KR102141703B1 - Molecular marker for selecting tomato cultivars resistant to tomato Bacterial wilt and selection method using the same marker - Google Patents

Abstract

The present invention relates to a marker for determination of an entity resistant to Fusarium wilt on tomatoes, and a selection method of an entity resistant to Fusarium wilt on tomatoes using the same. Since the marker of the present invention can be amplified to select the entity resistant to Fusarium wilt on tomatoes, the maker can be usefully used for selection and breeding of tomatoes having resistance to fusarium wilt.

Description

Molecular marker for selecting tomato cultivars resistant to tomato Bacterial wilt and selection method using the same marker}

The present invention relates to a marker for selecting a tomato foot disease-resistant individual and a method for selecting a tomato foot disease-resistant individual using the marker.

Tomato is a high value-added global vegetable crop with a global market value of about 1 trillion won, and the domestic market has grown to 27.1 billion in 2017 due to increased consumption of tomatoes. Occupy.

On the other hand, foot disease, a major disease that threatens the stable production of tomatoes in domestic and foreign tomato growers, is caused by the soil-borne bacteria Ralstonia solanacearum . Pathogens invade tomatoes through the natural opening of wounds or roots, and when the roots grow horizontally in the sack, they infect the throat tissue, blocking the flow of water from the vascular system of susceptible plants. To control this deadly disease, seed companies are putting a lot of effort into screening and breeding resistant tomatoes. Conventional screening and breeding methods based on phenotypes have disadvantages that require a lot of time and money, and many studies have been conducted to improve the screening efficiency using DNA molecular markers.

The DNA molecule marker is a specific sequencing fragment capable of determining polymorphism on the genome of a species, and has the advantage of being fast and accurate because it is not affected by the cultivation environment and the growth stage of the crop compared to the phenotype-based method. . In the case of tomatoes, there is a high demand for Marker Assisted Selection (MAS) technology through the development of molecular markers to select individuals resistant to multiple diseases, and research is actively being conducted. However, the molecular markers for the resistance to foot disease developed in the past are being used in a limited way in the breeding field, so it is necessary to discover new resistance genes and develop molecular markers.

Korean Registered Patent No. 1970264

An object of the present invention is to provide a tomato foot disease resistance marker.

Another object of the present invention is to provide a composition for selecting a tomato foot blight resistant individual.

Another object of the present invention is to provide a kit for selecting a tomato foot blight resistant individual.

Another object of the present invention is to provide a method for selecting a tomato foot disease-resistant individual.

1. In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, the 231st base is C or T, and the polynucleotide composed of 10 to 450 consecutive bases containing the 231st base or a polynucleotide complementary thereto Tomato foot disease resistance marker.

2. In the above 1, when the 231st base is T, the tomato foot disease resistance marker is to be determined to be tomato foot disease resistance tomato.

3. Composition for selecting a tomato foot disease-resistant individual comprising an agent capable of amplifying the marker of 1 above.

4. The composition of 3 above, wherein the agent is a primer set consisting of the polynucleotides of SEQ ID NO: 2 and SEQ ID NO: 3, and tomato foot blight resistance.

5. In the above 3, in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, the 241 base is C or T, and the polynucleotide consisting of 10 to 450 consecutive bases including the 241 base or the same A composition for screening a foot disease-resistant individual, further comprising an agent capable of amplifying a tomato foot disease-resistant second marker comprising a complementary polynucleotide.

6. The composition of 5 above, wherein the agent capable of amplifying the second marker is a primer set consisting of polynucleotides of SEQ ID NO: 5 and SEQ ID NO: 6, and tomato foot blight resistance.

7. A kit for screening tomato foot disease-resistant individuals comprising the composition of the above 3.

8. Amplifying a first polymorphic site comprising SNP of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 or a complementary polynucleotide thereof from DNA isolated from a tomato sample; And determining the base of the amplified first polymorphic site.

9. In the above 8, when the 231st base of the polynucleotide of SEQ ID NO: 1 is T, tomato foot disease resistance individual screening method to determine that it is a foot disease resistant tomato.

10. The method of 8 above, amplifying a second polymorphic site comprising SNP of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 or a complementary polynucleotide thereof from the DNA; And determining the base of the amplified second polymorphic site.

11. In the above 10, when the 231st base of the polynucleotide of SEQ ID NO: 1 is T, and the 241th base of the polynucleotide of SEQ ID NO: 4 is T, it is said that one of the two has higher foot disease resistance than T Judging how to judge tomato foot disease resistant individuals.

The present invention relates to a composition comprising a tomato foot disease resistance marker and an agent capable of amplifying it, and can be usefully used for selecting and breeding tomatoes having foot disease resistance.

1 shows the step-by-step severity of foot disease in tomato seedlings.
Figure 2 shows the frequency distribution of the foot disease severity of 192 points tomato confirmed through the first analysis and the second analysis.
3 shows the results of Bayesian clustering analysis for evaluating the structure of a population.
4 shows the structure of the population estimated at 192 point tomatoes.
Figure 5 shows the Manhattan plots (Manhattan plots) showing the association between genomic SNPs and foot blight resistance confirmed through the primary analysis and secondary analysis.
6 shows the physical map location of QTL candidates for foot blight resistance across 12 chromosomes.
7 shows data confirming alleles favorable to SNPs sjs2705, sjs2707 and sjs7794 associated with foot blight resistance.
8 shows agarose gels showing the three CAPS markers sjs2705 (SspI), sjs2707 (BfaI) and sjs7794 (BsaAI) genotypes for the F1 tomato variety.

Hereinafter, the present invention will be described in detail.

The present invention is a polynucleotide consisting of five or more consecutive nucleotides comprising a single nucleotide polymorphism (SNP) position (231st of SEQ ID NO: 1) base in a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 or a polynucleotide complementary thereto It provides a tomato foot disease resistance marker comprising a.

Sequence of SEQ ID NO: 1 are as follows, in this specification expressed in a polynucleotide of SEQ ID NO: 1, the nucleotide of the SNP position to Y: GCTACAGGAGGAGGACAACTTCGTTTGTTTGTAGTTTTCAACAAAGGGTTGGCTCTTTCGGCAGATGTCCTGACAGTAACTTCCGCAACTTGTTGAGCAGGTTTTGGCAAGTGCTTCTCTTTGGATACTGATATTTCACCTTGCACACCCTTTTTAGACAATCTAATTCTGATAATGCTACCTATTGTCGAGCAGCAAAACTTCAGATTAGCAACAGATAAAACATAACAYTAGACCAAAATAGTAAGTATTATATATAAAGGGAAAGAACTACCATGCGCCTGTATGCCACCTCGTGAAGGTGAAGGTGAAGTAGGCCTCTTCCTTTTATTACTGTTCTGGGTGCTGTCGGATGAGCAGCTGGAATTCTGTGAACACACAGCAGGCTCATGTTCCTCAGTGAGATTGCTCCTCTCCAACTGCTCAGGTTCA (SEQ ID NO: 1).

