are harmless to humans when consumed for a long time, and environmental disturbances such as ecosystems caused by genetically modified crop varieties There is a risk that a disaster could occur.

In the present invention, the "endogenous sequence" is a sequence uniquely possessed by a corresponding crop, and is used as a reference for comparison with an exogenous sequence, and is also referred to as an endogenous reference sequence.

In addition, the present invention provides a composition for detecting genetically modified corn into which the EPSPS gene including the primer set is introduced.

In one embodiment, the composition may be a composition for amplifying a target nucleic acid. The amplification may be a known method for amplifying nucleic acids. For example, amplification can be DNA amplification or RNA amplification. The amplification method may be one requiring thermal cycling or one carried out isothermal. The amplification method includes polymerase chain reaction (PCR), nucleic acid sequence-based amplification (NASBA), ligase chain reaction (LCR), and strand substitution amplification (strand). displacement amplification; RCA). The amplification method may also include an RNA amplification method. For example, it may include reverse transcription (RT) or reverse transcription-PCR. Amplification may be to increase the number of copies of a target nucleic acid sequence or a sequence complementary thereto. “PCR” may be a method of amplifying a target nucleic acid from a primer pair that specifically binds to a target nucleic acid using a polymerase.

The composition may further contain known substances required for amplification of the target nucleic acid. For example, the composition may further contain a nucleic acid polymerase, a buffer necessary for its activity, a cofactor, and/or a substrate. The nucleic acid polymerase may be a DNA polymerase, an RNA polymerase, a reverse transcriptase, and a combination thereof. Reverse transcription may be the synthesis of a DNA strand complementary to an RNA sequence using RNA as a template.

The nucleic acid polymerase may have a strand displacement activity. For example, it may be one or more reverse transcriptases derived from retroviruses such as human immunodeficiency virus (HIV), murine leukemia virus (MMLV) and avian myeoloblastosis virus (AMV). The nucleic acid polymerase may be one that does not have 3'→5' exonuclease activity. The composition may be one containing a material required for reverse transcription or PCR amplification.

In addition, the present invention provides a method for detecting genetically modified corn into which the EPSPS gene is introduced, comprising the step of performing PCR on the genomic DNA of a sample using the primer set and analyzing the PCR product.

Specifically, it provides a method for detecting genetically modified corn into which the EPSPS gene is introduced, comprising the step of performing PCR on genomic DNA extracted from a sample using the primer set and analyzing a PCR product.

More specifically, the detection method,

1) extracting genomic DNA from the sample;

2) preparing a primer set including at least one primer pair selected from the group consisting of a first primer pair to a fourteenth primer pair;

3) using the DNA extracted in step 1) as a template, and performing a polymerase chain reaction (PCR) using the primer set of step 2); And

4) It may include the step of detecting the amplification product generated by the PCR of step 3).

In the present invention, the sample may be a sample obtained from genetically modified crops, such as genetically modified corn, containing or expected to contain the mEPSPS gene.

In the above detection method, all of the above descriptions can be applied to the sample, the primer pair (set) consisting of the nucleotide sequences of SEQ ID NOs: 1 to 19, and the PCR reaction.

The step of extracting genomic DNA from the sample in step 1) may use a commonly used genomic DNA extraction method, and is not particularly limited. In the present invention, the "genomic DNA" refers to DNA derived from or present in a chromosome.

In step 2), the first primer pair to the 14th primer pair consisting of the nucleotide sequences of SEQ ID NO:1 to SEQ ID NO:19 can specifically detect the EPSPS gene.

In step 3), the PCR may be a multiplex PCR, but is not limited thereto.

The PCR of step 3) may be performed at an annealing temperature of 50 to 65°C, and preferably, an annealing temperature may be performed at 60°C. The PCR reaction conditions may be performed under conventional conditions. In addition, the PCR and the multiple PCR reaction may be performed under the same conditions, for example, after initial denaturation is performed once at 96°C for 10 minutes, denaturation (30 seconds at 95°C), annealing (60 C. 40 seconds) and extension (60 seconds at 72° C.) were performed for a total of 30 cycles, and the final extension reaction may be performed at 72° C. for 5 minutes. For example, the primer pairs consisting of the nucleotide sequences of SEQ ID NOs: 1 to 19 may all have the same annealing temperature at 60° C. when performing PCR, and thus detection efficiency may be excellent when performing multiple PCR.

