KR102133820B1 - A Method for Enhancing Osteogenesis of Human Mesenchymal Stem Cells using Single-Walled Carbon Nanotubes and a use for Tissue Engineering Applications - Google Patents

Abstract

The present invention relates to: a method for increasing cell proliferation and induction of osteogenic differentiation in stem cells by treating single-walled carbon nanotubes in vitro on the stem cells; a composition thereof; and a filament having increased tensile strength, wherein a manufacturing method of the filament comprises a step of adding single-walled carbon nanotube powders to polylactic acid (PLA) pellets at a weight ratio of 10 to 20 (w/w), followed by melting. The filament of the present invention has exhibited suitable structural, mechanical properties and biocompatibility for tissue engineering applications.

Description

A method for Enhancing Osteogenesis of Human Mesenchymal Stem Cells using Single-Walled Carbon Nanotubes and a use for Tissue Engineering Applications}

The present invention relates to a method for improving bone differentiation of mesenchymal stem cells using single-walled carbon nanotubes and histological applications.

In tissue engineering applications, porous artificial scaffolds are used to support bone tissue cells to replace and complement the current approach of organ transplantation. The cornerstone of a successful tissue engineering application depends on two essential elements: the cell and the support. Proper design of three-dimensional (3D) supports determines biomaterials and manufacturing protocols through mechanical control of process parameters and biological requirements (including porosity, biodegradability, surface properties, and biocompatibility). Human mesenchymal stem cells (hMSCs) have received much attention in tissue engineering because of their ability to differentiate into bone cells, chondrocytes, adipocytes and muscle cells.

Carbon nanotubes (CNTs) also have unique and excellent properties such as high surface area, good electrocatalytic activity and biocompatibility, and have been proposed as potential applications for bone formation. Therefore, it is important to study the mechanism of interaction between CNTs and hMSCs for tissue engineering applications. Nevertheless, many studies of stem cells on nanoparticles of CNTs have not been reported.

[Previous patent document]

Republic of Korea Patent Publication No. 10-2013-0084553

The present invention was devised by the above needs, and an object of the present invention is to provide a composition for stem cell proliferation and differentiation.

Another object of the present invention is to provide a complex for stem cell proliferation and differentiation.

In order to achieve the above object, the present invention provides a method of increasing cell proliferation in the stem cells by treating the single-walled carbon nanotubes with stem cells in vitro.

3.4 nm 및 24

2.7 nm인 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, the single-walled carbon nanotubes have an average length and diameter of 179, respectively.

3.4 nm and 24

It is preferably 2.7 nm, but is not limited thereto.

In another embodiment of the present invention, the concentration of the treated single-walled carbon nanotubes is 5 to 20 μg/ml and the treatment time is preferably 72 hours, but is not limited thereto.

In addition, the present invention provides a method for inducing osteogenic differentiation in the mesenchymal stem cells by treating the single-walled carbon nanotubes in the mesenchymal stem cells in vitro.

In one embodiment of the present invention, the concentration of the treated single-walled carbon nanotubes is 7.5 to 10 µg/ml and the treatment time is preferably 7 days to 14 days, and the treatment time is more preferably 14 days, but is not limited thereto. No.

In addition, the present invention provides a composition for proliferating stem cells comprising single-walled carbon nanotubes as an active ingredient.

In one embodiment of the present invention, the concentration of the single-walled carbon nanotubes is preferably 5 to 20 μg/ml, but is not limited thereto.

In addition, the present invention provides a composition for inducing bone differentiation of mesenchymal stem cells comprising a single-walled carbon nanotube as an active ingredient.

In one embodiment of the present invention, the concentration of the single-walled carbon nanotubes is more preferably 7.5 to 10 μg/ml, but is not limited thereto.

In addition, the present invention provides a method for producing a filament having increased tensile strength, comprising adding a single-wall carbon nanotube powder to a polylactic acid (PLA) pellet at a weight ratio of 10 to 20 (w/w) and then melting it to prepare a filament. do.

3.4 nm 및 24

2.7 nm인 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, the single-walled carbon nanotubes have an average length and diameter of 179, respectively.

3.4 nm and 24

It is preferably 2.7 nm, but is not limited thereto.