The marker of the present invention can be used for tomato foot disease resistance screening is based on that the 231st base (Y) in the nucleotide sequence represented by SEQ ID NO: 1 of the tomato sequence is differently represented by C or T. For example, the base (Y) of the SNP position corresponding to the 231 nucleotide of SEQ ID NO: 1 represents base polymorphism in C or T, and a tomato having a genotype where the base (Y) of the SNP position is T is tomato. It can be determined as a foot disease-resistant individual, and a variety having a genotype with a base (Y) C of the SNP position can be determined as a tomato foot disease-sensitive variety.

The term "marker" refers to a nucleotide sequence used as a reference point when identifying genetically unspecified associated loci, and a position on a genetic map of a marker is referred to as a genetic locus or locus.

The marker provided in the present invention may be a restriction amplification polymorphic sequence marker.

The term "Cleaved amplified polymorphic sequence (CAPS) marker" is a marker capable of interpreting a change in a site cut by a restriction enzyme generated by InDel or a single nucleotide sequence like SNP. The CAPS marker is a method for analyzing polymorphism after PCR amplification with primers specific to the locus, followed by restriction enzyme digestion.

In addition, the present invention is a polynucleotide consisting of 5 or more consecutive nucleotides comprising a single nucleotide polymorphism (SNP) position (241 th of SEQ ID NO: 4) base in a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 or complementary thereto Tomato foot blight resistance markers comprising polynucleotides are provided.

Was sequence of SEQ ID NO: 4 is equal to, in this specification expressed in a polynucleotide of SEQ ID NO: 4 with a base of the SNP position to Y: TGCTGCTTGCCTTTCTGACTGGAGTATGGAAGGTAAGTTGTTTTCTGTCACTATTAATCAACCGTTGGGTGATGCTTCTGTTGATAATCTTAGAGCTTTACTATCTGTGAAGAACCCTCTTGTGCTCAACGGTCAGTTGTTGGTCGGAAGTTGTCTTGCTCGAACTTTAAGCAGCATTGCCCAAGGTGCATTTAATTTTTTGCATGAAACTGTTAAGAAAGTAAGAGATAGCGTCAAGTAYGTGAAAACATCAGAATTTCACGAGGAAAAGTTTATTGAGCTCAAACAGCAGCTTCAAGTGCCAAGCACAAAGACTTTGGCTCTTGATGACCAGACTCAATGGAACACCACATATGAGATGTTGTTAGCTGCATCAGAGTTAAAGGAAGTGTTTTCATGCTTGGATACATCTGATCCCGATTACAAGGATGCCC (SEQ ID NO: 4).

The use of the marker for tomato foot disease resistance screening is based on the fact that the 241st base (Y) in the nucleotide sequence represented by SEQ ID NO: 4 among the sequences of tomatoes is differently represented by C or T. For example, the base (Y) of the SNP position corresponding to the 241 nucleotide of SEQ ID NO: 4 represents base polymorphism in C or T, and a tomato having an genotype where the base (Y) of the SNP position is T is tomato. It can be determined as a foot disease-resistant individual, and a variety having a genotype with a base (Y) C of the SNP position can be determined as a tomato foot disease-sensitive variety.

The markers provided in the present invention can be used to select individuals with higher foot blight resistance, and more accurately and effectively can select individuals with foot blight resistance.

The term "polymorphism" means a case where two or more alleles exist in one locus, and single polymorphism (single) in which only a single base differs among individuals among polymorphisms It is called nucleotide polymorphism (SNP).

The term "allele" refers to several types of genes of one kind that exist at the same locus of the homologous chromosome.

The marker of the present invention may be all or part of the polynucleotide of SEQ ID NO: 1 including the base of the SNP position of SEQ ID NO: 1. The polynucleotide may be 10 to 450 consecutive nucleotides, but is not limited thereto.

The term "nucleotide" is a deoxyribonucleotide or ribonucleotide present in single-stranded or double-stranded form and includes analogues of natural nucleotides unless specifically stated otherwise.

The term “Bacterial wilt” is a disease caused by rod-shaped soil-borne Gram-negative bacteria, Ralstonia solanacearum , also known as Cheong-O-Go. Pathogens that cause foot blight invade tomatoes through natural openings of wounds or roots, and when the roots grow horizontally in the sack, they infect conduit tissues, blocking the flow of water in the vascular system of susceptible plants, causing the plants to quickly wither.

The term “resistance” refers to a property that withstands external stress, and specifically refers to a property that is resistant to infections such as diseases or to endure damages such as pests.

The term “individual” refers to a tomato that is an object to be identified for tomato foot disease resistance, and by using a sample obtained from the tomato, the genotype of the marker can be analyzed to determine the tomato having tomato foot disease resistance. The sample may be a sample such as a leaf, a root, a stem, a flower, a fruit, an isolated tissue, or an isolated cell, but is not limited thereto.

In addition, the present invention provides a composition for selecting tomato foot disease-resistant individuals comprising an agent capable of amplifying the marker of the present invention.

The term "an agent capable of amplifying a marker" refers to a composition capable of discriminating tomato foot disease-resistant tomatoes by identifying a polymorphic site through amplification.

The term "polymorphic site" refers to the position of the base where the polymorphism appears, and may be used interchangeably with the base present at the position where the polymorphism appears.

The agent capable of amplifying the marker of the present invention may be a primer set.

The term "primer" is a base sequence with a short free 3'hydroxyl group, capable of forming a template and a base pair and serving as a starting point for template strand copying. It means a short sequence and is mainly used in the form of a primer set that amplifies a specific section. Primers can initiate DNA synthesis in the presence of reagents (eg, DNA polymerase or reverse transcriptase) for polymerization at appropriate buffers and temperatures and four different nucleoside triphosphates. Primers can incorporate additional features that do not change the basic properties of the primer, which serves as the starting point for DNA synthesis. The suitable length of the primer is determined by the properties of the primer to be used, and is typically 15 to 30 bp in length, but is not limited thereto. The primer need not be exactly complementary to the base sequence of the template, but must be complementary enough to form a hybrid-complex with the template.

The primer set capable of amplifying the marker of the present invention may be made of polynucleotides of SEQ ID NO: 2 and SEQ ID NO: 3, but is not limited thereto. The polynucleotide represented by SEQ ID NO: 2 is a forward primer, and the polynucleotide represented by SEQ ID NO: 3 is a reverse primer.

The base sequence of SEQ ID NO: 2 is as follows: GCTACAGGAGGAGGACAACTTC (SEQ ID NO: 2).

The base sequence of SEQ ID NO: 3 is as follows: TGAACCTGAGCAGTTGGAGAG (SEQ ID NO: 3).