The amplification product of step 4) may be a 98 bp PCR product amplified by a primer set including at least one of the first primer pair to the third primer pair; A PCR product of 283 bp amplified by a primer set comprising at least one of the fourth to seventh primer pairs; A PCR product of 162 bp amplified by a primer set comprising at least one of the eighth primer pairs to the tenth primer pairs; Alternatively, it may be a PCR product of 80 bp amplified by a primer set including at least one of the eleventh primer pair to the fourteenth primer pair.

Thus, a PCR product of 98 bp is amplified by using a primer set comprising at least one of the first to third primer pairs;

A PCR product of 283 bp is amplified by using a primer set including at least one of the fourth to seventh primer pairs;

A PCR product of 162 bp is amplified using a primer set including at least one of the eighth primer pairs to the tenth primer pairs; or

When a PCR product of 80 bp is amplified using a primer set including at least one primer pair among the 11th to 14th primer pairs, it can be determined that the genetically modified corn into which the EPSPS gene is introduced in the sample is included. have.

The PCR product analysis may be performed by comparing the size of the PCR product by electrophoresis or by checking whether the PCR product is amplified or not.

The electrophoresis may use agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product, but the electrophoresis method is not limited thereto.

The term “amplification reaction” as used herein refers to a reaction to amplify a nucleic acid molecule. Various amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822), ligase chain reaction (LCR) ( 17, 18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) (19) (WO 88/10315), autologous Self-sustained sequence replication (20) (WO 90/06995), selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276), consensus sequence priming polymerase Consensus sequence primed polymerase chain reaction (CPPCR) (US Pat. No. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR) (US Pat. Nos. 5,413,909 and 5,861,245), nucleic acid Nucleic acid sequence based amplification (NASBA) (U.S. Patent Nos. 5,130,238, 5,409,818, 5,554,517, and 6,063,603), strand displacement amplification n) (21, 22) and loopmediated isothermal amplification; LAMP) 23, but is not limited thereto. Other amplification methods that can be used are described in US Pat. Nos. 5,242,794, 5,494,810, 4,988,617 and US 09/854,317.

In addition, the present invention provides a PCR kit for detecting genetically modified corn into which the EPSPS gene is introduced, including the primer set and a PCR reaction mixture thereof.

The PCR reaction mixture may include any well known in the art, and may include, for example, dNTP, DNA polymerase, and buffer, but is not limited thereto.

Advantages and features of the present invention, and a method of achieving them will become apparent with reference to embodiments described below in detail. However, the present invention is not limited to the embodiments disclosed below, but will be implemented in a variety of different forms, and only these embodiments are intended to complete the disclosure of the present invention, and to provide ordinary knowledge in the technical field to which the present invention pertains. It is provided to completely inform the scope of the invention to those who have it, and the invention is only defined by the scope of the claims.

When the primer set according to the present invention is used, since it is possible to simultaneously detect an inherent gene of genetically modified corn and an EPSPS gene introduced into the genetically modified corn, only genetically modified corn containing the EPSPS gene can be specifically detected.

