KR102146666B1 - Primer set for loop-mediated isothermal amplification reaction for detection of Mycobacterium tuberculosis - Google Patents

Abstract

The present invention relates to a primer set for detecting Mycobacterium tuberculosis, including a primer consisting of a nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 6.

Description

Primer set for loop-mediated isothermal amplification reaction for detection of Mycobacterium tuberculosis}

The present invention relates to a primer set for isothermal amplification reaction for detecting Mycobacterium tuberculosis, and more particularly, to a primer set for isothermal amplification reaction capable of specifically detecting Mycobacterium tuberculosis, a composition and a kit comprising the same. .

Tuberculosis (TB) is a droplet infectious disease caused by Mycobacterium tuberculosis (MTB), which is one of the leading causes of infectious disease deaths that have resulted in millions of deaths over the past centuries. It is also estimated to be 10 million new cases and about 2 million deaths each year.

Conventional tuberculosis detection methods include chest radiology, swab culturing, Mantoux, and bacterial microscopy (Bacterioscopy). As such, there are several methods for detecting tuberculosis, but it takes a long time and the method is difficult, requiring an experienced tester and advanced laboratory infrastructure. Therefore, there are limitations in areas where specialized medical services are not available or where it is necessary to perform a large number of screening tests in a short period of time.

On the other hand, there has been a study of a new method for the detection of molecular tuberculosis based on the detection of DNA, protein and peptide of MTB, and some of these methods have been successfully implemented and currently commercialized.

However, in the molecular diagnosis of tuberculosis using the PCR technique, there is a problem that a long time of 110-150 minutes is basically required to obtain the test result. Meanwhile, loop-mediated isothermal amplification (LAMP), a molecular diagnostic technique that has recently attracted attention, recognizes 8 different sites using 6 complementary primers to the template and proceeds with gene amplification, so there is no change in temperature. Compared to the conventional gene amplification method PCR, the consumption time can be shortened. When isothermal amplification is used, it typically consumes 60-80 minutes.

Korean Patent Registration No. 0950495

Under this background, the present inventors have developed a primer set for an isothermal amplification reaction capable of rapidly detecting Mycobacterium tuberculosis while maintaining diagnostic accuracy.

Accordingly, an object of the present invention is to provide a primer set specifically binding to the DNA sequence of Mycobacterium tuberculosis, a Mycobacterium tuberculosis, a composition and a kit comprising the same.

However, the problem to be solved by the present invention is not limited to the problems mentioned above, and other problems that are not mentioned will be clearly understood by those of ordinary skill in the art from the following description.

According to an embodiment of the present invention, there is provided a primer set for detecting Mycobacterium tuberculosis, including a primer consisting of a nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 6.

According to one side, it may be for loop-mediated isothermal amplification.

According to another embodiment of the present invention, a composition for diagnosing tuberculosis comprising the primer set is provided.

According to another embodiment of the present invention, there is provided a tuberculosis diagnostic kit comprising the primer set.

According to one side, it may further include a reagent for performing the isothermal amplification reaction.

According to another embodiment of the present invention, extracting a nucleic acid from the separated biological sample; Amplifying the target sequence of the Gyr B gene by processing a primer set including primers consisting of the nucleotide sequences of SEQ ID NOs: 1 to 6; And determining whether or not Mycobacterium tuberculosis is infected from the amplified product. A method for detecting Mycobacterium tuberculosis including a is provided.

According to one side, the biological sample may be sputum, bronchial aspiration and bronchial washing, body fluid, blood, saliva, urine, or cerebrospinal fluid.

According to one side, the amplification may be performed by an isothermal amplification reaction.

According to one side, the isothermal amplification reaction may be performed at 60°C to 65°C.

According to one side, the isothermal amplification reaction may be a one-step LAMP, a real-time LAMP, or a combination thereof.

The primer set of the present invention not only exhibits high sensitivity and accuracy, but also uses an isothermal amplification method, so there is no need for an electrophoresis process to check whether a sample is infected with tuberculosis. It can be diagnosed as and there are few restrictions on the devices used.

The effects of the present invention are not limited to the above effects, and should be understood to include all effects that can be deduced from the configuration of the invention described in the detailed description or claims of the present invention.

