KR102129522B1 - anti-tumor Protien conjugated with lysosomal protease activatable probe for specific tumor cell imgaing and composition for imgae comprising the same - Google Patents

Abstract

In the protein-fluorescent complex according to the present invention, the protein is incorporated into cells by CD47 overexpressed in cancer tissues, and a probe that re-emits fluorescence is combined, effectively delivered to the cancer region, and increases the phagocytosis of macrophages by itself. It is a technology that can specifically image cancer cells because it can be decomposed within cells and emit fluorescence. In the future, this protein-fluorescent complex can be combined with various drugs as a carrier to further improve the anti-cancer effect and cancer cell imaging.

Description

Anti-tumor Protien conjugated with lysosomal protease activatable probe for specific tumor cell imgaing and composition for imgae comprising the same}

The present invention relates to a cancer cell-specific anti-cancer protein-fluorescent complex, and more specifically, through a protein receptor that is excessively present in cancer cells, it specifically delivers to cancer cells to enhance the phagocytic effect of phagocytic cells as well as fluorescence within cells. It relates to a novel protein-fluorescent complex.

Various techniques have been developed to diagnose and treat cancer, which is the number one cause of death in the past few years. The developed cytotoxic anti-cancer therapies have excellent effects on growth inhibition or death of cancer cells, but they have a problem of causing serious side effects because they have growth inhibition and death effects on both normal and cancer cells. In addition, in the case of diagnostic fluorescent contrast agents, there is a limitation in which the mechanism by which fluorescence enters the cell and is attached to the outside of the drug to act is unknown.

In order to solve this problem, efforts have been made to effectively deliver to cancer using various nanoparticles such as chitosan nanoparticles, PLGA, and liposomes. However, when nanoparticles are used as a carrier, the problem of causing toxicity in the body occurs because the nanoparticles themselves are foreign substances. Accordingly, a method of using particles having biocompatibility using a substance (protein, exosome, antibody, etc.) present in various bodies as a carrier has been continuously studied.

Carriers using biocompatible proteins, exosomes, etc. have a problem of low delivery effectiveness, and exosomes have excellent targeting ability, but they are rapidly degraded and removed in the body, so the effect of drug delivery to the target site There is a limit that is significantly lower. Because of the large size of antibodies, it is difficult to deliver drugs into cells. In addition, when using a receptor-specific antibody, it is currently unclear about the mechanism of the drug, such as whether the drug is delivered through a specific receptor or only forms a binding, thus limiting its clinical use.

Therefore, in order to overcome the above-mentioned problems, there is a need to develop a new anti-cancer drug and phosphor technology that has biocompatibility, can be delivered to a cancer site, and can emit only in cells.

Patent Document 1. Republic of Korea Patent Publication No. 10-2017-0111601

The present invention has been devised in view of the above-mentioned problems, and the object of the present invention is to provide a drug through a cancer cell receptor, and thus provide anti-cancer action and fluorescence in cells. It is to provide a composition for diagnosis or imaging.

Another object of the present invention is to provide a composition for preventing or treating cancer after application with other drugs by presenting the possibility of the protein-fluorescent complex as a carrier having drug delivery ability.

In order to achieve the above object, the present invention focuses on a polypeptide (a) composed of an amino acid sequence represented by SEQ ID NO: 1, wherein a fluorescent substance (b) and a quencher (c) are conjugated to both ends of the polypeptide, and the polypeptide ( Provided is a protein-fluorescent complex in which SIRPα protein (d) is bound to the COO- group of a).

The phosphor (b) may be bound to the N-terminus of the polypeptide (a), and the quencher (c) may be bound to the epsilon amine group of the lysine or arginine amino acid residue of the polypeptide (a).

The protein-fluorescent complex may exhibit fluorescence in cancer cells.

The molecular weight of the protein-fluorescent complex may be 18 kDa to 21 kDa depending on the number of phosphors.

The fluorescent substance (b) is fluorescein, fluorescein isothiocyanate (FITC), Oregon green, Texas red, Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7 , Indocarbocyanine, rhodamine, oxacarbocyanine, thiacarbocyanine, merocyanine, pyridyloxazole, nitrobenzoxadiazole (nitrobenzoxadiazole), benzoxadiazol, Nile red, Nile orange, acridine yellow, aumarine, crystal violet, and It may be any one selected from the group consisting of malachite green.

The quencher (c) is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dabbyl (dabcyl) , Eclipse, Deep Dark Quencher (DDQ), Blackberry Quencher, and Iowa black.

The SIRPα protein may be represented by SEQ ID NO: 3.

The protein-fluorescent complex specifically binds to CD47 overexpressed in cancer cells, is incorporated into cancer cells, and may be degraded by lysosomal enzymes present in cancer cells after incorporation to restore fluorescence.

The protein-fluorescent complex may be represented by the following structural formula 1.

[Structural Formula 1]

In addition, the present invention, in order to achieve the other object, provides a composition for the diagnosis or imaging of cancer containing the protein-fluorescent complex.

The cancer is breast cancer, ovarian cancer, stomach cancer, colon cancer, lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, uterine cancer, small intestine cancer, rectal cancer, anti-falloptic carcinoma, cervical carcinoma, vaginal carcinoma, esophageal cancer, lymph node cancer, bladder cancer, gallbladder cancer, Endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or urinary tract cancer, kidney cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) system) tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, pituitary adenoma, and fibrosarcoma cancer.

The present invention also provides a composition for preventing or treating cancer using the protein-fluorescent complex as an active ingredient in order to achieve the above another object.

The cancer is breast cancer, ovarian cancer, stomach cancer, colon cancer, lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, uterine cancer, small intestine cancer, rectal cancer, anti-falloptic carcinoma, cervical carcinoma, vaginal carcinoma, esophageal cancer, lymph node cancer, bladder cancer, gallbladder cancer, Endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or urinary tract cancer, kidney cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) system) tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, pituitary adenoma, and fibrosarcoma cancer.

The composition for preventing or treating cancer further includes an anti-cancer agent, and the anti-cancer agent is doxorubicin, cyclophosphamide, mecholrethamine, uramustine, melphalan , Chlorambucil, ifosfamide, bendamustine, carmustine, lomustine, streptozocin, busulfan, dacarbazine ( dacarbazine, temozolomide, thiotepa, altretamine, duocarmycin, cisplatin, carboplatin, nedaplatin, oxa Oxaliplatin, satraplatin, triplatin tetranitrate, 5-fluorouracil, 6-mercaptopurine, capecitabine ), cladribine, clofarabine, cystarbine, floxuridine, fludarabine, gemcitabine, hydroxyurea, Methotrexate, pemetrexed, pentostatin, thioguanine, camptothecin, topotecan, irinotecan, etoposide, etoposide (teniposide), mitosantrone, paclitaxel, docetaxel, izabepilone, vinble Vinblastine, vincristine, vindesine, vinorelbine, estramustine, maytansine, DM1 (mertansine, mertansine), DM4, dolastatin ( Dolastatin), auristatin E, auristatin F, monomethyl auristatin E, monomethyl auristatin F and derivatives thereof It may be any one or more selected from the group.