Figure 1 shows the EPSP-synthase mRNA nucleotide sequence and intron site of corn ( Zea mays ) (①, ②, ③, ④ and ⑤ represent intron sites).
2 shows the result of mEPSPS detection using a gene-specific primer set for detecting the mEPSPS gene. (M: 1Kb DNA marker, lane 1-14: primer combinations using nucleotide sequences between ①, ②, ④ and ⑤ introns (No. 1-14 in Table 1), lane 15-17: primers using exon nucleotide sequences)
3 shows a structure-specific marker site for detection of mEPSPS gene. In FIG. 3, a red bar represents a structure-specific detection site, and GA21 is a representative variety of genetically modified corn containing mEPSPS.
Figure 4 shows the result of mEPSPS detection of genetically modified corn using the primer set according to the present invention. Figure 4 (A) is the result for the mEPSPS gene-specific primer set, (B) is the result for the mEPSPS structure-specific primer set. (M: 1Kb DNA marker, lane 1: unmodified soybean, lane 2: unmodified corn, lane 3: genetically modified corn (GA21), lane 4: genetically modified soybean (FG72), lane 5: genetically modified Soybean (Das44406-6), lane 6: genetically modified cotton (GHB614), N: no sample, ai: primers 1, 2, 4, 5, 7, 8, 9, 11 of Table 1 in order No. 13, jl: primer set of exon base sequence combination, mo: 1, 2 and 3 in Table 2 in order, p: combination primers 1, 2, and 3 in Table 2)
5 is a result of analyzing the detection limit of the primer for mEPSPS detection in genetically modified corn. 5A is a result of the mEPSPS gene specific primer set, and (B) is a result of the mEPSPS structure specific primer set. (M: 1Kb DNA marker, lane 1: 100%, lane 2: 5%, lane 3: 1%, lane 4: 0.5%, lane 5: 0.1%, lane 6: 0%, ai: in order of Table 1 1, 2, 4, 5, 7, 8, 9, 11 and 13, jl: No. 1, 2, and 3 in Table 2 in that order)
6 shows the detection results of genetically modified corn containing mEPSPS in feed using a primer for detecting mEPSPS in genetically modified corn. 6A is a result of the mEPSPS gene-specific primer set, and (B) is a result of the mEPSPS structure-specific primer set. (M: 1Kb DNA marker, lane 1: unmodified corn, lane 2: genetically modified corn (GA21), lane 3: genetically modified soybean (FG72), lane f1-f8: 8 animal feeds currently in circulation, ai : 1, 2, 4, 5, 7, 8, 9, 11 and 13 in Table 1 in order, jl: 1, 2, and 3 in Table 2 in order)

Hereinafter, examples will be described in detail to aid understanding of the present invention. However, the following examples are for illustrative purposes only, and the scope of the present invention is not limited to the following examples. The embodiments of the present invention are provided to more completely explain the present invention to those of ordinary skill in the art.

< Example 1> Plant material preparation and DNA extraction

To assay genetically modified corn, a standard material (Certified Reference Material, CRM) (AOCS, USA) of genetically modified crops (corn-GA21, soybean-FG72 and Das44406-6, cotton-GHB614) was purchased and used. DNA from corn and soybeans, which are non-GM crops, was used.

In addition, for the practical application of the detection method, animal feed was purchased and finely powdered, and then DNA was extracted and used for analysis. The DNA concentration of each sample was adjusted to 50 ng/µl to perform PCR.

For genomic DNA of each sample, 100 mg of each powder sample was obtained and extracted according to the method of the kit and reagents included in the DNA extraction kit (DNeasy Plant Mini Kit, Quiagen, Germany).

<Example 2> Preparation of mEPSPS gene-specific primers in genetically modified crops

PCR was performed on the GA21 variety, a genetically modified corn containing mEPSPS, using the nucleotide sequence information of corn-derived EPSP-synthase mRNA (NCBI Accession No. X63374). The PCR product obtained through the PCR was sequenced to analyze the nucleotide sequence of the internal mEPSPS gene. As a result, as shown in FIG. 1, five intron sites were identified in the entire nucleotide sequence of mEPSPS. At this time, the intron base size was identified as ① 98 bp, ② 283 bp, ③ 500 bp, ④ 162 bp, ⑤ 80 bp, and based on these nucleotide sequences, a gene-specific marker that can distinguish between the maize intrinsic nucleotide sequence and the introduced mEPSPS nucleotide sequence. Was selected (③, which is the largest intron site, was excluded from the following experiment). At this time, as a control group, a specific marker capable of distinguishing between the intrinsic maize nucleotide sequence and the introduced mEPSPS gene was prepared using both exon nucleotide sequences with each intron site in between.

Accordingly, it was confirmed whether or not gene-specific detection was performed on the corn GA21 variety through PCR analysis (FIG. 2). In this case, M in FIG. 2 refers to a 1Kb DNA marker, lanes 1 to 14 are combinations of primers including intron sites of ①, ②, ④, and ⑤, and lanes 15 to 17 are of primers in the exon sequence. It shows a combination.