In addition, the present invention provides a composite filament of polylactic acid (PLA) and a single-walled carbon nanotube prepared by adding and dissolving a single-wall carbon nanotube powder in a weight ratio (w/w) of 20% in a polylactic acid (PLA) pellet.

3.4 nm 및 24

2.7 nm인 것이 바람직하나 이에 한정되지 아니한다.In one embodiment of the present invention, the single-walled carbon nanotubes have an average length and diameter of 179, respectively.

3.4 nm and 24

It is preferably 2.7 nm, but is not limited thereto.

Hereinafter, the present invention will be described.

In the present invention, first, SWCNTs of nano-sized particles were fabricated, and properties for promoting proliferation and bone formation differentiation of hMSCs were investigated. CNTs were not involved in cytotoxicity, but rather proved to promote the proliferation of hMSCs and differentiation of bone formation. In addition, we assessed its potential application to bone for tissue engineering (bone formation and angiogenesis) by evaluating the cell growth hormone of stem cells stimulated by CNTs.

Second, a new biocompatible filament composed of CNTs and Poly (lactic acid) was developed. The carbon-based PLA filament developed in the present invention showed various properties including structural properties, mechanical properties, and biocompatibility for hMSCs. In particular, the filament composed of SWCNTs-20%/PLA showed suitable structural, mechanical properties and biocompatibility for tissue engineering applications.

To improve tissue engineering for bone applications in biomaterials, new designs are needed to balance bioactivity requirements with mechanical behavior.

In the present invention, SWCNTs have been prepared and evaluated for their ability to grow stem cells and tissue engineered bone structures in tissue engineering applications.

SWCNT was evaluated to measure the effect of hMSCs on bone formation in in vitro cultures. The present invention evaluated carbon-based PLA filaments to meet market demand for tissue engineering.

According to the invention, the following results were obtained:

(1) In the present invention, nano-sized SWCNTs were produced. The microstructure of SWCNT was observed by TEM image and Raman spectroscopy was used to observe the chemical structure of SWCNT. Specifically, SWCNTs having an average length of 179±3.4 nm and a diameter of 24±2.7 nm were obtained. In addition, TEM images showed that SWCNTs were relatively well dispersed without aggregation. The spectrum of SWCNTs by Raman spectroscopy showed the generation of bands of 1343.3 cm-1 (D band) and 1591.1 cm-1 (G band).

(2) The present invention investigated the effect of SWCNT on in vitro growth and differentiation of hMSCs.

The present inventors performed cell viability and proliferation, mineralized nodule formation, and real-time PCR as an indicator of bone formation.

The results of the present invention indicate that SWCNT is an important stimulus for bone formation activation. hMSCs were cultured in media containing various concentrations of SWCNTs (5, 7.5, 10, 15 and 20 μg/ml). As a result, SWCNT did not show cytotoxicity to hMSC, and cell growth was significantly higher when treated with SWCNT than the control group (* p <0.05).

Even at the highest dose (20 μg/mL) SWCNT increased cell viability SWCNT increased over 11% over 72 hours compared to control.

In addition, SWCNTs at appropriate concentrations (7.5 and 10 μg/ml) were significantly increased compared to controls in alizarin red-S staining.

From these results, it was confirmed whether an appropriate concentration of SWCNTs influenced cell differentiation and maturation, and real-time PCR analysis proceeded to a concentration of 10 μg/ml of SWCNTs with the largest cell differentiation.

Real-time PCR results confirmed that the expression levels of ALP, BSP, OPN, OCN, COL1 and RUNX2 were significantly higher in SWCNT 10 μg/ml than in the control group at 2 weeks. According to the analysis of gene expression, hMSCs cultured in the presence of SWCNT significantly upregulated all osteoblast specific genes. The results of the present invention indicate that SWCNTs exhibit potential biomaterial properties.

(3) It was also an object of the present invention to develop a carbon-based PLA filament in the field of tissue engineering that enables artificial organ application. Therefore, the present inventors developed and evaluated carbon-based PLA filaments for stem cell and 3D tissue regeneration.

The results of the present invention showed the average diameter of the carbon-based PLA filament as follows. PLA: 1.68 ± 0.2 mm; SWCNT-10% / PLA: 1.65 ± 0.1 mm; SWCNT-20% / PLA: 1.67 ± 0.2 mm; SWCNT-40% / PLA: 1.68 ± 0.2 mm. The surface of the carbon-based filament had a relatively smooth and uniform diameter.