In addition, the present invention to achieve the above another object, 1) administering the protein-fluorescent complex to an individual; And 2) obtaining an image by the protein-fluorescent complex from the subject; provides a method for diagnosing cancer in the subject.

Since the protein-fluorescent complex according to the present invention is specifically activated in response to cancer cells, it can not only effectively diagnose and image cancer cells, but also promote macrophage phagocytosis in cancer cells by itself, thereby It has the effect of treating.

In addition, since the protein-fluorescent complex is mostly absorbed into the cell by the CD47 receptor specifically expressed in cancer tissues, and must be absorbed into the cell to emit fluorescence, cancer cells can be accurately targeted and accurately diagnosed.

The protein-fluorescent complex according to the present invention and the conventional nanoparticles and phosphors can solve the toxicity problem and the problem of low cancer specific activity, and do not include separate carriers, transporters and nanocarriers in vivo, This configuration has the advantage of accurately targeting cancer tissue and absorbing it into the cancer tissue to diagnose and treat cancer tissue. In addition, the protein-fluorescent complex has a great advantage that it can act as an anti-cancer agent that enhances the macrophage action of phagocytes by itself, without the need for a separate drug.

1A is a diagram showing a chemical structural formula of a lysosomal probe degraded in cancer cells. This introduces Cy5.5, a near-infrared fluorescent substance, into a peptide (lysine, K) having an amine group on a peptide (GFLG) base so that it is cut by lysosomal degrading enzymes in cancer cells, and the lysine or arginine located in the N-terminal group. It was designed such that the quencher (BHQ-3) was attached to the epsilon amine group. Each synthesis process was carried out in DMSO, and N-Methylmorpholine (NMM) and 4-Dimethylaminopyridine (DMAP) were synthesized under the catalyst. Each synthesis process consists of phosphor introduction, protection group removal, and quencher introduction. Each process was confirmed and purified by high-performance liquid chromatography (HPLC).
Figure 1b is a graph of the results measured by ultraviolet / visible light spectrophotometer (UV-VIS spectroscopy) for the protein-fluorescent composite prepared from Example 4.
Figure 1c is a graph quantified with an ultraviolet/visible spectrophotometer according to the concentration of the protein-fluorescent complex prepared from Example 4 in the presence of phosphate-buffered saline (PBS).
Figure 1d is a phosphate-buffered saline (phosphate-buffered saline, PBS) in the presence of the protein-fluorescent complex prepared from Example 4 absorbs the fluorescence to the fluorescence machine (photoluminescence, F-7000, Hitach, Tokyo, Japan) It is a graph shown by measurement.
Figure 1e is treated with the protein-fluorescent complex prepared in Example 3 under the conditions of the presence or absence of papain (endopeptidase) endopeptidase in the cell, and fluorescence (photoluminescence, PL) intensity. It is a measured graph and photo.
Figure 2a shows the structure of the protein-fluorescent complex of the present invention, a schematic diagram showing the binding relationship between a protein (SIRPα) and a lysosomal probe (probe). The protein is an amine group by reacting the carboxyl group (-COOH) of the lysosomal probe with Sulfo-NHS (N-hydroxysulfosuccinimide) and EDC (1-Ethyl-3- (3-dimethylaminopropyl) carbodiimide) under phosphate buffer pH 6.0. After changing to the form of NHS that can be bound, the protein (SIRRPα) is treated and prepared by reacting at room temperature for 4 hours.
Figure 2b is a picture of staining with coomassie blue by purifying the SIRPα protein from E. coli after cloning by inserting a modified SIRPα DNA sequence with enhanced binding ability to CD47 into the pET-28 vector.
Figure 2c is a protein-fluorescent complex prepared from Example 4, SIRPα protein prepared from Example 4-1), SIRPα-Cy5.5 prepared from Comparative Example 1 was incubated with papain enzyme, and then 15% Polyacrylamide gel After SDS-PAGE analysis by electrophoresis (PAGE gel), to confirm the fluorescence for each band, it is a picture taken with a fluorescence instrument (IVIS lumina).
2D is a graph analyzing the purification and size of the protein-fluorescent complex of Example 4 by Fast protein liquid chromatography (FPLC).
2E is a graph showing the protein-fluorescence complexes prepared from Examples 4 to 6 with papain, sigma, and confirming the re-lighting effect after 20 minutes with a fluorescence machine (photoluminescence, PL).
Figure 2f is to compare the protein-fluorescent composite (SIRPα-probe) prepared from Example 4 and the protein-phosphorescent body (SIRPα-Cy5.5) without the quencher of Comparative Example 1, each of these fluorescence machine (photoluminescence) , PL).
Figure 3a is a confocal microscopy (confocal microscopy) of cell uptake over time (30 minutes, 1 hour, 2 hours, 4 hours) after treatment of the protein-fluorescent complex of Example 6 on cancer cells (HT29). At this time, the blue color represents nuclear staining with DAPI (4',6-diamidino-2-phenylindole), and the red color indicates probe fluorescence with Cy5.5 (Cyanine5.5).
Figure 3b is a confocal microscopy image of each of the cancer cells (HT29, CT26CL25, B16F10) treated with the protein-fluorescent complex prepared from Example 6 with and without treatment (+, -) with a CD47 inhibitor (CD47 Ab) (bar =50 μm). At this time, red is the fluorescence of Cy5.5 degraded from the protein-fluorescent complex of Example 6, and blue is the nucleus of cells stained with DAPI solution.
Figure 3c is a confocal microscopic image taken over time (1h, 2h, 4h) of changes in the cellular uptake of the protein-fluorescent complex of Example 6 at the cellular level by enlarging cancer cells (CT26CL25) and Example 6 with a CD47 inhibitor It is a confocal microscope image (4h+inhibitor) taken at the cell level by enlarging the cancer cells (CT26CL25) treated with the protein-fluorescent complex of.
4A is a fluorescence image obtained by injecting the protein-fluorescent complex prepared from Example 6 into a tumor animal model, and photographing tumor animal models after 1 hour, 3 hours, 6 hours, and 24 hours, respectively. At this time, the left arm was injected with a CD47 inhibitor (CD47 blockin Ab).
Figure 4b is a tumor animal model of Figure 4a, after injecting the protein-fluorescent complex of Example 6 and after 24 hours, the cancer tissues of both sides of the tumor animal model were extracted, followed by IVIS Lumina Series III (PerkinElmer, Massachusetts, USA). ).
Figure 4c is a photograph of each of the cancer tissues in Figure 4b by confocal microscopy (confocal microscopy). At this time, the blue color represents nuclear staining with DAPI (4',6-diamidino-2-phenylindole), and the red color represents Cy5.5 (Cyanine5.5).
4D is an intravenous injection of a phosphate buffer (PBS), a lysosomal probe prepared from Example 3, and a protein-fluorescent complex prepared from Example 6 into a tumor animal model, and changes in fluorescence over time with IVIS Lumina Series III (PerkinElmer, Massachusetts, USA).
Figure 4e is an intravenous injection of phosphate buffer (PBS), a lysosomal probe prepared from Example 3, and a protein-fluorescent complex prepared from Example 6 into a tumor animal model, and after 24 hours, all organs (liver, lung , Gallbladder, kidney, heart, and cancer), and the fluorescence changes are imaged with IVIS Lumina Series III (PerkinElmer, Massachusetts, USA).
Figure 4f is an intravenous injection of a phosphate buffer (PBS), a lysosomal probe prepared from Example 3, and a protein-fluorescent complex prepared from Example 6 in a tumor animal model, and after 24 hours, cancer tissues are extracted and its fluorescence change is IVIS. Image taken with Lumina Series III (PerkinElmer, Massachusetts, USA).