In addition, the composition capable of discriminating the foot disease-resistant tomato provided in the present invention is 5 to 24 in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, the C or T, and the 241 th base contains the 5 to It may further include an agent capable of amplifying a tomato foot disease resistance second marker comprising a polynucleotide composed of 200 consecutive bases or a complementary polynucleotide.

The agent capable of amplifying the second marker may be composed of polynucleotides of SEQ ID NO: 5 and SEQ ID NO: 6, but is not limited thereto. The polynucleotide represented by SEQ ID NO: 5 is a forward primer, and the polynucleotide represented by SEQ ID NO: 6 is a reverse primer.

The base sequence of SEQ ID NO: 5 is as follows: TGCTGCTTGCCTTTCTGACT (SEQ ID NO: 5).

The base sequence of SEQ ID NO: 6 is as follows: GGGCATCCTTGTAATCGGGA (SEQ ID NO: 6).

Furthermore, the present invention provides a kit for selecting a tomato foot disease-resistant individual comprising the composition.

The kit of the present invention comprises a composition comprising an agent capable of amplifying the aforementioned marker; Reagents for the amplification; And it may be a kit containing a restriction enzyme. Reagents for the amplification may include dNTPs, DNA polymerase and buffer, but are not limited thereto. The dNTPs include dATP, dCTP, dGTP, dTTP, and the DNA polymerase may be a commercially available polymerase such as Taq DNA polymerase, Tth DNA polymerase, etc. as a heat-resistant DNA polymerase. The restriction enzyme may be one or more of BfaI or BsaAI, but is not limited thereto.

The kit of the present invention may further include a user guide describing optimal conditions for performing the reaction. The guide may be a printout explaining how to use the kit, for example, how to prepare a PCR buffer, the reaction conditions presented, and the like. The guide may include a brochure or leaflet, a label attached to the kit, and a description on the surface of the package containing the kit. In addition, the handbook may include information disclosed or provided through an electric medium such as the Internet.

The present invention comprises the steps of i) amplifying a first polymorphic site comprising the SNP of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 or a complementary polynucleotide thereof from DNA isolated from a tomato sample; And ii) determining the base of the amplified first polymorphic site. The first polymorphic site may be the 231st base of the polypeptide consisting of the nucleotide sequence of SEQ ID NO: 1.

The method for selecting a tomato foot disease-resistant individual may be selected as a tomato foot disease-resistant tomato when the 231st base of the polynucleotide of SEQ ID NO: 1 is T.

In addition, the present invention, in addition to the steps i) and ii) described above, iii) a second polymorphic site comprising the SNP of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 from the DNA isolated from the tomato sample or a complementary polynucleotide thereof amplifying (polymorphic site); And iv) determining the base of the second polymorphic site. The second polymorphic site may be the 241st base of the polypeptide consisting of the nucleotide sequence of SEQ ID NO:4.

The method for selecting a tomato foot disease-resistant individual may be determined to be a tomato foot disease-resistant tomato when the 241st base of the polynucleotide of SEQ ID NO: 4 is T.

Furthermore, in the present invention, when the 231st base of the polynucleotide of SEQ ID NO: 1 is T, and the 241st base of the polynucleotide of SEQ ID NO: 4 is T, the 231st base of the polynucleotide of SEQ ID NO: 1 or the SEQ ID NO: 4 Provides a method for selecting a tomato foot disease-resistant individual, which determines that one of the 241st bases of T has higher foot disease resistance than T.

Specifically, in addition to the steps i) and ii) as a method of selecting a tomato foot disease-resistant individual, further comprising steps iii) and iv), the 231st base of the polynucleotide of SEQ ID NO: 1 is T A tomato foot disease-resistant individual having a 241th basicity T of the polynucleotide of SEQ ID NO: 4 can be selected. When the individual selected by the above-described screening method is an individual in which the 231st base of the polynucleotide of SEQ ID NO: 1 is T and the 241st base of the polynucleotide of SEQ ID NO: 4 is also T, the 231th of the polynucleotide of SEQ ID NO: 1 It can be determined that tomato foot disease resistance is more than twice as high as that of an individual whose base or one of the 241 bases of the polynucleotide of SEQ ID NO: 4 is T.

The step of amplifying the polymorphic site from the DNA of step i) or step iii) can be any method known to those skilled in the art. For example, polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, strand substitution amplification (strand displacement amplification) or Qβ replication enzyme (replicase) may be used, but is not limited thereto.

Hereinafter, examples will be described in detail to specifically describe the present invention.

[Example]

The inventors have identified a qualitative trait loci (QTL) against foot disease resistance in tomatoes, and developed a marker derived from SNP for the marker associated with the QTL.

The term “qualitative trait loci (QTL)” is a region of a genome that is influenced by association with quantitative traits, multiple genes affecting a single trait, or strongly linked to these genes ).

Experimental material

A mapping population consisting of 191 cultivated ( S. lycopersicum ) tomato accession (tomato accessions) and 1 wild ( S. pimpinellifolium ) tomato for Genome-wide association study (GWAS). Was used. Of these tomatoes, 98 modern tomato breeding lines were collected from the RDA's Horticultural and Herbal Science Institute (NIHHS). The remaining 94 germplasms were obtained from RDA's National Agrobiodiversity Center (NAC), USDA's Germplasm Resources Information Network (GRIN), CM Rick Tomato Genetics Resource Center (TGRC), and Sejong University.

In addition, a collection of 45 commercial F1 tomato cultivars was used to investigate genetic variation associated with the locus of foot disease. The group was derived from 15 seed companies in Korea, including Nongwoo Bio, Koregon, Monsanto Korea, and Syngenta Korea.

Table 1 below shows a list of 192 points of tomatoes used in GWAS.