As a result (FIG. 2), in the case of 14 primer combinations (lanes 1 to 14) using intron nucleotide sequences, both the maize intrinsic nucleotide sequence (marked with a yellow star) and the introduced mEPSPS nucleotide sequence (marked with a red star) were detected. The dog's major PCR product bands were clearly identified. On the other hand, in the case of primers (lanes 15 to 17) made using the exon sequence of mEPSPS, only a single PCR product band of the mEPSPS sequence was formed, so that the presence or absence of detection by the maize intrinsic sequence and the introduced mEPSPS sequence was confirmed. It was impossible.

primer NO. primer Combination SEQ ID NO. Base sequence (5'-3') One mEPSPS01#1-1 One CTGTTACTGCTGCTGGTGGA mEPSPS01#1-2 2 CAGTCAGTGCCAAGGAAACA 2 mEPSPS01#2-1 3 TACTGCTGCTGGTGGAAATG mEPSPS01#2-2 4 TGCCAAGGAAACAATCAACA 3 mEPSPS01#1-1 One CTGTTACTGCTGCTGGTGGA mEPSPS01#2-2 4 TGCCAAGGAAACAATCAACA 4 mEPSPS12#1-1 5 TGATTGTTTCCTTGGCACTG mEPSPS12#1-2 6 CTGATGGAGCCAGACAGCTT 5 mEPSPS12#2-1 7 TGTTTCCTTGGCACTGACTG mEPSPS12#2-2 8 CAATCTCCACATCCCCAAGA 6 mEPSPS12#2-1 7 TGTTTCCTTGGCACTGACTG mEPSPS12#3-2 9 ACATCCCCAAGAGCCAAAG 7 mEPSPS12#2-1 7 TGTTTCCTTGGCACTGACTG mEPSPS12#4-2 10 GACTGCTGATGGAGCCAGAC 8 mEPSPS34#1-1 11 CTCGGTCCATGTAACCTTCG mEPSPS34#1-2 12 CCTCAAGCGCAAGCTATTTC 9 mEPSPS34#2-1 13 ACGCTAGTCTCGGTCCATGT mEPSPS34#1-2 12 CCTCAAGCGCAAGCTATTTC 10 mEPSPS34#3-1 14 TAACCTTCGCTCCCATCATC mEPSPS34#1-2 12 CCTCAAGCGCAAGCTATTTC 11 mEPSPS45#1-1 15 ATGTCGCCATGACTCTTGCT mEPSPS45#1-2 16 AACCATCCTCTCGGTCTCCT 12 mEPSPS45#2-1 17 ATGACTCTTGCTGTGGTTGC mEPSPS45#1-2 16 AACCATCCTCTCGGTCTCCT 13 mEPSPS45#3-1 18 ACCTCAAGGCGATTGATGTC mEPSPS45#1-2 16 AACCATCCTCTCGGTCTCCT 14 mEPSPS45#4-1 19 TTGGGAGGAAACACCTCAAG mEPSPS45#1-2 16 AACCATCCTCTCGGTCTCCT

Meanwhile, in the case of genetically modified crops containing mEPSPS, since most of the introduced genes are inserted in the form of CTP-otp::mEPSPS, the site is selected as a construct-specific marker for gene detection. (Fig. 3 and Table 2). At this time, the structure-specific marker is presented as a comparison group of the gene-specific markers of the present invention, and FIG. 3 is a red bar indicating the site of the structure-specific marker for mEPSPS detection of the GA21 (corn) variety. will be.

primer Combination SEQ ID NO. Base sequence (5'-3') One tpEPSPS1-1 20 TTCGAGACGCTGTCGTACCT tpEPSPS1-2 21 GCTGCAGCACGATCTCCTC 2 tpEPSPS2-1 22 CGTTCCAGGGGCTCAAGT tpEPSPS2-2 23 GAGTAGGAGGATCCGGTTGG 3 tpEPSPS3-1 24 ACGGCAACAAGAAGTTCGAG tpEPSPS2-2 23 GAGTAGGAGGATCCGGTTGG

Genetically modified corn containing mEPSPS of the primer combinations selected for each intron position (①, ②, ④, and ⑤) among the 14 gene-specific primer combinations prepared previously, and the structure-specific primer combinations in Table 2 above The results of confirming the detection of are shown in FIG. 4.