(4) In the present invention, the mechanical properties of carbon-based PLA filaments were investigated through stress-strain diagrams. When the strain rate is about 14%, the yield point of the PLA filament occurs, after which the load no longer increases.

In addition, yield points of SWCNT-10%/PLA filament and SWCNT-20%/PLA filament occurred when the strains were 20% and 11%, respectively. In the case of SWCNT-40% / PLA filament, the strain was about 10%. These results show that SWCNT-20% / PLA filament and SWCNT-40% / PLA filament have higher elasticity than conventional PLA filament.

The tensile strength of PLA filament is 8±0.94 MPa, SWCNT-10%/PLA, SWCNT-20%/PLA and SWCNT-40%/PLA filaments are 10±0.84, 11±1.4 and 8±1.4 MPa respectively, ( Figure 12 (B)). As a result, SWCNT-20% / PLA filament showed 1.4 times higher tensile strength than PLA (*p <0.05). However, the tensile strength of the composite filament was not proportional to the proportion of SWCNT added.

(5) In the present invention, the biological response of the carbon-based PLA filament to the cell viability of hMSC was also investigated. There was no significant difference between the PLA filament extracted from the control group and the carbon-based PLA filament (p>0.05). According to these results, carbon-based PLA filament is a biocompatible material having excellent biocompatibility and may be a promising application material in the field of tissue engineering in potential applications.

(6) In the present invention, a new 3D scaffold was developed using FDM technology.

The present inventors modified two control parameters, such as infill pattern and scaffolds infill density. However, further studies are needed to understand the correlation between the properties of the artificial supports and the tensile strength based on these parameters. There are currently not enough studies to evaluate the mechanical behavior of scafflods generated by parameters.

However, scaffolds made with these manufacturing techniques have unlimited potential to rebuild and recover tissue. Controlling these parameters not only provides the potential for scaffolds with patient-specific reinforcement elements, but also the ability to meet the needs of different organizations.

1 shows material preparation from SWCNT. (A) Ultrasonic treatment of SWCNTs with acid, (B) removal of acids by filtration, and (C) SWCNTs were obtained by centrifugation at 14,000 rpm for 15 minutes.
2 is a schematic diagram of an experimental protocol used in the present invention.
Figure 3 is a schematic (A) of the extrusion process, the shape of the mini extruder (B); Mini extruder motion controller: switch, menu, speed (C); Winding device (D); Prepared PLA filament (E).
4 is a working principle of FDM 3D printing,
5 shows various packing densities and pattern properties for 3D printed specimens.
Figure 6 FACS analysis of hMSCs.
Figure 7 shows the zeta potential values of SWCNTs (A) and traditional SWCNTs (B) of the present invention.
8 is a TEM image of SWCNTs (A) and conventional SWCNTs (B).
9 is Raman spectroscopy of SWCNT.
10 is a bar graph of cell viability (WST-1) of hMSCs exposed to SWCNT for 48 hours. Results are mean±SD of 3 experiments (*p<0.05).
11 shows the formation of mineralized nodules stained by Alizarin Red S. Cells were treated with SWCNTs for 7 days (A) and 14 days (B).
12 is a PCR analysis of the expression of bone-specific differentiation specific genes under induced conditions (A) 7 days and (B) 14 days. Results indicate SD of 3 experiments (* p <0.05).
The photo in Figure 13 shows the extruded filaments of the CNT blend. (A) PLA; (B) SWCNTS-10% / PLA; (C) SWCNTS-20% / PLA; (D) SWCNTS-40% / PLA.
Figure 14 is the shape of the surface of the carbon-based filament using FE-SEM. (A) PLA; (B) SWCNTs-10%/PLA; (C) SWCNTs-20%/PLA; And (D) SWCNTs-40%/PLA.
15 is a mechanical property of the carbon-based filament. (A) Stress-strain diagram for pure PLA filament and carbon-based PLA filament. (B) Tensile strength of carbon based PLA filament. PLA was significantly different from SWCNTs-10% / PLA and SWCNTs-20% / PLA (* p <0.05).
16 is a cytotoxicity test result of the filament according to the content of SWCNT (p> 0.05).
Figure 17 shows density and infill patterns, (A) 30% triangle, (B) 50% triangle, (C) 30% tetrahedron (D) 50% tetrahedron, (E) 30% zig zag, (F) 50% zig zag.