No. Accession Country of origin No. Accession Country of origin One SJG0009 United State 97 14KT-3-4 Republic of Korea 2 SJG0046 United State 98 14KT-5-6 Republic of Korea 3 SJG0048 United State 99 14KT-6-5 Republic of Korea 4 SJG0324 United State 100 14KT-7-6 Republic of Korea 5 SJG0327 United State 101 14KT-8-1 Republic of Korea 6 SJG0333 United State 102 14KT-10-4 Republic of Korea 7 SJG0340 United State 103 14KT-11-7 Republic of Korea 8 SJG0341 United State 104 14KT-12-2 Republic of Korea 9 SJG0343 United State 105 14KT-13-3 Republic of Korea 10 SJG0346 United State 106 AVTO1422 Republic of Korea 11 SJG0347 United State 107 AVTO1424 Republic of Korea 12 SJG0351 United State 108 AVTO1458 Republic of Korea 13 SJG0352 United State 109 AVTO1219 Republic of Korea 14 SJG0355 United State 110 AVTO1315 Republic of Korea 15 SJG0362 United State 111 AVTO1174 Republic of Korea 16 SJG0364 United State 112 11-BA-4 Republic of Korea 17 PI 124035 Peru 113 11-BA-10 Republic of Korea 18 PI 124037 Chile 114 Maeryeok Republic of Korea 19 PI 127820 Bolivia 115 Sarang Republic of Korea 20 PI 128592 Chile 116 Number one Republic of Korea 21 PI 129026 Ecuador 117 Tamina Republic of Korea 22 PI 129033 Ecuador 118 Wonhong 3 ho Republic of Korea 23 PI 129084 Colombia 119 Wonhong 2 ho Republic of Korea 24 PI 129128 Panama 120 15BC10 Republic of Korea 25 PI 129142 Ecuador 121 15BC17 Republic of Korea 26 PI 155372 Peru 122 14KT-2-7 Republic of Korea 27 PI 159009 Peru 123 14KT-3-8 Republic of Korea 28 PI 196297 Nicaragua 124 14KT-3-19 Republic of Korea 29 PI 270430 Mexico 125 14KT-5-12 Republic of Korea 30 PI 272703 Guatemala 126 14KT-5-24 Republic of Korea 31 PI 270408 Mexico 127 14KT-6-10 Republic of Korea 32 SJG0404 United State 128 14KT-6-11 Republic of Korea 33 SJG0412 United State 129 14KT-8-20 Republic of Korea 34 LA2044 United State 130 14KT-9-4 Republic of Korea 35 LA2448 United State 131 14KT-9-20 Republic of Korea 36 LA2449 United State 132 14KT-10-13 Republic of Korea 37 LA2533 Peru 133 14KT-10-15 Republic of Korea 38 LA3043 United State 134 14KT-12-8 Republic of Korea 39 LA3044 United State 135 14KT-12-12 Republic of Korea 40 LA3047 United State 136 14KT-12-14 Republic of Korea 41 LA3051 United State 137 14KT-13-7 Republic of Korea 42 Summer Pink#1 Japan 138 14KT-13-14 Republic of Korea 43 Harkovskii 179 Russia 139 15BC9 Republic of Korea 44 Originalnyi Russia 140 15TC3 Republic of Korea 45 Yantar 530 Russia 141 15TC9 Republic of Korea 46 Prometei Russia 142 15TC18 Republic of Korea 47 Finish Russia 143 15TC22 Republic of Korea 48 Talalikhin Russia 144 15TC30 Republic of Korea 49 Ranny-83 Russia 145 15TC33 Republic of Korea 50 Pirson Russia 146 15TC37 Republic of Korea 51 Vinogradnyi Russia 147 15TC41 Republic of Korea 52 Vogogrdskii skorospelyi 323 Russia 148 15TC43 Republic of Korea 53 Seet100 Netherlands 149 15TC48 Republic of Korea 54 Dachnik Russia 150 15TC54 Republic of Korea 55 Nikola Russia 151 15TG1 Republic of Korea 56 Utro Russia 152 15TG9 Republic of Korea 57 UzRIPI 581 Israel 153 15TG19 Republic of Korea 58 Volgogradskiy Uzbekistan 154 15TG22 Republic of Korea 59 300-78 F Italy 155 15TG29 Republic of Korea 60 Sodrujestvo Russia 156 15TG30 Republic of Korea 61 Bereg Kubana Russia 157 15TG46 Republic of Korea 62 Linia 82-7 Russia 158 15TG49 Republic of Korea 63 Gaigapo 70 Italy 159 15TG60 Republic of Korea 64 Dar Surhana Uzbekistan 160 15TG72 Republic of Korea 65 UzRIPI 123 Russia 161 15TG74 Republic of Korea 66 Chinaские Russia 162 15TG111 Republic of Korea 67 Dularigin China 163 15TG112 Republic of Korea 68 Bahodir Uzbekistan 164 15TG113 Republic of Korea 69 UzRIPI 17 Chile 165 15TG114 Republic of Korea 70 Temnokrasniy Uzbekistan 166 15TG115 Republic of Korea 71 Astrakhan Uzbekistan 167 15TG117 Republic of Korea 72 Doku 2000 Uzbekistan 168 15TG123 Republic of Korea 73 Tmk 22 Uzbekistan 169 15TR1 Republic of Korea 74 Popeecubuous 202 Uzbekistan 170 15TR2 Republic of Korea 75 Wapg Hoeggzy Uzbekistan 171 15TR3 Republic of Korea 76 Cumopa 2009 Uzbekistan 172 15TR4 Republic of Korea 77 Dycimue Uzbekistan 173 15TR5 Republic of Korea 78 Hauyna Uzbekistan 174 15TR10 Republic of Korea 79 Hezuo 928 fanqie China 175 15TR12 Republic of Korea 80 Hezuo 919 dahong fanqie China 176 15TR14 Republic of Korea 81 Hezuo 908 China 177 15TR16 Republic of Korea 82 Shen guan yi China 178 15TR17 Republic of Korea 83 ALT516 fanqie China 179 15TR19 Republic of Korea 84 Darizavaljiya Russia 180 15TRY9 Republic of Korea 85 Talinskii skorospelyi Russia 181 15TRY16 Republic of Korea 86 Slavyansky Shedevr Russia 182 15TRY19 Republic of Korea 87 Kruiz Russia 183 15TRY23 Republic of Korea 88 Miskovkii Delikates Russia 184 16TB94 Republic of Korea 89 Tigrovyi Russia 185 16TB95 Republic of Korea 90 Byche serdtse Russia 186 15BC19 Republic of Korea 91 Gruntovoi Gribovskii Russia 187 15BC20 Republic of Korea 92 Sibirsky Skorospely Russia 188 15BC21 Republic of Korea 93 Moskvich Russia 189 Tomhart Republic of Korea 94 Tsygan Russia 190 16TB197 Republic of Korea 95 14KT-1-3 Republic of Korea 191 16TB198 Republic of Korea 96 14KT-2-2 Republic of Korea 192 16TB199 Republic of Korea

Table 2 below shows a list of 45 commercially available F1 tomatoes used to investigate gene mutations related to foot disease loci using CAPS markers. “B blocking”, “Cheonggang”, and “Shincheonggang” of Table 2 below are foot blight resistant varieties and used as rootstock for grafting. In addition, H shown in Table 2 below shows heterozygote form (CT) of SNP. S is the homozygous form of SNP (homozygote form, CC).