1 is a diagram showing position information of a target sequence detected by the primer set of the present invention.
2 is a graph showing the results of a sensitivity test according to the Mycobacterium tuberculosis copy number after performing an isothermal amplification reaction using the primer set of the present invention.
3 is a result of confirming the mutual reaction between Mycobacterium tuberculosis and non-tuberculosis Mycobacterium (NTM) after performing an isothermal amplification reaction using the primer set of the present invention.
4 is a table and a graph showing experimental results comparing an existing primer set targeting the same gene (Gyr B) with the primer set of the present invention.
5 is a table and graph showing experimental results comparing the detection limits of the existing primer set targeting the same gene (Gyr B) and the primer set of the present invention.

Hereinafter, exemplary embodiments will be described in detail with reference to the accompanying drawings. However, since various changes may be made to the embodiments, the scope of the rights of the patent application is not limited or limited by these embodiments. It should be understood that all changes, equivalents, or substitutes to the embodiments are included in the scope of the rights.

The terms used in the examples are used for illustrative purposes only and should not be interpreted as limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. In the present specification, terms such as "comprise" or "have" are intended to designate the presence of features, numbers, steps, actions, components, parts, or combinations thereof described in the specification, but one or more other features. It is to be understood that the presence or addition of elements or numbers, steps, actions, components, parts, or combinations thereof, does not preclude in advance.

Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which the embodiment belongs. Terms such as those defined in a commonly used dictionary should be interpreted as having a meaning consistent with the meaning in the context of the related technology, and should not be interpreted as an ideal or excessively formal meaning unless explicitly defined in this application. Does not.

In addition, in the description with reference to the accompanying drawings, the same reference numerals are assigned to the same components regardless of the reference numerals, and redundant descriptions thereof will be omitted. In describing the embodiments, when it is determined that a detailed description of related known technologies may unnecessarily obscure the subject matter of the embodiments, the detailed description thereof will be omitted.

The present inventors fabricated a primer set based on an isothermal amplification method that significantly shortened the time required for analysis of results compared to technologies based on detection methods such as conventional PCR and real time PCR. According to the examples described below, it was confirmed that the primer set of the present invention can obtain a detection result within a faster time than the conventional primer set for LAMP, and has higher sensitivity.

Moreover, the method for detecting Mycobacterium tuberculosis using the primer set of the present invention performs an amplification reaction at isothermal temperature without a change in temperature, so it is also suitable for testing using a simple and lightweight device.

Accordingly, according to an embodiment of the present invention, there is provided a primer set for detecting Mycobacterium tuberculosis, including a primer consisting of a nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 6.

In the present invention, the term'primer' is a nucleic acid sequence having a short free 3'terminal hydroxyl group, which can form a complementary template and a base pair, and It refers to a short nucleic acid sequence that functions as a starting point. These primers can initiate DNA synthesis in the presence of four different NTPs (nucleoside triphospates) from reagents for polymerization (DNA polymerase or reverse transcriptase) at an appropriate buffer solution and at an appropriate temperature.

In addition, the primer pairs constituting the primer set of the present invention each amplify only a specific gene fragment, and the amplification of each gene fragment is sufficient for the analysis of the next step, and each gene region can be simultaneously amplified without interference between primers. I can.

According to another embodiment of the present invention, a composition for diagnosing tuberculosis comprising the primer set is provided.

According to another embodiment of the present invention, there is provided a tuberculosis diagnostic kit comprising the primer set.

Meanwhile, the tuberculosis diagnostic kit may further include a reagent for performing an isothermal amplification reaction. For example, it may include an amplification reaction mixture consisting of DNA polymerase, dNTP (dATP, dCTP, dGTP, dTTP), reaction buffer, distilled water, etc., and may be prepared as a plurality of separate packaging including such reagent components. . In addition, it goes without saying that the kit of the present invention may additionally include a user's manual describing the optimum reaction performance conditions.

According to another embodiment of the present invention, extracting a nucleic acid from the separated biological sample; Amplifying the target sequence of the Gyr B gene by treating a primer set including primers consisting of the nucleotide sequences of SEQ ID NOs: 1 to 6; And determining whether or not Mycobacterium tuberculosis is infected from the amplified product. A method for detecting Mycobacterium tuberculosis including a is provided.