Hereinafter, various aspects of the present invention and various implementation examples will be described in more detail.

The term "peptide" as used herein refers to a linear molecule formed by bonding amino acid residues to each other by peptide bonding.

For reference, representative amino acids and their abbreviations are alanine (Ala, A), isoleucine (Ile, I), leucine (Leu, L), methionine (Met, M), phenylalanine (Phe, F), proline (Pro, P), tryptophan (Trp, W), valine (Val, V), asparagine (Asn, N), cysteine (Cys, C), glutamine (Gln, Q), glycine (Gly, G), serine (Ser, S) ), Threonine (Thr, T), Tyrosine (Try, Y), Aspartic Acid (Asp, D), Glutamic Acid (Glu, E), Arginine (Arg, R), Histidine (His, H), Lysine (Lys, K) ).

An aspect of the present invention is centered on the polypeptide (a) consisting of the amino acid sequence represented by SEQ ID NO: 1 or 2, the fluorescent substance (b) and the quencher (c) are conjugated to both ends of the polypeptide, and the polypeptide (a ) Is a protein-fluorescence complex, in which SIRPα protein (d) is bound to the COO- group of.

Conventional materials for labeling or imaging cancer cells are rapidly decomposed and removed in vivo, and the function of targeting a target site is not only low, but also difficult to deliver into cells, thereby limiting practical application. In order to solve these problems, the present inventors tried to invent a substance that selectively labels cancer cells, penetrates effectively into cells, and decomposes by lysosomes present in the cancer cells to display fluorescence.

The protein-fluorescent complex of the present invention is a structural formula a formed by conjugating a phosphor (b) and a quencher (c) at both ends of the polypeptide, centered on the polypeptide (a) composed of the amino acid sequence represented by SEQ ID NO: 1 or 2. It is a form in which the lysosomal probe displayed and the amine group of the SIRPα protein represented by SEQ ID NO: 3 are combined. Since the protein-fluorescent complex is designed to be fluoresced by lysosomes present in cancer cells, usually exhibiting a fluorescence intensity near to zero in a quenching state, the protein-fluorescent complex inside the cancer cell When impregnated and penetrated, fluorescence is expressed by being effectively decomposed by lysosomes present in cancer cells.

Furthermore, when the protein-fluorescent complex is decomposed, the SIRPα protein itself has an effect as an anticancer agent. Therefore, it has been significantly improved to overcome and solve the side effects problems of the conventional nanoparticles and various synthetic transporters, and to simultaneously perform in vivo compatibility and fluorescence transporters as well as anticancer agents.

That is, the protein-fluorescent complex of the present invention has excellent biocompatibility, has few side effects, can specifically image cancer cells, and the protein-fluorescent complex of the present invention can be efficiently used as a carrier for various drugs. Was confirmed through various experimental examples.

In addition, since the protein-fluorescent complex is easily dissolved in a physiological solution, it is easy to absorb, has excellent bioavailability, and has improved stability and specificity of cancer cells, and thus is very useful for imaging and treatment as a carrier having an anticancer effect.

The protein-fluorescent complex is incorporated into cancer cells, degraded by lysosomes present in the cells, and fluorescent substances are released, and SIRPα protein (SEQ ID NO: 3) is decomposed, absorbed and transferred into cancer cells, and cancer tissue It has the effect of inhibiting growth and metastasis. Thereafter, all of the degraded protein-fluorescent complexes are degraded through metabolic processes in the body or discharged to the body through the kidneys, and thus do not remain in the body, and thus do not cause toxicity, and thus have excellent biocompatibility.

The protein-fluorescent complex according to the present invention may be one in which the lysosomal probe is combined in a molar ratio of 1 mol or more with respect to 1 mol of the SIRPα protein. If the lysosomal probe is 1 mol or less with respect to 1 mol of the SIRPα protein, a entanglement phenomenon occurs as the mol of the SIRPα protein increases, and thus there is a problem in that cell incorporation becomes difficult. In addition, as the mole of SIRPα protein increases, the unit price increases rapidly.

Furthermore, the protein-fluorescent complex according to the present invention has a lysosomal probe with a molar ratio of 2 mol or more with respect to 1 mol of the SIRPα protein in order to exhibit a re-lighting effect with high yield without introducing any additional process through a simple synthesis method. It is preferred. The protein-fluorescent complex prepared in the above-described ratio has an advantage in that the sensitivity of fluorescence is remarkably improved by efficiently re-emitting by lysosomes in cancer cells.

The polypeptide (a) may be composed of an amino acid sequence represented by SEQ ID NO: 1 or 2. The polypeptide is a peptide (GFLG)-based peptide that is coupled to one or more glycine and lysine (lysine, K) or arginine (R) amino acid residues at the C terminus to be cut by lysosomal degrading enzymes in cancer cells. .

The phosphor (b) is bound to the N-terminus of the polypeptide (a), and the quencher (c) is attached to the epsilon amine group (ε-amino group; side chain amine group) of the lysine or arginine amino acid residue of the polypeptide (a). May be combined.

That is, the protein-fluorescence complex is a combination of a quencher (c) capable of absorbing the luminescence of the phosphor (b) and exhibiting a quenching effect. Strong quenching by absorbing light of a wavelength emitted by the phosphor (b) It is to achieve the quenching effect. In other words, if the polypeptide (a) is not degraded by lysosomes present in cancer cells, fluorescence does not emit light, and this quenching effect is exhibited when the distance between the phosphor and the quencher is within tens of nm. When the polypeptide (a) is degraded by an enzyme, the phosphor (b) and the quencher (c) bound thereto are separated from each other and fall off, thereby eliminating the quenching effect. It is possible to perform imaging (imaging) to check the presence or absence of cancer cells inside. Since the protein-fluorescent complex of the present invention can specifically detect only cancer cells overexpressing CD47, it can be very useful for cancer diagnosis or cancer imaging or cancer cell monitoring.

The fluorescent substance (b) is fluorescein, fluorescein isothiocyanate (FITC), Oregon green, Texas red, Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7 , Indocarbocyanine, rhodamine, oxacarbocyanine, thiacarbocyanine, merocyanine, pyridyloxazole, nitrobenzoxadiazole (nitrobenzoxadiazole), benzoxadiazol, Nile red, Nile orange, acridine yellow, aumarine, crystal violet, and It may be any one selected from the group consisting of malachite green.