No. Cultivar Company Genotype Mean of disease rating sjs2707 (BfaI) sjs7794 (BsaAI) One B blocking Koregon H H 1.00 2 Olleh TY Monsanto-Korea S S 5.00 3 TY Smartsama Takki-Korea S S 3.38 4 Yoyo captain Konong S H 2.56 5 Dotaerang Dia Takki-Korea S S 3.67 6 Yoyo Konong S S 4.00 7 TY Endorphin Bunong Seed S S 4.89 8 TY Tini PSS S S 4.88 9 Escot Bunong Seed S S 3.89 10 TY Candy Bunong Seed S S 3.14 11 Dafnis Syngenta Korea S S 3.56 12 Landolino Syngenta-Korea S S 4.88 13 Vitamini Bunong Seed S H 3.67 14 Sun globe Nongwoo Bio S S 4.00 15 Seowang Monsanto-Korea S S 5.00 16 Gayachal Plus Syngenta-Korea H S 1.33 17 Venus Dong-won Nongsan S H 2.11 18 Poseidon Monsanto-Korea S S 3.67 19 Rokusanmaru Sakata-Korea S S 5.00 20 Goangbok Jinheung Seed S S 4.89 21 Black Eagle Bunong Seed S S 3.67 22 Sweety Redggoma Jinheung Seed S S 5.00 23 Super Dotaerang Koregon S S 4.56 24 Tenten Koregon S S 4.11 25 Beta Tiny PPS S S 3.56 26 Dotaerang Dia Takki-Korea S S 4.88 27 Cheonggang Monsanto-Korea H H 1.00 28 Shincheonggang Monsanto-Korea H H 1.00 29 Bacchus Monsanto Korea S S 3.56 30 Bigstar Bunong Seed S H 1.13 31 Styx TY Monsanto-Korea S S 5.00 32 Rafito Monsanto-Korea S S 5.00 33 Dotori gold Gana Seed H S 3.22 34 Red Pang Nongwoo Bio H S 3.22 35 SV0244TG Monsanto-Korea S S 5.00 36 Unicorn Monsanto-Korea S S 2.78 37 Veteran Bunong Seed S S 4.44 38 Black Eagle Bunong Seed S S 3.67 39 Kstar Bunong Seed S S 4.22 40 TP-7 Plus Syngenta-Korea S H 1.00 41 Gold Minichal Nongwoo Bio S S 2.78 42 Dotori Gana Seed S S 3.67 43 Sugaryellow Asian Seed S S 3.89 44 Sweety Jinheung Seed S S 4.11 45 Jicored Gana Seed S S 4.88

Experimental method

1. Genotyping-by-sequencing (GBS)

Using the DNeasy Plant mini kit (QIAGEN, Germany), genomic DNA was extracted from 3 week-old seedlings of 192 tomato accessions according to the manufacturer's protocol. DNA concentration was quantified using NanoDrop (Thermo Fisher Scientific, USA) and normalized to 50 ng/μl for library construction.

The quantified library was sequenced in a HiSeq 2000 system (Illumina Inc., San Diego, CA, USA). The sequencing result data was demultiplexed based on barcode and trimmed to exclude low quality, adapter and barcode sequences using the SolxaQA v1.13 package (Cox et al., 2010). After that, the Burrows-Wheeler Aligner (BWA) v0.6.1-r104 program (Li & Durbin, 2009) was applied to align the cleaned reads in the reference genome assembly v2.50 (The Tomato Genome, 2012). did. Raw SNPs were loaded using SAMtools v 0.1.16 (Li et al., 2009), and SNP matrices of mapping populations were generated. For further application, SNPs were clarified under the criteria of minimum depth=5, minimum allele frequency≧5%, and missing data<20%.

2. Disease evaluation and statistical analysis

In the mapping seedling stage of 192 tomato accessions (192 tomato accessions), the severity of foot disease was evaluated twice. In addition, the severity of foot blight disease for F1 tomato-cultivated varieties was evaluated once.

Analysis was conducted in a greenhouse according to a completely randomized design method with 7 plants (7 plants/genotype) for each genotype for the mapping population and 9 plants (9 plants/genotype) for each genotype for the F1 variety.

Tomato germ seeds were sown in plastic trays of 6x12 pots (38 cm ³ /pot) filled with commercial soil and grown at a temperature in the range of 22-30°C. Seeds were watered daily and fertilized weekly according to the manufacturer's protocol at 1 to 5 true leaf steps using Hyponx 6-10-5 (HYPONeX Japan Corp., LTD).

To perform artificial inoculation, a toxic strain of R. solanacearum (WR-1) race 1 was provided according to NIHHS (RDA). Several bacterial colonies were transferred from a nutrient agar medium to a liquid medium of beef extract and peptone (DifcoTM Nutrient Broth, Sparks, MD 21152 USA) and shaved incubation at 28°C for about 48 hours. The bacterial mass was harvested from the medium and placed in sterile double distilled water to prepare an inoculum. The resulting suspension was normalized to O.D. 600 = 0.3 to 0.4 (approximately 108 CFU ml-1) using a photometer. Artificial inoculation was performed by dipping the seeded roots in the bacterial inoculum and transplanting it into a separate plastic pot (Ψ10×10 cm) with a new commercial wetland. Infected plants were raised and watered daily in a greenhouse, and the severity of the disease was visually assessed 14 days after inoculation.

1 shows a measure for assessing the severity of a disease. As shown in FIG. 1, the severity score of the disease was divided by 1 to 5, 1 is no symptom, 2 is 1 or 2 leaf wilted, 3 is 3 or more leaf wilted, 4 is all wilted , 5 indicates that the plant is dry or dead.

Phenotypic data was collected, data was analyzed in the R program (Team, 2011), and the average disease class of each augmentation was calculated according to the following equation: DR = (1n ₁ + 2n ₂ + 3n ₃ + 4n ₄ + 5n ₅ )/N (n ₁ to n ₅ is the number of plants at each of the different disease scores of 1 to 5, N is the total number of plants identified). Phenotypic data and frequency distribution of disease severity were performed in the R program.

3. Electric Field Dielectric Linkage Analysis (GWAS)

In order to use the marker-trait association, a mixed linear model (MLM) considering both the population structure (Q matrix) and the individual relationship (Kinship matrix) was applied in the Tassel program v5.0 (Bradbury et al., 2007). Was performed.

This model is expressed as y = μ + Sα + Qv + Ku + ε, y is the vector of the phenotype, μ is the population mean, α, v, u, and ε are SNP effects, population effects. Corresponds to individual relevance and residual vectors. S, Q, and K are matrixes of marker effects, population effects (fixed effects), and blood relations (random effects). The population structure was estimated using the Bayesian Markov Chain Monte Carlo model (MCMC) performed in Structure software v2.3.4 (Pritchard et al., 2000). Five runs were performed for each number of subpopulations (k) (k set from 1 to 10). The burn-in time and the number of MCMC copies were set to 10,000 and 75,000 for each run, respectively, and the best k value was determined using the ad hoc statistic delta k method. The Q matrix corresponding to the k subpopulation was obtained, and the kinship matrix (K) was obtained from the marker data of Tassel v5.0. Both matrices were fitted to the MLM model, and the distribution of -log ₁₀ (P) observed for each SNP from the marker-trait association analysis was estimated for a null hypothesis in a quantile-quantile plot (QQ plot) -log ₁₀ (P) Compared with. The important association between SNPs and foot disease tolerance was visualized by Manhattan plots based on the threshold of -log ₁₀ (P) at P-value=0.001. The value above the critical line showed a small P- value and was considered an important association. QQ plots and Manhattan plots were completed using the "qqman" and "manhattan" packages in the R program (Team, 2011).