In the present invention, the biological sample may be sputum, bronchial aspiration and bronchial washing, body fluid, blood, saliva, urine, or cerebrospinal fluid. It is not limited.

In addition, the nucleic acid extracted from the biological sample is a nucleic acid including all or part of a target gene in which a genetic marker of an infectious bacteria to be detected is present, and may be DNA. A method known in the art may be used as a method for extracting a nucleic acid from a biological sample.

The amplification may be performed by a loop-mediated isothermal amplification (LAMP) reaction, and may be performed at 60°C to 65°C, more preferably 62°C to 65°C. Specifically, the isothermal amplification reaction may use a one-step LAMP, a real-time LAMP, or a combination thereof.

The isothermal amplification method is similar to the conventional PCR method, but the conventional PCR method requires a change in temperature while going through three steps: denaturation, annealing, and extension. Kidney is possible. This is the Taq. Bst instead of DNA polymerase. DNA polymerase is used, and a loop structure (stem-loop DNA) is created at the primer binding site from four primers that are combined by selecting 6 parts from the target DNA strand, and amplifying DNA through chain replacement reaction. It's a technique. Bst. DNA polymerase is the Taq. Unlike DNA polymerase, it has a characteristic of 5'→exonuclease, so the double helix structure of DNA is not denatured by heat, and conjugation and extension are performed at a junction temperature close to the Tm value.

Hereinafter, the present invention will be described in more detail through examples. The following examples are described for the purpose of illustrating the present invention, and the scope of the present invention is not limited thereto.

Example 1: Securing Mycobacterium tuberculosis DNA

Nucleic acid (DNA) samples of Mycobacterium tuberculosis bacteria extracted from sputum and bronchial aspirate of tuberculosis patients were obtained at Korea University Guro Hospital, and the infection of each sample was clinically confirmed at the hospital.

Example 2: For detection of Mycobacterium tuberculosis primer Design of set

Table 1 below shows the sequence of a primer set for detecting Mycobacterium tuberculosis bacteria designed with the primer explorer v5.0 (Eiken, Japan) program based on the base sequence of the Mycobacterium tuberculosis bacteria.

Sequence number division Base sequence (5'-3') Target gene Length One F3 GCGATATCTGGTGGTCTGCA Gyr B 20 2 B3 CCGTGGTTTCGAAAACAGC 19 3 FIP ACCCGTCGCGCTTGATCTCGTCGGCGTGTCGGTGGTTA 38 4 BIP GAGAAGTCGGAACCCCTGGGCGCACCGTTGACCCCGT 37 5 BLP TTCGAGCCGGGTGGATAGC 19 6 FLP AGGGGCGCCGACCAAGAA 18

Example 3: For LAMP Composition and reaction conditions

The detection of Mycobacterium tuberculosis using LAMP performed in the following examples was performed using the Loopamp DNA Amplification kit of EIKEN. The reagent composition of the reaction mixture for real-time LAMP and the reaction conditions and time of real-time LAMP are as shown in Tables 2 and 3, respectively.

LAMP component division volume 2X Reaction buffer 12.5 μl Enzyme buffer 1 μl Fluorescent dye 1 μl Primer
(FIP, BIP, FLP, BLP) Each final concentration
800 nM Primer (F3, B3) Each final concentration 100 nM Distilled water 7.5 μl Template DNA 2 μl Total volum 25 μl

2X Reaction Buffer, Enzyme, and fluorescent dye were purchased from EIKEN.

Lamp temperature condition and time 65℃ 1 min 60 cycle 80℃ 5 min Total reaction time 75 min

Example 4: detection limit test

In order to confirm the detection limit, the DNA sequence containing the target gene was synthesized, and the Copy No. was measured, and then diluted with distilled water without the presence of DNA degrading enzyme. The nucleic acid used in the test was stored at -50°C when not in use. Each prepared positive control was diluted from the concentration of 1×10 ⁹ Copies/rxn to 10 ⁰ to check the sensitivity, and the results are shown in Table 4 and FIG. 2.