As shown in Figure 4, in the case of the primer set according to the present invention (see a to i), the inherent nucleotide sequence of genetically modified corn (yellow arrow in Figure 4) and the nucleotide sequence of the introduced mEPSPS (red arrow in Figure 4) It can be seen that two detection bands for) are formed. On the other hand, in corn that was not genetically modified, only one detection band for the intrinsic sequence site of corn was shown. In addition, even in the case of a primer produced using only the exon sequence of the mEPSPS gene, as shown in j to l, one detection band for the intrinsic sequence of corn was detected even in unmodified corn, so that the mEPSPS gene was It can be seen that it is not possible to specifically detect only genetically modified corn containing. In addition, in the case of the structure-specific primers of the mEPSPS gene and the tp sequence (Fig. 4 (B), m to p), genetically modified crops containing the mEPSPS gene (soybean-FG72, Das44406-6 and cotton-GHB614) Regarding, it was confirmed that only the mEPSPS gene was not specifically detected through the formation of only one detection band for the structural sequence of the introduced mEPSPS gene site.

<Example 3> PCR analysis using EPSPS gene-specific primers

PCR was performed using the combination of gene-specific primers selected in Example 2. PCR analysis was performed using a multiple PCR premix (including Hotstart Top DNA polymerase, Reaction buffer, and dNTPs, Bioneer, Korea) to prepare a sample. A total of 20 µl of the reaction solution per sample was used, and each 10 µM of forward and reverse primers and 50 ng/µl of template DNA extracted in Example 1 were used as basic reactions. PCR conditions were initially performed at 95° C. for 10 minutes, followed by a total of 30 cycles repeated at 95° C. for 30 seconds, 60° C. for 40 seconds, and 72° C. for 1 minute. As a final step, a DNA amplification reaction was performed in a gene amplifier (TProfessional Thermocycler, Biometra, Germany) for 5 minutes at 72°C. The amplified PCR product was developed on a 2% agarose gel using an electrophoresis device and then confirmed under ultraviolet light (UV).

<Example 4> Measurement of the limit of detection (LOD) of PCR

In the assay of genetically modified crops, if the DNA in the sample is unintentionally present in a trace amount, detection may be difficult. Therefore, the limit of detection (LOD) was checked to confirm the actual detectable concentration range. The reaction for the detection limit was GA21, a representative genetically modified corn variety including mEPSPS, and 50 ng/µl of DNA extracted in Example 1 was used as the template DNA. The DNA concentration of each detection item standard was analyzed at different levels of 0%, 0.1%, 0.5%, 1%, 5% and 100%.

As a result, as shown in FIG. 5, it was found that detection was possible up to 0.1% in some primer combinations, and detection products were clearly identified up to 0.5% in both the overall selected gene-specific primer and structure-specific primer combination. Therefore, it can be seen that the 3% domestic labeling system and the 0.9% range in Europe can be sufficiently satisfied.

<Example 5> Confirmation of detection of mEPSPS in genetically modified crops in livestock feed

For practical application of the PCR technology according to the present invention, 8 kinds of animal feed distributed in Korea were randomly selected and analyzed. In the case of animal feed used as a material, since the premium mixture contains various crops and contains genetically modified crops approved for domestic import, it is possible to confirm the presence or absence of the mEPSPS of the primer according to the present invention in the complex material. This is a good way to check practical applicability. PCR was performed in the same manner as in the positive control conditions of Example 3, and 50 ng/µl of DNA extracted in Example 1 was used as the template DNA.

As a result (Fig. 6), the primer set according to the present invention was able to clearly confirm not only the identification of the mEPSPS gene introduced into the feed, but also the presence or absence of corn raw materials. On the other hand, it was confirmed that no mEPSPS gene reaction product was shown for corn that was not genetically modified (refer to the red circle in FIG. 6). That is, it is possible to distinguish the use of genetically modified corn containing mEPSPS or genetically modified crops containing mEPSPS in the mixed sample, and thus efficient discrimination characteristics and various uses of the primer set according to the present invention were confirmed.

As described above, it was confirmed that the primer set according to the present invention can specifically detect genetically modified corn containing the mEPSPS gene, and can identify genetically modified corn containing mEPSPS even in a low concentration sample. Accordingly, the primer set according to the present invention is the detection of indigenous genetically modified crops in the environment due to the unintentional environmental release of genetically modified corn, confirmation of the surrounding environment of the agricultural genetically modified crop processing plant and the farm using feed, the history of the genetically modified crop As it can be effectively used for tracking, it can be applied as a safety management technology for environmental monitoring.