4. Investigation of SNPs related to foot disease locus

CAPS (cleaved amplified polymorphic sequence) markers were designed using flanking regions of SNPs associated with the repeatedly detected foot disease locus. Genomic DNA of F1 tomato cultivated varieties was isolated from young leaves of seedlings using the CTAB method (Kabelka et al., 2002). PCR amplification was performed using 20-30 ng genomic DNA contained in a total 10 μL volume, 0.25 μM of each primer, 0.2 mM dNTPs, 1X PCR buffer, and 0.5 U DNA Taq polymerase (Geneslabs, Seongnam, Korea). . The PCR amplification process involves initial denaturation at 94°C for 3 minutes, after which 40 cycles are repeated at 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 45 seconds, and 72°C for 7 minutes. It includes extension in one cycle. The amplified product was treated with restriction enzymes according to the manufacturer's protocol. The results of genotyping were visualized using an agarose gel electrophoresis method.

Experiment result

1. GBS and SNP detection

Using the GBS method, a total of 862,036,576 raw reads for 192 tomato accessions were generated in the Illumina sequencing platform. After the low quality reads and barcode sequences were removed, 747,017,652 reads were left with an average length of 78 bp. The average reference genome range for each accession was 0.91%. A total of 1,393,704 estimated SNPs were obtained by aligning the quantified sequence to tomato reference genome assembly v2.50. After filtering by several criteria (minimum depth=5, minimum allele frequency≥5%, missing data <20%), 8,550 SNPs were finally obtained. Table 3 below shows the raw sequences and processed reads of 192 tomatoes obtained from GBS. The SNP markers obtained were not evenly distributed over the 12 chromosomes, but distributed at a maximum of 16.9 SNPs/Mb on chromosome 4 and a minimum of 2.5 SNPs/Mb on chromosome 12.

Content Total Number of raw reads 862,036,576 Number of trimmed reads 747,017,652 Average length of trimmed sequence (bp) 78 Average genome coverage (%) 0.91 Total number of SNPs 1,393,704 Number of SNPs filtered 8,550

The average genome range in Table 3 is the average percentage of each accession genome sequenced.

2. Phenotypic data analysis

To obtain phenotypic data, at the seedling stage, R. solanacearum race 1 WR-1 was used to infect 192 tomato accessions and the severity of the disease was recorded. This accession exhibited disease severity at all levels, from high resistance (level 1) to complete sensitivity (level 5). In the case of susceptible driftwood, typical symptoms of foot blight appeared on the top of the driftwood on the 7th day after inoculation, and rapidly progressed to the whole plant within 14 days after inoculation. On the other hand, high and moderate resistant plants showed no symptoms except for one or two leaves.

A total of 192 points of tomato accession confirmed through a total of 2 assays were recorded and 14 days after inoculation, respectively (see Table 4 below).

Assay Min Max Mean of disease rating (±SD) CV(%) (Coefficient of variation) Assay effect 1 ^st One 5 3.94±1.16 30 P <2E-16 2 ^nd One 5 3.00±1.03 34 P <2E-16

As described in Table 4 above, the mean values of disease grades were 3.94±1.16 and 3.0±1.03 (± SD; Standard deviation) for each assay. The coefficient of variation (CV) was 30% to 34% for each analysis, with significant variation in disease resistance among 192 tomatoes.

14.7% of the genotypes collected by the primary analysis showed high resistance to foot disease, while 76.3% of the genotypes showed severe leaf dryness or death (disease grades 3 to 5). In addition, 22.27% of the genotypes collected by the secondary analysis showed high resistance to foot disease, while 50% of the genotypes showed severe leaf dryness or death (disease grades 3 to 5). Figure 2 (a) shows the frequency distribution of the foot disease severity of tomato accession of 192 points in the first analysis. Figure 2 (b) shows the frequency distribution of the foot disease severity of tomato accession of 192 points in the second analysis.

In addition, ANOVA suggested that the genotype and assay effect of each assay environment significantly influenced foot disease resistance ( P-value <0.001). These results indicate that each analysis environment plays an important role in phenotypic changes. Consequently, data from each analysis was considered separately for QTL identification.

3. Population structure and association analysis

To estimate the structure of the population among the 192 tomato populations, Structure software v2.3.4 using 8,550 SNPs. Structural analysis was performed at. The ad hoc quantity (Δk) showed the first peak with k=7, indicating that the mapping population can be concentrated into 7 subpopulations.

3 shows the results of Bayesian clustering analysis for evaluating the structure of a population. The graph of FIG. 3 is a graph of delta k values (y-axis) for the assumed subpopulation (x-axis) representing the ideal number of accessions presented in tomato collection.

Seven subpopulations of the tomato collection (clusters 1 to 7) were visualized in FIG. 4. 4 is the structure of the population estimated in the collection of 192 points of tomato accession using the STRUCTURE program. The genome of each accession is represented by one vertical bar, which is divided into color segments in proportion to the estimated number of members of the seven subpopulations. The largest cluster (Cluster 2) consists of 90 accessions, from 27 countries (27 from Russia, 20 from the United States, 17 from Korea, and 26 from 14 other countries). ). The other 81 Korean breeding lines were divided into the remaining 6 clusters: Cluster 1 (11 accessions), Cluster 3 (7 accessions), Cluster 4 (11 accessions), Cluster 5 (21 accessions), and Cluster 6 (12 accessions), and cluster 7 (19 accessions). Of these, clusters 1, 6 and 7 consisted only of Korean breeding varieties. Several accessions in the seven clusters showed relatively high mixing levels. The corresponding Q matrix at k=7 was used for subsequent GWAS.

Analysis of the association between foot blight resistance and genome-wide 8,550 SNPs revealed a total of 13 SNP loci that are significantly related to foot blight resistance. These SNPs were distributed over 8 chromosomes (see Figures 5 and 6), and the R ² (percentage of total phenotypic deviations described by loci) values ranged from 6.12 to 17.43% (see Table 5).

Table 5 shows the mononucleotide polymorphic markers significantly related to the foot disease resistance locus in a population of 192 tomato accessions. The physical positions listed in Table 5 are physical positions based on the tomato reference genome assembly vSL2.5 at the Sol Genomics Network.