Hereinafter, the present invention will be described in more detail through non-limiting examples. However, the following examples are intended to illustrate the present invention, and the scope of the present invention is not to be construed as being limited by the following examples.

Example One: CNTs Produce

SWCNTs were purchased from Applied carbon nano (ACN, Republic of Korea). Purified SWCNTs were purified by acid refluxing. In summary, 1 g of SWCNTs powder was treated with a mixture of sulfuric acid and nitric acid (3:1 each), and then the purified SWCNTs were sonicated (VCX-130, Sonics, USA). After 30 minutes, 6 ml of diH2O was added to the suspension and stirred slowly. The diluted suspension was obtained by removing the residual acid through filtration and centrifuging the dried SWCNTs at 14,000 rpm for 10 minutes (FIG. 5). The CNTs were well dispersed.

Example 2:CNTs Specialization

The microstructure and particle size analysis of the CNTs were performed using an electroscopy-type transmission electron microscope (FE-TEM, JEM-2100F, JEOL, Tokyo, Japan). The mean and standard deviation were reported for each value. Raman spectroscopy was performed at 532 nm using Horiba Jobin-Yvon LabRAM ARAMIS Raman confocal microscope (Aramis CRM, Horiba Jobin Yvon, Edison, NJ). The results of the Raman analysis were analyzed with "D (disorder)" line and "G (graphite)" line.

Example 3: cell culture

hMSCs were obtained from the Dental Research Institute of Dentistry, Seoul National University. Cells were 37° in dulbecco modified eagle medium (DMEM; Welgene. Inc.) containing 10% fetal calf serum (FBS; Welgene. Inc.), and 10 mM ascorbic acid (L-ascorbic acid; Sigma-Aldrich, USA). C, 5% CO2 (Steri-Cycle 370 Incubator; Thermo Fisher Scientific) culture. The medium was changed every 2 days. hMSCs were incubated for 24 hours to attach, detach, count, and were passaged with 1 mL of trypsin-ethy-lenediaminetetraacetic acid (EDTA) solution before the cells were confluent. Cells were commonly used between 3 and 6 passages.

All protocols for human tissue processing followed legal guidelines for human tissues and organs in an experimental protocol approved by the Seoul National University Bioethics Review Committee (IRB No. CRI05008).

Example 4: FACS analysis

The expression of cell surface markers was identified by FACS (fluorescence-activated cell sorting) analysis. In summary, hMSCs were prepared as a single cell suspension at passage 3 of 1.0 Х 10 ⁶ cells/mL. After collecting with trypsin-EDTA, centrifugation was performed at 1200 rpm for 5 minutes. Cells were resuspended with 10 μg/mL of the following antibodies in 1% BSA (ICN Biomedicals): CD13, CD90, CD146, and CD34 (BD bioscience, USA). Samples were analyzed using flow cytometry (FACSCalibur, Becton Dickinson, California, USA).

Example 5: cells Survival rate And proliferation analysis

/ml, 7.5

/ml, 10

/ml, 15

/ml 및 20

/ml)를 24-웰 플레이트 내로 첨가하였다. SWCNTs 처리없는 hMSCs를 대조군으로 사용하였다. 세포 생존률을 WST-1 분석(EZCytox Cell Viability Assay Kit^®; Daeillab Service Co., Ltd.)으로 측정하였다. WST-1 분석은 formazan을 측정하는 비색분석법이다. formazan 염료의 양은 생존 세포의 수와 직접 비례한다. 생성된 formazan 염료를 분광계(INFINITE M NANO, TECAN, Schweiz)로 450 nm에서 흡광도를 측정하여 정량화하였다. 각 값들에 대한 평균 및 표준편차를 리포트하였다.Different concentrations of SWCNTs (5

/ml, 7.5

/ml, 10

/ml, 15

/ml and 20

/ml) into a 24-well plate. HMSCs without SWCNTs treatment were used as controls. The WST-1 cell viability analysis was measured as ^{(EZCytox Cell Viability Assay Kit ® Daeillab} Service Co., Ltd.). WST-1 analysis is a colorimetric method that measures formazan. The amount of formazan dye is directly proportional to the number of viable cells. The resulting formazan dye was quantified by measuring absorbance at 450 nm with a spectrometer (INFINITE M NANO, TECAN, Schweiz). The mean and standard deviation for each value were reported.