The type of the quencher used varies depending on the range of the emission wavelength of the phosphor (b), because the quenching effect can be maximized only when a quencher having a wavelength equal to or near the wavelength of the phosphor is used. In the present invention, the quencher is a dark quencher, a material capable of quenching the fluorescence of the phosphor because it absorbs the energy of the excited phosphor but does not emit the fluorescence energy outward, and is commercially widely commercialized as TAMRA (6-carboxytetramethyl -rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dabbyl, Eclipse, Deep Dark Quencher (DDQ), Blackberry Any one or more selected from the group consisting of Blackberry Quencher and Iowa black can be used.

In the present invention, Cy5.5, a near-infrared phosphor, is introduced at the C-terminal of the polypeptide (a), and a quencher (BHQ-3) is added to the epsilon amine group (side-chain amine group) of lysine (K) or arginine located at the N-terminal. ). It can use a variety of techniques well known to those skilled in the art. Specifically, the method of binding the quencher (c) or the phosphor (b) to the polypeptide (a) was performed in the DMSO state, and N-Methylmorpholine (NMM) and 4-Dimethylaminopyridine (DMAP) were synthesized under the catalyst. The synthesis process consists of three types: phosphor introduction, protection group removal and quenching, and each process is confirmed and purified by high-performance liquid chromatography (HPLC). When an amine group is present in the polypeptide and an N-hydroxysuccinimide (NHS form) functional group is present in the phosphor and the quencher, covalent bonding between the two molecules is possible. Alternatively, when a COOH group is present in the polypeptide, and an amine group is present in the phosphor and the quencher, since it is impossible to directly bind the two residues, a crosslinker (eg, dicyclohexylcarbodiimide (DCC), 1- It is possible to chemically bond the two using ethyl-3-(3-dimethylaminopropyl)-carbodiimide, hydrochloride (EDAC).

The SIRPα protein may be represented by SEQ ID NO: 3, which is expressed by SEQ ID NO: 4, by introducing an expression vector containing a modified SIRPα DNA sequence with improved binding ability to CD47 into a microorganism to obtain a transformed microorganism, As obtained by culturing this transformed microorganism, it can be confirmed that the SIRPα protein has a very good binding ability with CD47, which is overexpressed in cancer tissue, in the experimental example described later.

When a COOH group is present in the polypeptide (a) and an amine group is present in the SIRPα protein, it is impossible to directly bind the two residues, so the COOH group of the polypeptide (a) is Sulfo-NHS (N-hydroxysulfosuccinimide) And EDC (1-Ethyl-3- (3-dimethylaminopropyl) carbodiimide) to replace the N-hydroxysuccinimide (NHS form) functional group, and then form a covalent bond between the two molecules.

The protein-fluorescent complex reacts with CD47, which is overexpressed in cancer tissue, and is incorporated into cells, decomposed by lysosomes in cells, and fluoresces. At this time, the phosphor is Cy5.5, a cyanine phosphor that exhibits near infrared fluorescence, and emits near infrared light (650-900 nm). Therefore, the quenching body used BHQ3, which can absorb the fluorescence of the phosphor and maximize the quenching effect. When the near-infrared phosphor is used, it is suitable for in vivo fluorescence imaging of a bulky animal, such as a human, because it can image cancer cells deeper than a fluorescent molecule that emits light in a visible light band.

In addition, if necessary, the prepared protein-fluorescent complex can be purified or confirmed, and various techniques well known to those skilled in the art can be used.

The molecular weight of the protein-fluorescent complex may be 18 kDa to 21 kDa. When the molecular weight is exceeded, agglutination occurs, so that cancer cells cannot be fluorescently labeled effectively, and if it is less, the degree of fluorescence is lowered, which is disadvantageous for imaging in vivo.

The protein-fluorescent complex may be represented by the following structural formula 1.

[Structural Formula 1]

Tumors to which the protein-fluorescent complex of the present invention can be applied are not particularly limited, but may be general cancer diseases including solid cancer and blood born tumor, for example, breast cancer, ovarian cancer, stomach cancer, Colon cancer, lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, uterine cancer, small intestine cancer, rectal cancer, anti-falloptic carcinoma, cervical carcinoma, vaginal carcinoma, esophageal cancer, lymph node cancer, bladder cancer, gall bladder cancer, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer , Urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or urinary tract cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord Tumor, brainstem glioma, pituitary adenoma or fibrosarcoma cancer.

The preferred dosage of the protein-fluorescent complex of the present invention depends on the patient's condition and body weight, the degree of disease, the drug form, the route and duration of administration, but can be appropriately selected by those skilled in the art. For the desired effect, the dosage of the present invention is 0.0001 mg/kg to 100 mg/kg per adult male, based on the protein-fluorescent complex as an active ingredient, preferably 0.001 mg/kg to 60 mg/kg. The administration may be administered once to several times a day, but it is preferable to administer after fluorescence discharge at intervals of time. Depending on the patient's age, sex, weight, metabolic action, and other medications currently being taken, it may be appropriately increased or decreased. Therefore, the protein-fluorescent complex according to the present invention is to be manufactured in consideration of a range of effective amounts, and the formulated formulation is a specialized dosing method according to the needs of the individual and the judgment of experts who supervise or manage the administration of the medicine as necessary, and The formulation can be used or administered several times at regular time intervals.

The protein-fluorescent complex of the present invention can be administered to mammals such as rats, mice, rabbits, and humans in various routes, for example, orally or intraperitoneally, intranasally, intrarectally, intravenously, intramuscularly, subcutaneously, and into cerebral blood vessels. It can be administered by injection or the like.

The protein-fluorescent complex of the present invention is specifically incorporated into cancer cells only by injecting them into cells at a very low concentration, and thus can selectively fluoresce in the cancer cells. After injection into the cells, the intensity of fluorescence is measured at 700 to 900 nm with a fluorescence microscope. Since the protein-fluorescent complex of the present invention penetrates into the cancer cells in vivo or ex vivo and emits fluorescence, it is possible to effectively image the distribution of cancer cells non-invasively. That is, the protein-fluorescent complex of the present invention can be utilized as a composition to diagnose cancer by presenting where the cancer cells are present from an individual and where they are distributed, and monitoring or prognosis of the cancer treatment effect of a cancer patient It can be utilized as a composition for identification.

The protein-fluorescent complex of the present invention is formulated in a unit dose form by formulating using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily carried out by those skilled in the art to which the present invention pertains. It can be manufactured or can be manufactured by incorporating it into a multi-dose container. At this time, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of ex, powder, granule, tablet, or capsule, and may further include a dispersant or stabilizer.

Another aspect of the present invention relates to a composition for preventing or treating cancer using the protein-fluorescent complex as an active ingredient. The composition is administered to a subject suspected of cancer to provide information for diagnosing cancer by monitoring the presence of cancer and the distribution of cancer, confirming anti-cancer treatment effect, predicting responsiveness to a specific drug in advance, or cancer It can be used to check the location of. This is very important in the treatment of cancer.