No. SNP Chreomosome Physical position (Mb) One ^st assay 2 ^nd assay P-value R ² (%) P-value R ² (%) One sjs574 One 97.93 6.95E-04 8.20 - - 2 sjs747 2 40.75 9.32E-04 8.27 - - 3 sjs764 2 41.88 7.39E-04 7.44 - - 4 sjs2532 4 59.95 8.45E-04 7.64 - - 5 sjs2705 4 65.66 - - 8.75E-05 10.81 6 sjs2707 4 65.66 - - 9.21E-04 6.12 7 sjs3141 5 19.90 8.40E-04 7.93 - - 8 sjs5063 7 56.99 6.98E-06 11.88 - - 9 sjs6489 9 67.99 3.87E-04 8.51 - - 10 sjs6995 11 10.49 9.19E-05 11.08 - - 11 sjs7622 11 54.30 4.05E-04 9.72 - - 12 sjs7794 12 2.92 1.16E-08 17.43 1.85E-06 13.85 13 sjs7895 12 5.53 - - 4.36E-04 9.67

Of the 13 important SNPs related to foot disease resistance, the sjs7794 locus of chromosome 12 was confirmed by two analyzes and showed the most significant association ( P-value <1.2E-08). The sjs7794 locus accounted for 17.43% of the total phenotypic variation in the first analysis and 13.85% of the total phenotypic variation in the second analysis. The other 12 SNPs are assay-specific and account for resistance deviations from 6.12 to 11.88%. Nine of these SNPs were found in chromosomes 1, 2, 4, 5, 7, 9, and 11 with P-value <0.001 in the first analysis. The remaining three SNPs were detected on chromosomes 4 and 12 in the second analysis.

FIG. 5 shows the Manhattan plots showing the association between genomic SNPs and foot disease resistance in primary and secondary analyses. The x-axis and y-axis indicate the chromosome position and -log ₁₀ (P-value) of the SNP of GWAS, respectively. The blue line represents the -log10 (P-value) threshold for genome-wide significance at P=0.001.

Figure 6 shows the physical map location of QTL candidates for foot disease resistance across 12 chromosomes. Each vertical bar in FIG. 6 represents one chromosome. The number of SNPs per chromosome obtained from GBS is indicated at the bottom of each bar. The red line represents SNPs detected in both primary and secondary analysis, the pink line represents SNPs detected in primary analysis, and the blue green line represents SNPs detected in secondary analysis. The number on the left side of each bar indicates the physical location of the detected SNPs. The red boxes represent the main known QTLs, bwr6 and bwr12.

4. Identification of favorable SNP alleles of common QTL associated with foot blight loci

By several analyzes, three SNPs (sjs2532, sjs2705 and sjs2707) were identified on chromosome 4. In the second analysis, the GWAS result showed that the sjs2532 locus showed P-value = 0.12, but in the first analysis, the GWAS result showed that the sjs2705 and sjs2707 loci were relatively low at 0.001< P <0.005. Thus, for further analysis, two SNPs, sjs2705 and sjs2707, as well as a common SNP sjs7794 strongly associated with QTL on chromosome 12 were selected. All three SNPs showed alleles C and T at their loci. For each SNP, 192 tomato accessions were divided into two groups according to the type of allele they had. Advantageous alleles were found by comparing the mean of disease classes in the two groups classified. Analysis of the severity of foot disease resistance for the three locus SNP alleles (SNP alleles) was implemented in the R program and visualized in FIG. 7.

The boxplot of the mean separation analysis showed that for all three loci in two analyzes, the mean of the disease class of the group containing allele T was significantly lower than the mean of the disease class of the group containing allele C. Showed that. These results indicate that the three loci alleles T are favorable alleles for both QTL4 and QTL12.

7 shows the identification of favorable alleles of SNPs sjs2705, sjs2707 (QTL4) and sjs7794 (QTL12) associated with foot blight resistance. In FIG. 7, coral color indicates a group of tomato accession containing allele C, blue green indicates a group of tomato accession including allele T, and each dot represents each tomato accession.

5. Confirmation of the presence of QTL4 and QTL12 in F1 tomato varieties

To confirm that the three SNPs (sjs2705, sjs2707 and sjs7794) appeared in the F1 tomato variety, genotyping and phenotypic analysis of the F1 cultivated variety was performed. Three CAPS markers were designed using flanking regions of three SNPs and used for genotyping of F1 varieties (see Table 6). Along with 45 F1 tomato varieties, 15TG111 and Yellow Pear, which are known to be very resistant and sensitive to foot disease, were also analyzed as controls.

Table 6 shows CAPS markers derived from three SNPs associated with QTL4 and QTL12 of foot blight resistance.

QTL CAPS markers (restriction endonucleases) SNP alleles Size of PCR product (bp) Allele size (bp) C T QTL4 sjs2705(SspI) C/T 507 244/263 507 QTL4 sjs2707 (BfaI) C/T 435 231/204 435 QTL12 sjs7794 (BsaAI) C/T 436 241/195 436

The base sequence amplified by the CAPS marker (sjs2707) of QTL4 is shown in SEQ ID NO: 1. The base (Y) present at position 231 of SEQ ID NO: 1 may be C or T.

The base sequence amplified by the CAPS marker (sjs7794) of QTL12 is shown in SEQ ID NO: 4. The base (Y) present at position 241 of SEQ ID NO: 4 may be C or T.

As a result of genotyping, it was confirmed that all F1 tomato cultivars were monomorphic with allele C against the CAPS marker sjs2705 (SspI). On the other hand, it was confirmed that 6 varieties were heterozygous for the sjs2707 (BfaI) marker, and 8 varieties were heterozygous for the sjs7794 (BsaAI) marker. Among them, three genotypes of “B blocking”, “Cheonggang”, and “Shincheonggang” corresponding to 1, 27, and 28 of FIG. 8 were confirmed to be heterozygous for both markers. , All cultivars with favorable alleles (T) of the sjs2707 and sjs7794 loci showed little or no symptoms of foot blight (see Figure 8 and Table 5).

8 shows agarose gels showing the three CAPS markers sjs2705 (SspI), sjs2707 (BfaI) and sjs7794 (BsaAI) genotypes for the F1 tomato variety. 8, L denotes a ladder 100 bp, S denotes a sensitivity control (Yellow Pear), and R denotes a resistance control (15TG111). In addition, the numbers 1 to 37 in FIG. 8 represent the same number genotype in Table 2.

Through the above results, it was confirmed that the tomato having the 231st base of the polynucleotide of SEQ ID NO: 1 has high foot disease resistance, and the tomato having the 241st base of the polynucleotide of SEQ ID NO: 4 has a foot disease resistance of tomato. It was confirmed that this is high. In addition, in the case of the tomato having both the 231 th base of the polynucleotide of SEQ ID NO: 1 and the 241 th base of SEQ ID NO: 4, it was confirmed that one of the two bases has higher foot disease resistance than the tomato of T.

For further analysis, genotypes of two polymorphic markers were analyzed. According to the presence of favorable alleles of the sjs2707 and sjs7794 markers associated with QTL4 and QTL12, 45 F1 varieties were divided into four groups (Group 4, Group 12, Group 4-12, Group N).