Example 6: Mineralized dyeing test

10⁶ cells/웰)를 24-웰 조직 배양 플레이트에 시딩하고 골형성 배지에서 CNTs 첨가 및 미첨가로 7일 및 14일간 배양하였다(도 2). hMSCs (4

10 ⁶ cells/well) was seeded in a 24-well tissue culture plate and cultured for 7 days and 14 days with and without addition of CNTs in the bone-forming medium (FIG. 2 ).

The presence of mineralized nodules was determined by staining with alizarin red-S. In summary, cells were immobilized with 4% formalin for 15 minutes, washed with diH ₂ O, and then stained with 40 mM alizarin red-S (pH 4.2) for 30 minutes. The cells were washed 5 times with diH ₂ O, then dried and captured with a microscopic image using an optical microscope. After obtaining differentiated images of cells, the absorbance of alizarin red-S in the sample was combined with 10% cetylpyridinium chloride (Amresco, Solon, Ohio, USA) and 10 nM sodium phosphate (Duksan Co., Republic of Korea) at 562 nm. It was quantified by measuring by decolorizing with the solution. The mean and standard deviation for each value were reported.

Example 7: Real -time PCR

Real-time polymerase chain reaction (RT-PCR) was used to measure the expression of several osteogenic factors. After 7 and 14 days in CNTs culture, total RNA was isolated with TRIzol reagent (Invitrogen). The cDNA was then synthesized using the first-strand cDNA synthesis kit (Invitrogen) according to the manufacturer's instructions. Human primer information is listed in Table 1. The products were separated by 1% agarose gel electrophoresis (Bio-Rad, USA) and viewed with UV-induced fluorescence. The mean and standard deviation for each value were reported.

Full name Sequence (5'-3') Accession No. PCR cycles Product size (bp) Human Alkaline phosphatase (ALP) F: ggacatgcagtacgagctga BC090861 26 357 R: gcagtgaagggcttcttgtc Human Integrin-binding sialoprotein (BSP) NM_004967 29 248 F: caacagcacagaggcagaaa R: cgtactccccctcgtattca Human Osteopontin (OPN) J04765 29 279 F: cccacagacccttccaagta R: acactatcacctcggccatc Human Osteocalcin (OCN) X53698 29 175 F: gtgcagagtccagcaaaggt R: tcagccaactcgtcacagtc Human Collagen type I (COL1) XM_012651 23 300 F: ctgaccttcctgcgcctgatgtcc R: gtctggggcaccaacgtccaaggg Human RUNX2 (RUNX2) NM_001015051 30 432 F: cgcattcctcatcccagtat R: gactggcggggtgtaagtaa

Table 1 shows the human primer sequence for RT-PCR

Example 8: Filament production

PLA pellets (3D Factory, Ulsan, Repubile of Korea) were used in the present invention. First, PLA pellets were melted at 200°C using a hot plate (Daihan Scientific Co. Ltd., MSH-30D Wise Stir). After melting, SWCNTs (5, 10, or 20 g) were mixed at room temperature for 24 hours and allowed to stand. The synthesized sample was extruded through an extruder (Philibot, Leejo, Changwon, Korea) at a die exit diameter of 1.75 mm at 12 rpm and 200°C. Table 2 shows the specifications of the extruder. The extrudate was quenched in a cooling circulation system. The puller speed was set at 2 mm/s. PLA was used as a control (FIG. 3).

OS Temperature & DC controller Temperature 23 ~ 230°C Speed 0 ~ 24 RPM Ext Rat 2 cm / 1 s INP 1.65 ~ 3.0 mm Nozzle 1.75 mm Power 220 V, 200 W Hopper 400 G Dimension

27 cm (W)

44 cm (L)19 cm (H)

27 cm (W)

44 cm (L)

Table 2 shows the specifications of the extruder used in the precise extrusion process.