Tumors to which the protein-fluorescent complex of the present invention can be applied are not particularly limited, but may be general cancer diseases including solid cancer and blood born tumor, for example, breast cancer, ovarian cancer, stomach cancer, Colon cancer, lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, uterine cancer, small intestine cancer, rectal cancer, anti-falloptic carcinoma, cervical carcinoma, vaginal carcinoma, esophageal cancer, lymph node cancer, bladder cancer, gall bladder cancer, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer , Urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or urinary tract cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord Tumor, brainstem glioma, pituitary adenoma or fibrosarcoma cancer.

The preferred dosage of the protein-fluorescent complex of the present invention depends on the patient's condition and body weight, the degree of disease, the drug form, the route and duration of administration, but can be appropriately selected by those skilled in the art. For the desired effect, the dosage of the present invention is 0.0001 mg/kg to 100 mg/kg per adult male, based on the protein-fluorescent complex as an active ingredient, preferably 0.001 mg/kg to 60 mg/kg. The administration may be administered once to several times a day, but it is preferable to administer after fluorescence discharge at intervals of time. Depending on the patient's age, sex, weight, metabolic action, and other medications currently being taken, it may be appropriately increased or decreased. Therefore, the protein-fluorescent complex according to the present invention is to be manufactured in consideration of a range of effective amounts, and the formulated formulation is a specialized dosing method according to the needs of the individual and the judgment of experts who supervise or manage the administration of the medicine as necessary, and The formulation can be used or administered several times at regular time intervals.

The protein-fluorescent complex of the present invention can be administered to mammals such as rats, mice, rabbits, and humans in various routes, for example, orally or intraperitoneally, intranasally, intrarectally, intravenously, intramuscularly, subcutaneously, and into cerebral blood vessels. It can be administered by injection or the like.

In the composition, the protein-fluorescent complex is absorbed into the cell in the presence of the CD47 receptor of cancer cells, and enzymatically decomposed in the lysosome to express fluorescence. This can serve as an indicator to not only image cancer, but also to see if it has been successfully delivered into cells.

The protein-fluorescent complex binds more strongly to the receptors of cancer cells, has cancer cell specific delivery power, and also has an anti-cancer effect of inhibiting the proliferation of cancer cells by increasing the macrophage action of phagocytes. Specifically, the CD47 receptor that is over-expressed in cancer cells is a survival method in which cancer cells survive by interfering with the role of phagocytic cells to recognize and remove cancer cells with a signal of'Don't eat me'. In the protein-fluorescent complex, the protein binds to CD47 and interferes with the suppression of macrophages in cancer cells. In other words, it means that autoimmunity can have anti-cancer effects by spontaneously attacking cancer cells around cancer cells.

Therefore, the protein-fluorescent complex of the present invention can be utilized as a composition for preventing or treating cancer.

The composition for preventing or treating cancer may achieve an anti-cancer effect only with the protein-fluorescent complex, but may further include an anti-cancer agent for an additional anti-cancer effect, and the anti-cancer agent is doxorubicin, cyclophosphamide , Mecholrethamine, uramustine, melphalan, chlorambucil, ifosfamide, bendamustine, carmustine, Lomustine, streptozocin, busulfan, dacarbazine, temozolomide, thiotepa, altretamine, duocarmycin , Cisplatin, carboplatin, nedaplatin, oxaliplatin, satraplatin, triplatin tetranitrate, 5-fluorouracil ( 5-fluorouracil, 6-mercaptopurine, capecitabine, cladribine, clofarabine, cystarbine, floxuridine , Fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, pentostatin, thioguanine, camptothecin , Topotecan, irinotecan, etoposide, teniposide, mitosantrone, pacley Paclitaxel, docetaxel, izabepilone, vinblastine, vincristine, vindesine, vinorelbine, estramustine, may Maytansine, DM1 (mertansine), DM4, dolastatin, auristatin E, auristatin F, monomethyl auristatin E , Monomethyl auristatin F (monomethyl auristatin F) and derivatives thereof.

Another aspect of the invention 1) administering the protein-fluorescent complex according to claim 1 to an individual; And 2) obtaining an image by the protein-fluorescent complex from the subject; relates to a method for diagnosing cancer in the subject.

In the above method, when an image in which a region emitting fluorescent light is observed from the individual is observed, it can be determined that cancer cells are present, and the position of the cancer cells can be determined.

When an anticancer agent is administered and measured by the method, when the area indicated by fluorescence on the image does not decrease or increase, it is determined that the therapeutic effect by the anticancer agent is positive, and when the area indicated by fluorescence increases, the anticancer agent It can be determined that the therapeutic effect by is negative.

Hereinafter, the present invention will be described in more detail through various examples, but the scope and contents of the present invention may not be interpreted as being reduced or limited by the following examples. In addition, if it is based on the disclosure of the present invention including the following examples, it is obvious that a person skilled in the art can easily carry out the present invention in which experimental results are not specifically presented, and patents to which such modifications and corrections are attached Naturally, it is within the scope of the claims.

In addition, the experimental results presented below are only representative of experimental results of the examples and comparative examples, and the effects of the various embodiments of the present invention, which are not explicitly presented below, will be described in detail in the corresponding parts.

Examples 1 and 2. Peptide (a) synthesis

A polypeptide represented by SEQ ID NO: 1 or 2 to be used as a lysosomal protease cleavable probe was designed and purchased by requesting peptron (Daejeon, South Korea). In the synthesis process, SSPS (solid-) in which the amino acid monomer protected with Fmoc is sequentially attached to the link amide resin in which the amide is fixed to the C-terminus and the polypeptide represented by SEQ ID NO: 1 or 2 is designed. phase peptide synthesis) method was used. The tert-Butyloxycarbonyl protecting group (BOC) protecting group was bound to a lysine (k) group or an arginine (R) group to make the polypeptide amine and sulfo-NHS bonds one-to-one.

N-Methylmorpholine (NMM), 4-Dimethylaminopyridine and papain hydrolase Sigma Aldrich.

[SEQ ID NO: 1]

GFLGGGKG

[SEQ ID NO: 2]

GFLGGGRG

Since the present invention directly binds a quencher to the amine group of a lysine group or an arginine group, the chain length of the lysosomal probe may vary depending on the type of quencher to be bound, and in this experimental example, BHQ-3 was used as a quencher. .

The purchased polypeptide was purified by reverse phase HPLC (Shimadzu prominence HPLC, Japan) using a Vydac Everest C18 column (250 mm×22 mm, 10 μm, USA). Elution is water-acetonitrile linear gradient (5-95% (v/v) of acetonitrile) containing 0.1% (v/v) trifluoroacetic acid Was carried out. The purified material was lyophilized using FDT12012 (Operon, Korea). The polypeptide is designed to be cut by lysosomal degrading enzymes in cells, and specifically, a peptide of the GFLG sequence is used as a backbone, and at least one glycine and lysine (K) or arginine (R) amino acid residue at the C terminal Combined.

Example 3. Preparation of lysosomal protease cleavable probe

[Structural Formula a]

The lysosomal probe was designed such that Cy5.5, a near-infrared phosphor, was conjugated to the N-terminus of the polypeptide synthesized from Preparation Example 1, and BHQ-3, a quencher, was attached to the epsilon amine group of the lysine amino acid residue of the polypeptide. The specific synthesis process is as follows.