As a result, as a result of verifying the analysis capability by concentration using a tenth dilution factor for Synthesis DNA (positive control material) synthesized from the nucleoprotein portion of the Mycobacterium tuberculosis gene, the detection limit at which amplification is confirmed at 10 ¹ copy was reduced. Confirmed to be visible.

No. Copies/rxn Ct value Mycobacterium tuberculosis One 10 ⁹ 9.33 2 10 ⁸ 10.25 3 10 ⁷ 11.45 4 10 ⁶ 13.18 5 10 ⁵ 14.24 6 10 ⁴ 16.42 7 10 ³ 17.72 8 10 ² 33.90 9 10 ¹ 45.38 10 10 ⁰ N/A

Example 5: cross reaction test

In order to confirm the specific reaction for each sequence of Mycobacterium tuberculosis bacteria of the real-time LAMP targeting the DNA sample extracted in Example 1, cross-reaction with the sequence of NTM bacteria was performed, and detection according to the cross-reaction Ct values and relative fluorescence units (RFU) are shown in Table 5 and FIG. 3.

As a result, as shown in Table 5 and Fig. 3, it was confirmed that the results for the cross-reaction and non-specific reaction did not appear.

Mycobacterium tuberculosis Sample Ct. value MTB 15.04 NTM N/A non-infected human gDNA N/A D.W N/A

* MTB-Mycobacterium tuberculosisNTM-Non-tuberculosis Mycobacterium

Example 6: Confirmation of clinical specimen

Clinical trials were conducted with 20 MTBs, 20 NTMs, 20 negative tuberculosis, and 60 specimens obtained from Korea University Guro Hospital. Real-time LAMP was performed on the extracted DNA sample to confirm the detection result of Mycobacterium tuberculosis, and the result is shown in Table 6 below, and it was found that the result was the same as the in-house PCR result.

Sample No. In-house PCR results LAMP Ct<40 Ct<30 MTB One 35.6 24.98 2 27.0 14.67 3 33.3 18.51 4 22.7 13.39 5 31.0 16.48 6 30.9 16.20 7 18.3 11.32 8 28.0 14.91 9 30.8 16.12 10 36.7 19.99 11 28.4 15.34 12 34.7 18.72 13 30.3 17.07 14 39.1 20.67 15 34.8 18.59 16 30.7 15.65 17 22.4 11.43 18 39.2 22.34 19 32.1 18.90 20 31.4 16.13 Sample NO. In-house PCR results LAMP Ct<40 Ct<30 NTM One N/A N/A 2 N/A N/A 3 N/A N/A 4 N/A N/A 5 N/A N/A 6 N/A N/A 7 N/A N/A 8 N/A N/A 9 N/A N/A 10 N/A N/A 11 N/A N/A 12 N/A N/A 13 N/A N/A 14 N/A N/A 15 N/A N/A 16 N/A N/A 17 N/A N/A 18 N/A N/A 19 N/A N/A 20 N/A N/A Sample NO. In-house PCR results LAMP Ct<40 Ct<30 Tuberculosis negative One N/A N/A 2 N/A N/A 3 N/A N/A 4 N/A N/A 5 N/A N/A 6 N/A N/A 7 N/A N/A 8 N/A N/A 9 N/A N/A 10 N/A N/A 11 N/A N/A 12 N/A N/A 13 N/A N/A 14 N/A N/A 15 N/A N/A 16 N/A N/A 17 N/A N/A 18 N/A N/A 19 N/A N/A 20 N/A N/A

Example 7: existing primer Comparison of detection time with set (clinical sample)

Three MTBs, 3 NTMs, 3 tuberculosis negatives, and 9 samples obtained from Korea University Guro Hospital were used to perform clinical trial comparison between the primer set of the present invention and the existing primer set (Bionia Co., Ltd., Korea). . Real-time LAMP was performed on the extracted DNA sample to confirm the detection result of Mycobacterium tuberculosis, and the results are shown in Table 7 and FIG. 4.

As shown in Table 7 and FIG. 4, it was confirmed that the Ct value of the primer set of the present invention was measured approximately twice as fast in both the clinical specimen and the positive control group compared to the conventional primer set.