Example 9: Characteristics of carbon base composite

The microstructure and entry size of this carbon-based PLA filament were performed using an electrospinning scanning electron microscope (FE-SEM, S-4300, HITACHI, Tokyo, Japan).

All samples were coated with platinum for 240 s using an ion sputter coater (E-1010, HITACHI, Tokyo, Japan) at 0-30 mA. The thickness of the carbon-based PLA filament was measured by FE-SEM, and the average and standard deviation for each value were reported.

Example 10: Mechanical experiment of carbon-based composite

Stress strain analysis and compressive strength were performed by analyzing the mechanical properties of the carbon-based composite filaments and conventional filaments. Tensile and compression tests were performed using MCT-1150 (A&D, Tokyo, Japan) and analyzed using the MSAT-Lite program. The inventors recorded breakpoint displacement using a 500 N load cell. A cross-head speed of 100 mm/min was used for tensile strength testing. These tests were repeated 5 times. The mean and standard deviation for each value were reported.

Example 11: Cytotoxicity evaluation

The cytotoxicity of the filament was measured by WST-1 analysis (EZCytox Cell Viability Assay Kit ^® ; Daeillab Service Co., Ltd.). When 1 cm ² filament was inserted into the body, the amount of toxicity extracted from the filament was assumed to be 100%. PLA, 10%, 20%, and 40% carbon-based base PLA filaments were added to 10 ml cell culture medium/gram and eluted at 37°C for 24 hours from 5% CO2 culture. The resulting formazan dye was quantified by measuring absorbance at 450 nm with a spectrometer (INFINITE M NANO, TECAN, Schweiz). The mean and standard deviation for each value were reported.

Example 12: Scaffold making

The scaffold was made of carbon-based PLA filament using a FDM 3D printer (K300, K.Clone, Daejeon, Republic of Korea) (FIG. 4).

Cylinders of 14 (width) Х 2 mm (height) were made directly in the Cura software. Head speed, layer thickness, and density of all layers were programmed with Cura software and stored in a gcode file format.

In the present invention, the infill density and pattern of the scaffold were modified. For infill density, two levels were evaluated: 30% and 50%.

And for the infill pattern, three levels were evaluated: triangle, tetrahedron, and zigzag (Figure 10).

The default settings for the scaffold's software are: Nozzle temperature: 200°C; Build plate temperature: 60°C; Layer height: 0.1mm; Resolution: Standard; Speed of the extruder 60 mm/s during extrusion and 120 mm/s during travel.

All the above statistical analysis was performed using SAS (SAS Institute Inc., Cary, NC, USA) for Windows v8.2. Differences in means between independent samples were tested using t-test. Data are expressed as mean±standard deviation. Statistical significance was considered at p <0.05.

The results of the above examples are detailed below.

hMSCs characteristic

The cell surface antigen profile of hMSCs of the present invention was confirmed by flow cytometry. The results indicated that the hMSCs­ related antigens CD13, CD90, and CD146 were highly expressed, but there was little expression of the cell surface antigen CD34 (FIG. 6 ).

SWCNTs characteristic

3.4 nm 및 24

2.7 nm인 SWCNTs을 얻었다(도 8(A)). 통상적인 SWCNTs의 TEM 이미지와 비교하여(도 8(B)), 본 발명에서 제조된 SWCNTs가 엉김없이 비교적 잘 분산되었다는 것을 확인하였다 .8 shows a TEM image of SWCNTs. The zeta-potential of SWCNTs corresponds to their respective surface charges reflecting functionalization on the surface of SWCNTs (FIG. 7 ). In conclusion, the average length and diameter of each 179

3.4 nm and 24

SWCNTs of 2.7 nm were obtained (Fig. 8(A)). Compared to the TEM image of conventional SWCNTs (FIG. 8(B)), it was confirmed that SWCNTs prepared in the present invention were relatively well dispersed without entanglement.

We present chemical and structural analysis of SWCNTs by Raman spectroscopy.

In general, carbon nanotubes graphitized with graphite crystals show a peak around 1580 cm ^-1 , and this is called a graphite mode G-band.

The peak near 1330 cm ^-1 is called the D-band because it is related to the structural problems of graphite or other carbon impurities other than CNTs. The spectrum of SWCNTs showed the following bands: 1343.3 cm ^-1 (D band), and 1591.1 cm ^-1 (G band).