The synthesis process was carried out in three steps: phosphor introduction step, protecting group removal step, and quencher introduction step. Each synthesis process was carried out in DMSO, and N-Methylmorpholine (NMM) and 4-Dimethylaminopyridine (DMAP) were synthesized under the catalyst. After the completion of each synthesis process, it was confirmed and purified by high-performance liquid chromatography (HPLC), and then freeze-dried and stored frozen.

1) Phosphor introduction step

First, the phosphor Cy5.5 (cyanine5.5) on the N-terminal portion of the polypeptide prepared from Example 1 was catalyzed under dimethyl sulfoxide (DMSO) N-Methylmorpholine (NMM) and 4-Dimethylaminopyridine (DMAP). After synthesizing at room temperature for 2 hours, it was analyzed and purified by high-performance liquid chromatography (HPLC).

2) Protection group removal steps

Trifluoroacetic acid: anisol: tertiary distilled water = 95:2.5 to remove the protective group present in the lysine group of the Cy5.5 (phosphor)-synthesized polypeptide synthesized in step 1). : 2.5 After the reaction under strong acid conditions, the solvent was removed through an evaporator.

3) Stage of introducing the quencher

Through the above step 2), a protective group-removed Cy5.5 (phosphor)-binding polypeptide was obtained, and BHQ3-NHS (Black Hole Quencher3-NHS) was added to the epsilon amine group of the exposed lysine (K) of the polypeptide. After 2 hours of room temperature reaction under N-Methylmorpholine (NMM) and 4-Dimethylaminopyridine (DMAP) catalyst, a lysosomal probe of Structural Formula a in which both phosphor and quencher were introduced was prepared. This was confirmed and purified by high-performance liquid chromatography (HPLC), and then freeze-dried and stored frozen.

Example 4. Protein-fluorescence complex ( SIRP α- LS probe) synthesis

[Scheme 1]

The lysosomal probe prepared from Example 2 was prepared by mixing SIRPα protein in various molar ratios (1:1 (Example 4), 1:1.5 (Example 5), and 1:2 (Example 6)).

1) Preparation of SIRPα protein

First, SIRPα protein gene as follows in cosmogenetech (SEQ ID NO: 4: CATATGGAAGAGGAGCTGCAGATCATCCAGCCTGACAAGTCCGTGCTGGTCGCTGCTGGTGAAACTGCCACTCTGCGTTGTACGATTACCAGCCTGTTCCCGGTGGGTCCAATCCAGTGGTTCCGTGGTGCTGGTCCGGGTCGTGTTCTGATCTACAACCAGCGTCAAGGTCCGTTCCCGCGTGTAACTACCGTTAGCGATACCACGAAGCGTAACAACATGGACTTTTCCATCCGCATTGGCAATATTACCCCGGCCGACGCGGGCACCTACTATTGCATCAAATTTCGCAAAGGCTCCCCGGATGATGTAGAATTTAAATCTGGCGCAGGCACCGAACTGTCTGTTCGCGCAAAACCGGTCGACGGTGGGTTTCTGGGTGGGGGAGGATGCGGTTGAAAGCTT) after the purchase, PCR, and cloned by inserting them (also modified to enhance the CD47 and the binding force), the SIRPα DNA sequence in pET-28 vector Next, E. coli was transfected and cultured. To isolate and purify the SIRPα protein from the culture of the transfected E. coli, His-tag column was used. The purified SIRPα protein was loaded via SDS-PAGE and then confirmed by Coomassie Brilliant Blue staining (FIG. 2B ). Figure 2b is a picture stained with coomassie blue (comassie blue) by purifying the SIRPα protein in E. coli after cloning by inserting a modified SIRPα DNA sequence having enhanced binding ability with CD47 into the pET-28 vector, Example 4 of the present invention It can be seen that the purified SIRPα protein was well separated and purified.

2) Preparation of protein-fluorescent complex

The lysosomal probe prepared from Example 2 was mixed with 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS), and a phosphate buffer (Phosphate-buffered saline, PBS) was used as a coupling reaction. ) Reaction was carried out for 5 minutes under a pH 6.0 solvent to convert the carboxyl group (-COOH) of the lysosomal probe into the NHS form. Thereafter, the purified SIRPα protein was added under a phosphate buffer solvent, reacted for 4 hours, and purified through a PD-10 column to prepare a protein-fluorescent complex. At this time, the molar ratio of the lysosomal probe and the SIRPα protein was prepared by mixing 1:1 (Example 4), 1:1.5 (Example 5), and 1:2 (Example 6).

The prepared protein-fluorescent complex was stored by lyophilization (Scheme 2).

Comparative Example 1. Preparation of protein-phosphor (SIRPα-Cy5.5) without quenching

All of the same as in Example 3, except that only the process of binding the near-infrared fluorescent material Cy5.5 to the N-terminal of the polypeptide synthesized from Preparation Example 1 was performed, and the process of binding the quencher BHQ-3 was not performed. Thus, a lysosomal probe to which the quencher was not bound was prepared.

Protein fluorescent complexes were prepared in the same manner as in Example 4, except that the lysosomal probe to which the quencher was not bound was used.

Experimental Example 1. Protein-fluorescence complex (SIRPα-LS probe) characterization

The synthesis analysis and performance of the resulting protein-fluorescent complex were confirmed as follows.

The difference between the experimental group and the control group was analyzed using one-way ANOVA and was considered statistically significant (indicated by an asterisk (*) in the drawing, * P<0.05, ** P<0.01, ***P<0.0001 ).

Figure 1b is a graph of the results measured by ultraviolet / visible light spectrophotometer (UV-VIS spectroscopy) for the protein-fluorescent composite prepared from Example 4, it was confirmed that a phosphor and a quencher are combined in the protein-fluorescent composite.

Figure 1c is a graph quantified by the ultraviolet / visible light spectrophotometer according to the concentration of the protein-fluorescent complex prepared in Example 4 in the presence of phosphate-buffered saline (PBS), UV as the concentration increases, It was confirmed that the intensity of visible light increased.

Figure 1d is a phosphate-buffered saline (phosphate-buffered saline, PBS) in the presence of the protein-fluorescent complex prepared from Example 4 absorbs the fluorescence to the fluorescence machine (photoluminescence, F-7000, Hitach, Tokyo, Japan) As a graph shown by measurement, the fluorescence intensity of 680 to 690 nm was high, but it was confirmed that the fluorescence intensity was almost close to 0 from 700 nm.

In order to confirm that the protein-fluorescent complex prepared from Example 4 was cleaved only by an enzyme present in the cell, fluorescence change was analyzed when papain, an intracellular peptide endopeptidase, was used. First, a papain solution dissolved in a phosphate buffer solution (Phosphate-buffered saline, PBS) pH 6.0 was prepared, and the protein-fluorescent complex prepared in Example 4 was added to the papain solution for 30 minutes at 37°C. The fluorescence restoration effect of the protein-fluorescent complex prepared from Example 4 reacted with the enzyme was confirmed by PL (Photoluminescence).