Sample Ct value preceding The present invention MTB1 29.23 15.43 MTB2 34.22 17.53 MTB3 23.44 12.40 NTM1 N/A N/A NTM2 N/A N/A NTM3 N/A N/A TB-Negative1 N/A N/A TB-Negative2 N/A N/A TB-Negative3 N/A N/A Positive control 18.02 9.16 Non-infected human gDNA
(Negative control) N/A N/A D.W. N/A N/A

Example 8: existing primer Detection limit comparison with set

Using the same Mycobacterium tuberculosis (MTB) culture sample as in Example 7, the detection limits of the primer set of the present invention and the existing primer set were compared. The concentration of the sample was 113.6 ng, diluted to 10 ^-5 to compare the sensitivity, and the results are shown in Table 8 and FIG. 5.

As shown in Table 8 and FIG. 5, the existing primer set at a concentration of 113.6 ng (stock solution) took about twice as long as the Ct value was measured, compared to the primers of the present invention, and a low concentration sample diluted 10 times. Did not detect tuberculosis bacteria. On the other hand, when the tuberculosis primer set of the present invention was used, the detection result was obtained about twice as fast in the stock solution as compared to the existing primer set, and even in the sample diluted 10 times, the Ct value of a similar value to that of the stock solution was quickly detected.

Sample Ct value preceding The present invention MTB stock solution (113.6 ng) 34.83 17.69 10 ^-1 N/A 18.08 10 ^-2 N/A N/A 10 ^-3 N/A N/A 10 ^-4 N/A N/A 10 ^-5 N/A N/A Positive control 17.62 9.10 Non-infected human gDNA
(Negative control) N/A N/A D.W. N/A N/A

As described above, although the embodiments have been described by the limited drawings, a person of ordinary skill in the art can apply various technical modifications and variations based on the above. For example, even if the described techniques are performed in a different order from the described method, and/or the described components are combined or combined in a form different from the described method, or are replaced or substituted by other components or equivalents. Appropriate results can be achieved.

Therefore, other implementations, other embodiments and claims and equivalents fall within the scope of the following claims.

<110> KOREA UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> Primer set for loop-mediated isothermal amplification reaction for detection of Mycobacterium tuberculosis <130> APC-2018-0570 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GryB_F3 <400> 1 gcgatatctg gtggtctgca 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GryB_B3 <400> 2 ccgtggtttc gaaaacagc 19 <210> 3 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> GryB_FIP <400> 3 acccgtcgcg cttgatctcg tcggcgtgtc ggtggtta 38 <210> 4 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> GryB_BIP <400> 4 gagaagtcgg aacccctggg cgcaccgttg accccgt 37 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GryB_BLP <400> 5 ttcgagccgg gtggatagc 19 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> GryB_FLP <400> 6 aggggcgccg accaagaa 18

Claims (10)

A primer set for detecting Mycobacterium tuberculosis, comprising a primer consisting of a nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 6.
The method of claim 1,
For loop-mediated isothermal amplification, primer set.
A composition for diagnosing tuberculosis, comprising the primer set of claim 1.
A kit for diagnosing tuberculosis, comprising the primer set of claim 1.
The method of claim 4,
A kit for diagnosing tuberculosis, further comprising a reagent for performing an isothermal amplification reaction.
Extracting a nucleic acid from the separated biological sample;
Amplifying the target sequence of the Gyr B gene by processing a primer set including primers consisting of the nucleotide sequences of SEQ ID NOs: 1 to 6; And
Determining whether or not Mycobacterium tuberculosis is infected from the amplified product; Containing, the method for detecting Mycobacterium tuberculosis.
The method of claim 6,
The biological sample is sputum, bronchial aspiration and bronchial washing, body fluid, blood, saliva, urine, or cerebrospinal fluid, a method for detecting Mycobacterium tuberculosis.
The method of claim 6,
The amplification is performed by an isothermal amplification reaction, the method for detecting Mycobacterium tuberculosis.
The method of claim 8,
The isothermal amplification reaction is carried out at 60 to 65 ℃, the method for detecting Mycobacterium tuberculosis.
The method of claim 8,
The isothermal amplification reaction is a single-step (one-step) LAMP, real-time (real-time) LAMP, or a combination thereof, a method for detecting Mycobacterium tuberculosis.

Images