Cytotoxicity experiment

The present inventors investigated the cytotoxicity test for hMSCs cultured on SWCNTs for 2 and 3 days, and the following results were shown as those of the control group.

The results of the properties of the experimental material provide the basis for understanding the properties of the nanoparticles for biological effects and provide the basis for further research.

Since interest in cytotoxicity of SWCNTs remains, the present invention evaluated the effect of SWCNTs concentration on the survival rate of hMSCs.

/ml)에서 제조하고 48 및 72 시간 동안 처리하였다. Cell metabolic viability was measured by absorbance of hMSCs using WST-1 (FIG. 10 ). SWCNTs at different concentrations (5, 7.5, 10, 15, and 20)

/ml) and treated for 48 and 72 hours.

As a result, SWCNTs did not show cytotoxicity to hMSCs, and cell growth was significantly higher than that of the control group when treated with SWCNTs (* p <0.05). Even at the highest dose (20 μg/mL), SWCNT increased 11% cell viability over 72 hours compared to control. SWCNT did not induce cytotoxicity at any concentration, and these results indicate that the nanoparticles can be widely applied in vivo.

Calcium accumulation dye

Based on the results of osteoblast differentiation, it is possible to deduce the expression pattern of bone-forming proteins. Figure 11 is a control group (Figure 11 (a), (a')) or 5 μg / ml (Figure 11 (b (b')), 7.5 μg / ml (Figure 11 (c), (c')), 10 Concentrations of μg/ml (Figure 11(d) (d')), 15 μg/ml (Figure 11(e), (e')) and 20 μg/ml (Figure 11(f), (f')) Images related to the formation of mineralized nodules based on alizarin red-S staining method treated with SWCNT for 7 and 14 days are shown.

The staining intensity for CNT treatment at 7.5 and 10 μg/ml was stronger than the control group. These results show that an appropriate concentration of SWCNT can affect cell differentiation and maturation. Therefore, the present inventors set the SWCNT 10/ml which showed the highest mineralization nodule formation in the present invention to the optimal concentration.

Real-time PCR

FIG. 12 shows specific markers of bone formation differentiation such as ALP, BSP, OPN, OCN, COL1 and RUNX2 measured for 7 and 14 days through real-time PCR. RNA was extracted from the cell culture on 7 and 14 days after the addition of the differentiation medium, and 10 μg/ml of SWCNT, which showed the highest mineralization in the differentiation medium, was added (* p <0.05).

ALP was highly expressed in the SWCNT group, which was clearly distinguished from that of the control group. ALP is a marker of cells that undergo differentiation to form preosteoblasts and osteoblasts, and is considered an important gene for bone mineral production.

The bone matrix proteins BSP, OPN and COL1 were also higher in the SWCNT-added cells than in the control group. OCN is the most important gene for differentiation of bone formation and shows the maximum expression during mineralization and accumulates in mineralized bone, higher in the SWCNT group.

Runx2 is an early transcription factor, and it has been demonstrated that osteoblast differentiation is not observed without Runx2. Runx2 also increased significantly in the SWCNT treatment group. According to analysis of gene expression, hMSCs cultured in the presence of SWCNT significantly upregulated all osteoblast specific genes.

carbon- Based Filament properties

In filament manufacturing, it is important to properly control parameters such as extraction speed, dosage and temperature.

This parameter directly affects the diameter and surface of the filament, and irregular surfaces are prone to contamination and very susceptible to infection. Therefore, it is important to extract filaments having a continuous and uniform diameter. In general, 1.75 mm filament should be managed with quality within 0.15 mm error rate. In the present invention, the carbon-based PLA filament was made into a constant diameter to fit the drive wheel of the FDM system (FIG. 13), and the extrusion specifications are shown in the lower table of FIG.

Representative FE-SEM images of carbon-based PLA filaments are shown in Figure 14. SWCNT is well mixed with PLA and the average diameter is as follows. PLA: 1.68 ± 0.2 mm; SWCNT-10% / PLA: 1.65 ± 0.1 mm; SWCNT-20% / PLA: 1.67 ± 0.2 mm; SWCNT-40% / PLA: 1.68 ± 0.2 mm. The surface of the carbon-based filament had a relatively smooth and uniform diameter.