Figure 1e is treated with the protein-fluorescent complex prepared in Example 3 under the conditions of the presence or absence of papain (endopeptidase) endopeptidase in the cell, and fluorescence (photoluminescence, PL) intensity. It is a measured graph and photo. According to this, it can be confirmed that the protein-fluorescent complex of the present invention decomposes only by an enzyme present in the cell and exhibits fluorescence. If there is no enzyme present in the cell, it can be seen that the fluorescence intensity is close to zero.

Experimental Example 2. Fluorescence analysis of the protein-fluorescent complex (SIRPα-LS probe) prepared from Example 4 when incubated with lysosomal enzymes

To confirm that the protein-fluorescent complex prepared from Example 4 was cleaved only by an enzyme present in the cell, fluorescence change was analyzed when papain, an endopeptidase in the cell, was used. First, a papain solution dissolved in a phosphate buffer solution (Phosphate-buffered saline, PBS) pH 6.0 is prepared, and the protein-fluorescent complex prepared from Example 4 in the papain solution, SIRPα protein prepared from Example 4-1), is compared SIRPα-Cy5.5 prepared from Example 1 was added and treated at 37° C. for 30 minutes. The fluorescence restoration effect of each complex or protein was confirmed by PL (Photoluminescence).

Figure 2c is a protein-fluorescent complex prepared from Example 4, SIRPα protein prepared from Example 4-1), SIRPα-Cy5.5 prepared from Comparative Example 1 was incubated with papain enzyme, and then 15% Polyacrylamide gel After SDS-PAGE analysis by electrophoresis (PAGE　gel), to confirm the fluorescence for each band, it is a picture taken with a fluorescence instrument (IVIS lumina).

As shown in Figure 2c, it was confirmed that the protein-fluorescent complex according to the present invention shows bright fluorescence when cultured with papain. On the other hand, in the case of a protein-fluorescent body that does not bind to the quencher, it can be seen that the brightness is remarkably dark when viewed with the naked eye, despite having the same molecular weight as the present invention. Also, when only SIRPα protein was present, no fluorescence was observed.

Experimental Example 3. Characterization of the protein-fluorescence complex (SIRPα-LS probe) according to the molar ratio Figure 2d is a graph of the protein-fluorescence complex of Example 4 analyzed by protein liquid chromatography (Fast protein liquid chromatography,FPLC), According to this, it was confirmed that the protein-fluorescent complex of Example 4 was separated and purified with high purity.

2E is a graph showing the protein-fluorescence complexes prepared from Examples 4 to 6 with papain, sigma, and confirming the re-lighting effect after 20 minutes with a fluorescence machine (photoluminescence, PL). At this time, a papain enzyme solution that was not treated with anything was used as a control.

As shown in FIG. 2E, the protein-fluorescent complexes of Examples 4 to 6 exhibited fluorescence intensities of 3 to 9 times or more compared to the control group, and remarkable fluorescence was observed even with the naked eye. Through this, it was confirmed that the protein-fluorescent complex according to the present invention generates fluorescence only through reaction with an enzyme present in a cell, and usually has a fluorescence intensity close to 0.

In addition, when preparing the protein-fluorescence complex, when the molar ratio of the SIRPα protein and the lysosomal probe (LS) is 1:1 or more, sufficient fluorescence intensity is expressed, but the fluorescence intensity higher than 2 to 2.5 times is from 1:2. have.

Experimental Example 4. Analysis of quenching properties of protein-fluorescence complex (SIRPα-LS probe) according to whether quencher is bound

Figure 2f is to compare the protein-fluorescent composite (SIRPα-probe) prepared from Example 4 and the protein-phosphorescent body (SIRPα-Cy5.5) without the quencher of Comparative Example 1, each of these fluorescence machine (photoluminescence) , PL).

As shown in Figure 2f, it was confirmed that the protein-fluorescent complex of Example 4 exhibits an intensity close to 0 in the wavelength range of 690 to 800 nm, through which the protein-fluorescent complex of the present invention is present in cancer cells. As long as there was no enzyme, it was confirmed to exist in a lulled state. On the other hand, since the protein-phosphor of Comparative Example 1 does not contain a quencher, it was confirmed that it exhibits a fluorescence intensity of 1000 or more in a wavelength range of 680 to 760 nm. That is, it can be seen that the protein-phosphor without the quencher is not incorporated into the desired cancer cells, but exhibits fluorescence even in a general state, and thus there is a problem that it is difficult to make a clear diagnosis.

Experimental Example 5. Confirmation of intracellular delivery of protein-fluorescent complex in vitro

To target a specific cell of the protein-fluorescent complex according to the present invention and observe whether it can be imaged, HT-29 cells derived from human colorectal cancer cells are dispensed 2 x 10 ⁵ pieces in a 35 mm cover glass bottom dish. , Incubated at 37 °C in a carbon dioxide incubator for up to 4 hours in a culture solution treated with the protein-fluorescent complex prepared from Example 6 (20 μg/ml). In addition, the same procedure as above was performed using other cell lines (HT-29, CT26CL25, B16F10) in addition to the HT29 cells. Then, after treating the cell fixation solution, the solution was treated with a 4,6-diamidino-2-phenylindole (4′,6-diamidino-2-phenylindole, DAPI) solution for 10 minutes, subjected to nuclear staining, and absorbed by a confocal microscope. The decomposed protein-fluorescent complex (Example 6) and 4,6-diamidino-2-phenylindole were observed.

Figure 3a is a confocal microscopy (confocal microscopy) of cell uptake over time (30 minutes, 1 hour, 2 hours, 4 hours) after treatment of the protein-fluorescent complex of Example 6 on cancer cells (HT29). At this time, the blue color represents nuclear staining with DAPI (4',6-diamidino-2-phenylindole), and the red color indicates probe fluorescence with Cy5.5 (Cyanine5.5).

As shown in Figure 3a, it was confirmed that the fluorescence of the protein-fluorescent complex ingested and decomposed in the cells was observed from 2 hours. That is, it can be seen that the protein-fluorescent complex of the present invention, when processed into cells, is specifically ingested into the cancer cells and decomposed by enzymes present in the cells and changes from the lumen state to the fluorescence state, thereby emitting light. have. Therefore, the protein-fluorescent complex of the present invention is specifically taken up by cancer cells into cells, and decomposes within the cells to show fluorescence, so that only cancer cells can be effectively imaged. It can be seen that the protein-fluorescent complex of the present invention is processed and the imaging of the cells proceeds from 1 hour, and fully fluorescent from 4 hours.

Figure 3b is a confocal microscopy image of each of the cancer cells (HT29, CT26CL25, B16F10) treated with the protein-fluorescent complex prepared from Example 6 with and without treatment (+, -) with a CD47 inhibitor (CD47 Ab) (bar =50 μm). At this time, red is the fluorescence of Cy5.5 degraded from the protein-fluorescent complex of Example 6, and blue is the nucleus of cells stained with DAPI solution.