Group 4 is a cultivar with alleles favorable only to QTL4, and group 12 is a cultivar with alleles favorable only to QTL12. In addition, groups 4-12 are cultivars with alleles favorable to both QTL4 and QTL12, and group N includes the remaining cultivars.

Of the above four groups, groups 4-12 were found to be most resistant to foot blight, and group N was found to be most vulnerable to foot blight. Analysis of the variance showed a significant difference between the mean of the four groups of disease grades at P-value <0.001. Posthoc Duncan's new multi-range test (MRT), run in the R program, was applied to compare the mean of disease grades among the four groups. This analysis showed that Group 4 and Group 12 showed significant differences from Group 4-12 and Group N, but did not show significant differences between Group 4 and Group 12 ( P-value <0.05). In addition, Group 12 showed a significant difference from Group N (see Table 7).

Table 7 shows the results of Duncan's multiple range test for the mean of disease grades in four groups (Group 4, Group 12, Group 4-12, Group N). SDs disclosed in Table 7 below represent standard deviations. According to Duncan grouping, there was no significant difference in disease risk of P-value <0.05.

Group Mean of
disease rating
(±SD) No. of
cultivars Min Max Duncan
grouping 4 2.59 (±1.09) 3 1.33 3.22 a 4-12 1.00 (±0.0) 3 1.00 1.00 b 12 2.09 (±1.10) 5 1.00 3.67 a N 4.20 (±0.70) 34 2.78 5.00 c

Through these results, it was confirmed that the tomato having the 231 th base of the polynucleotide of SEQ ID NO: 1 has higher foot disease resistance than the tomatoes of other varieties. In addition, it was confirmed that the tomato having a 241 th base of the polynucleotide of SEQ ID NO: 4 has a higher resistance to foot disease than tomatoes of other varieties.

Furthermore, in the case of a tomato having the 231st base of the polynucleotide of SEQ ID NO: 1 and the 241st base of the polynucleotide of SEQ ID NO: 4, the 231st base of the polynucleotide of SEQ ID NO: 1 or the polynucleotide of SEQ ID NO: 4 It was confirmed that one of the 241 bases was more resistant to foot blight than a tomato with T.

<110> SEJONG UNIVERSITY INDUSTRY ACADEMY COOPERATION FOUNDATION <120> Molecular marker for selecting tomato cultivars resistant to tomato Bacterial wilt and selection method using the same marker <130> 19P05012 <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 432 <212> DNA <213> Artificial Sequence <220> <223> tomato_1 <400> 1 gctacaggag gaggacaact tcgtttgttt gtagttttca acaaagggtt ggctctttcg 60 gcagatgtcc tgacagtaac ttccgcaact tgttgagcag gttttggcaa gtgcttctct 120 ttggatactg atatttcacc ttgcacaccc tttttagaca atctaattct gataatgcta 180 cctattgtcg agcagcaaaa cttcagatta gcaacagata aaacataaca ytagaccaaa 240 atagtaagta ttatatataa agggaaagaa ctaccatgcg cctgtatgcc acctcgtgaa 300 ggtgaaggtg aagtaggcct cttcctttta ttactgttct gggtgctgtc ggatgagcag 360 ctggaattct gtgaacacac agcaggctca tgttcctcag tgagattgct cctctccaac 420 tgctcaggtt ca 432 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> forward primer_sequence1 <400> 2 gctacaggag gaggacaact tc 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer_sequence1 <400> 3 tgaacctgag cagttggaga g 21 <210> 4 <211> 434 <212> DNA <213> Artificial Sequence <220> <223> tomato_2 <400> 4 tgctgcttgc ctttctgact ggagtatgga aggtaagttg ttttctgtca ctattaatca 60 accgttgggt gatgcttctg ttgataatct tagagcttta ctatctgtga agaaccctct 120 tgtgctcaac ggtcagttgt tggtcggaag ttgtcttgct cgaactttaa gcagcattgc 180 ccaaggtgca tttaattttt tgcatgaaac tgttaagaaa gtaagagata gcgtcaagta 240 ygtgaaaaca tcagaatttc acgaggaaaa gtttattgag ctcaaacagc agcttcaagt 300 gccaagcaca aagactttgg ctcttgatga ccagactcaa tggaacacca catatgagat 360 gttgttagct gcatcagagt taaaggaagt gttttcatgc ttggatacat ctgatcccga 420 ttacaaggat gccc 434 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer_sequence4 <400> 5 tgctgcttgc ctttctgact 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer_sequence4 <400> 6 gggcatcctt gtaatcggga 20

Claims (11)

In the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, the 231st base is C or T, and a tomato foot comprising a polynucleotide composed of 10 to 450 consecutive bases including the 231st base or a polynucleotide complementary thereto Marker composition for determining blight resistance.
The method according to claim 1, If the 231 th base is T, tomato foot blight resistance marker composition for determining that it is a tomato foot blight resistance tomato.
A composition for screening tomato foot disease-resistant individuals comprising an agent capable of amplifying the marker of claim 1.
The method according to claim 3, wherein the formulation is a primer set consisting of a polynucleotide of SEQ ID NO: 2 and SEQ ID NO: 3 tomato foot blight resistant individual selection composition.
The method according to claim 3, wherein the 241 base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is C or T, polynucleotide consisting of 10 to 450 consecutive bases comprising the 241 base or complementary thereto A composition for screening a foot disease-resistant individual, further comprising an agent capable of amplifying a tomato foot disease-resistant second marker comprising a polynucleotide.
The composition according to claim 5, wherein the agent capable of amplifying the second marker is a primer set consisting of polynucleotides of SEQ ID NO: 5 and SEQ ID NO: 6.
Tomato foot blight resistant individual selection kit comprising the composition of claim 3.
Amplifying a first polymorphic site comprising SNP of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 or a complementary polynucleotide thereof from DNA isolated from the tomato sample; And determining the base of the amplified first polymorphic site.
The first polymorphic site is the 231st base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, tomato foot disease resistance individual selection method.
The method according to claim 8, When the 231st base of the polynucleotide of SEQ ID NO: 1 is T, tomato foot disease resistance individual selection method to determine that the tomato is a foot disease resistance tomato.
The method according to claim 8, Amplifying a second polymorphic site comprising the SNP of a polynucleotide consisting of the base sequence of SEQ ID NO: 4 or a complementary polynucleotide thereof from the DNA; And determining the base of the amplified second polymorphic site.
The second polymorphic site is a tomato foot disease-resistant individual selection method, which is the 241st base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO:4.
The method according to claim 10, wherein the 231 th base of the polynucleotide of SEQ ID NO: 1 is T, and the 241 th base of the polynucleotide of SEQ ID NO: 4 is T, it is determined that the foot disease resistance is higher than that of either T How to select tomato foot disease resistant individuals.

Images