<110> Republic of Korea <120> Primer set, composition and kit for detecting genetically modified crops introduced EPSPS gene, and methods using the same <130> P18R12C0677 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS01#1-1 <400> 1 ctgttactgc tgctggtgga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS01#1-2 <400> 2 cagtcagtgc caaggaaaca 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS01#2-1 <400> 3 tactgctgct ggtggaaatg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS01#2-2 <400> 4 tgccaaggaa acaatcaaca 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS12#1-1 <400> 5 tgattgtttc cttggcactg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS12#1-2 <400> 6 ctgatggagc cagacagctt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS12#2-1 <400> 7 tgtttccttg gcactgactg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS12#2-2 <400> 8 caatctccac atccccaaga 20 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS12#3-2 <400> 9 acatccccaa gagccaaag 19 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS12#4-2 <400> 10 gactgctgat ggagccagac 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS34#1-1 <400> 11 ctcggtccat gtaaccttcg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS34#1-2 <400> 12 cctcaagcgc aagctatttc 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS34#2-1 <400> 13 acgctagtct cggtccatgt 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS34#3-1 <400> 14 taaccttcgc tcccatcatc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS45#1-1 <400> 15 atgtcgccat gactcttgct 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS45#1-2 <400> 16 aaccatcctc tcggtctcct 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS45#2-1 <400> 17 atgactcttg ctgtggttgc 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS45#3-1 <400> 18 acctcaaggc gattgatgtc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mEPSPS45#4-1 <400> 19 ttgggaggaa acacctcaag 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tpEPSPS1-1 <400> 20 ttcgagacgc tgtcgtacct 20 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> tpEPSPS1-2 <400> 21 gctgcagcac gatctcctc 19 <210> 22 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> tpEPSPS2-1 <400> 22 cgttccaggg gctcaagt 18 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tpEPSPS2-2 <400> 23 gagtaggagg atccggttgg 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> tpEPSPS3-1 <400> 24 acggcaacaa gaagttcgag 20

Claims (6)

SEQ ID NO: a first primer pair consisting of the nucleotide sequences of 1 and 2;
A second primer pair consisting of the nucleotide sequences of SEQ ID NO: 3 and 4;
A third primer pair consisting of the nucleotide sequences of SEQ ID NO: 1 and 4;
A fourth primer pair consisting of the nucleotide sequences of SEQ ID NO: 5 and 6;
A fifth primer pair consisting of the nucleotide sequences of SEQ ID NO: 7 and 8;
A sixth primer pair consisting of the nucleotide sequences of SEQ ID NO: 7 and 9;
A seventh primer pair consisting of the nucleotide sequences of SEQ ID NO: 7 and 10;
An eighth primer pair consisting of the nucleotide sequences of SEQ ID NO: 11 and 12;
The ninth primer pair consisting of the nucleotide sequences of SEQ ID NO: 13 and 12;
The tenth primer pair consisting of the nucleotide sequences of SEQ ID NO: 14 and 12;
The eleventh primer pair consisting of the nucleotide sequences of SEQ ID NO: 15 and 16;
The twelfth primer pair consisting of the nucleotide sequences of SEQ ID NO: 17 and 16;
The thirteenth primer pair consisting of the nucleotide sequences of SEQ ID NO: 18 and 16; And
SEQ ID NO: a 14th primer pair consisting of the nucleotide sequences of 19 and 16; a primer set for detecting genetically modified corn into which the EPSPS gene has been introduced. A composition for detecting genetically modified corn into which the EPSPS gene comprising the primer set of claim 1 is introduced. A method for detecting genetically modified corn into which the EPSPS gene is introduced, comprising the step of performing PCR on the genomic DNA of the sample using the primer set according to claim 1 or 2 and analyzing the PCR product. The method of claim 3,
A PCR product of 98 bp is amplified using a primer set comprising a first primer pair to a third primer pair;
A PCR product of 283 bp was amplified using a primer set comprising the fourth primer pair to the seventh primer pair;
A PCR product of 162 bp was amplified using a primer set comprising an eighth primer pair to a tenth primer pair;
When a PCR product of 80 bp is amplified using a primer set including the eleventh primer pair to the fourteenth primer pair, detection method of transgenic corn into which the EPSPS gene is determined to contain the EPSPS gene in the sample . A PCR kit for detecting genetically modified corn into which an EPSPS gene comprising a primer set according to claim 1 and a PCR reaction mixture thereof is introduced. The method of claim 5,
The PCR reaction mixture is a PCR kit for detecting genetically modified corn into which the EPSPS gene including dNTP, DNA polymerase and buffer is introduced.

Images