Mechanical testing of carbon based filaments

In order to achieve biomimetics, the filament must be easy to process, have high mechanical strength, and the rate of decomposition must be adjustable. Hybrid systems using natural and synthetic polymers have recently been used to make such complex filaments.

It should be borne in mind that various materials and combinations have a direct effect on scaffold printing.

The stress-strain behavior observed in the present invention provides more tailored information about the scaffold due to its flexibility.

The stress-strain curve and tensile strength of the carbon-based filaments are shown in FIGS. 15(A) and 15(B), respectively. The stress-strain diagram shows important information comparing the mechanical properties of different materials and objects. When the strain rate is about 14%, the yield point of the PLA filament occurs, after which the load no longer increases.

Yields of SWCNT-10%/PLA filament and SWCNT-20%/PLA filament occurred when the strains were 20% and 11%, respectively. In the case of SWCNT-40% / PLA filament, the strain was about 10%.

These results show that SWCNT-20% / PLA filament and SWCNT-40% / PLA filament have higher elasticity than conventional PLA filament.

The tensile strength of PLA filament is 8±0.94 MPa, SWCNT-10%/PLA, SWCNT-20%/PLA and SWCNT-40%/PLA filaments are 10±0.84, 11±1.4 and 8±1.4 MPa, respectively, ( Figure 15 (B)). The tensile strength of SWCNT-20%/PLA filament was about 1.4 times higher than that of conventional PLA (*p <0.05).

The tensile strength of the composite filament was not proportional to the proportion of SWCNT added. This difference seems to be due to the reduced load transfer efficiency because the carbon nanotubes are not completely dispersed in the polymer matrix.

This appears to cause the CNTs to aggregate and reduce effective stress transfer as the amount of CNTs present in the polymer matrix increases above a critical level.

Thus, the scaffolds in the present invention were prepared in three experimental groups except SWCNT-40%/PLA filaments.

Cytotoxicity assessment of carbon-based filaments

The results of WST-1 analysis for carbon-based filaments are shown in FIG. 16.

There was no significant difference between the PLA filaments extracted from the control and carbon-based PLA filaments (p>0.05). These results showed that the carbon-based PLA filament was not cytotoxic.

Non-toxicity, biocompatibility and biodegradability are important properties of the scaffold material and must be degraded leaving only the desired tissue.

It would also be beneficial if it could act as a substrate that induces minimal inflammatory responses and promotes cell adhesion, proliferation and differentiation. The biodegradation and biocompatibility of this carbon based PLA composite material was not measured in the present invention. However, previous studies with human mesenchymal stem cells (hMSCs) have shown that these filaments do not cause toxicity or inflammation and significantly increase cell activity.

FDM technology Scaffolding making

3D printing factors such as particle size, layer thickness, distribution and orientation should be considered. These factors influence microporosity, which directly affects cell adhesion, proliferation and differentiation.

In the present invention, the present inventors modified two control parameters such as infill pattern and scaffold density. Two grades were evaluated for the scaffold: 30% and 50%. There are nine types of patterns in the software function, but only three commonly used triangles, tetrahedra and zigzag were selected.

Figure 17 shows different patterns and densities of the scaffold: (A) 30% triangle; (B) 50% triangle; (C) 30% tetrahedron; (D) 50% tetrahedron; (E) 30% zigzag; (F) Zigzag 50%.

Claims (12)

delete delete delete delete delete delete delete delete delete delete In a method of manufacturing a filament by extruding a sample synthesized by dissolving a polylactic acid (PLA) pellet and mixing a single-walled carbon nanotube powder into an extruder to produce a filament, a single-walled carbon nanotube powder compared to a polylactic acid (PLA) pellet is used. Filament manufacturing method characterized in that to increase the tensile strength in the prepared filament by adding in a weight ratio (w / w). In a method of manufacturing a filament by extruding a sample synthesized by dissolving a polylactic acid (PLA) pellet and mixing a single-walled carbon nanotube powder into an extruder to produce a filament, a single-walled carbon nanotube powder compared to a polylactic acid (PLA) pellet is used. Filament production method characterized in that to increase the tensile strength in the prepared filament by adding in a weight ratio (w / w).

Images