As shown in FIG. 3B, it can be confirmed that the protein-fluorescent complex according to the present invention is hardly absorbed by the cells in the CD47 inhibitor (CD47 Ab) treated (+) cancer cells (HT29, CT26CL25, B16F10). On the other hand, in the case of cancer cells (HT29, CT26CL25, B16F10) not treated with the CD47 inhibitor (CD47 Ab) (HT29, CT26CL25, B16F10), it was confirmed that the protein-fluorescence complex (Example 6) was absorbed and degraded in most cancer cells, indicating fluorescence. Did. Through this, it can be seen that the protein-fluorescent complex of the present invention is incorporated into cells by binding to CD47.

That is, the protein-fluorescent complex prepared from Example 6 of the present invention exists in a small state where the fluorescence intensity is almost 0 outside the cancer cells, and when cancer cells are present, through CD47 and receptor-ligand binding of the cancer cells, into the cells It can be seen that the impregnated protein-fluorescent complex is degraded by enzymes present in cancer cells and re-luminesce. Vitro by the above-mentioned result (in vitro) the protein according to the invention, it was confirmed that the fluorescent conjugate is effectively specific incorporation, is decomposed into a cancer cell refers to the fluorescence in the tumor cells.

Figure 3c is a confocal microscopic image taken over time (1h, 2h, 4h) of changes in the cellular uptake of the protein-fluorescent complex of Example 6 at the cellular level by enlarging cancer cells (CT26CL25) and Example 6 with a CD47 inhibitor It is a confocal microscope image (4h+inhibitor) taken at the cell level by enlarging the cancer cells (CT26CL25) treated with the protein-fluorescent complex of.

As shown in Fig. 3c, the protein-fluorescent complex according to the present invention was treated and gradually showed fluorescence in cancer cells after 1 hour, and at 4 hours, it was confirmed that all cancer cells were fluorescently labeled by the protein-fluorescent complex of the present invention. Did. Since typical imaging compositions label the outside of the cell, fluorescence may sometimes appear outside the cell. However, it was confirmed that the protein-fluorescent complex of the present invention is capable of imaging cells with fluorescence while being decomposed in a cell-embedded state, and exhibits very high accuracy that does not exhibit fluorescence at all in the absence of cells. In addition, it was confirmed that all three cancer cells present in the image are accurately imaged by fluorescence.

On the other hand, it was confirmed that almost no fluorescence occurs in cancer cells treated with a CD47 inhibitor (+inhibitor). The protein-fluorescent complex of the present invention is incorporated into cells and incorporated into cells through receptor-ligand binding to CD47 of cancer cells. -It was confirmed that the fluorescence complex was degraded by an enzyme present in the cancer cells, and re-fluorescence was once again confirmed.

Experimental Example 6. Selective accumulation of protein-fluorescent complex after administration of CD47 blockin Ab to the tumor animal model

Animal experiments in the present invention were performed according to the principles of the Korea Institute of Science and Technology (KIST), and were approved by institutional committees.

The tumor animal model was performed using thymic nude mice (6 weeks old, 20-25 g, male) purchased with Nara Bio INC (Gyeonggi-do, Korea). The male nude mice were inoculated with 1 X 10 ⁷ HT-29 cells on both thighs (n=3) or after inoculation on the left thigh, a tumor animal model was produced, and after 3-4 weeks, the cancer size was 80-100 ㎣. When the experiment was carried out.

4A is a fluorescence image obtained by injecting the protein-fluorescent complex prepared from Example 6 into a tumor animal model, and photographing tumor animal models after 1 hour, 3 hours, 6 hours, and 24 hours, respectively. At this time, the left arm was injected with a CD47 inhibitor (CD47 blockin Ab). The protein-fluorescent complex was administered intravenously 30 minutes after the inhibitor was injected. Figure 4b is a tumor animal model of Figure 4a, after injecting the protein-fluorescent complex of Example 6 and after 24 hours, the cancer tissues of both sides of the tumor animal model were extracted, followed by IVIS Lumina Series III (PerkinElmer, Massachusetts, USA). ). CD47 blocking Ab- is a cancer tissue not treated with a CD47 inhibitor, and CD47 blocking Ab+ is a cancer tissue treated with a CD47 inhibitor.

As shown in Figure 4a, it was confirmed that fluorescence appeared in the right arm without injection than in the left arm injected with CD47 inhibitor. In addition, it was confirmed that the protein-fluorescent complex of the present invention does not exhibit any fluorescence in normal cells other than cancer cells. This confirmed that the protein-fluorescent complex prepared from Example 6 entered the cell by the CD47 receptor and expressed fluorescence in cell experiments as well as in animal experiments. It can be seen that the protein-fluorescent complex according to the present invention can image cancer cells for up to 6 hours.

4A and 4B, when the protein-fluorescent complex of Example 6 was treated without the CD47 inhibitor (CD47 blocking -), the size of the cancer cells was reduced with time. Moreover, after 24 hours, even when the cancer tissue sizes of both sides were compared, the cancer tissues in which the protein-fluorescent complex (Example 6) of the present invention functioned properly were smaller, without interference from the CD47 inhibitor (CD47 blocking -). Was confirmed. That is, it can be seen that the protein-fluorescent complex of the present invention also has an anti-cancer effect.

Taken together, it was confirmed that the protein-fluorescent complex of the present invention can clearly image the exact location of cancer cells, so that the protein-fluorescent complex of the present invention can be used to image and diagnose cancer. In addition, it was confirmed that the protein-fluorescent complex of the present invention targets only cancer cells accurately in vitro and in vivo, and it can be seen that a high anticancer effect can be achieved when it is used as a drug delivery system. Moreover, it can be seen that the protein-fluorescent complex of the present invention has an anti-cancer effect by itself.

The protein-fluorescent complex prepared from Example 6 was injected into the tumor animal model, and a tumor animal model after 24 hours was prepared. At this time, a CD47 inhibitor (CD47 blockin Ab +) was injected into the left arm. The protein-fluorescent complex was administered intravenously 30 minutes after the inhibitor was injected. Both cancer tissues of the prepared tumor animal model were extracted. The extracted cancer tissue is sectioned (10 μm), the section slide (10 μm) is washed 3 times with DPBS, DAPI treated for 15 minutes at room temperature, placed on cover glass, and then confocal laser microscope. It was observed in Figure 4c. Figure 4c is a photograph of both cancer tissues of Figure 4b by confocal microscopy (confocal microscopy). The blue color represents nuclear staining with DAPI (4',6-diamidino-2-phenylindole), and the red color represents Cy5.5 (Cyanine5.5).

As shown in Figure 4c, it was confirmed that the fluorescence is expressed in the cells of the left cancer tissue without CD47 inhibitor treatment. That is, when the protein-fluorescent complex of the present invention is administered intravenously, imaging only cancerous tissues, the protein-fluorescent complex is specifically incorporated into cancer cells in response to CD47 of cancer cells, and the enzyme is present in the cells. This is because fluorescence appears as it decomposes and the quenching state is canceled. That is, it can be confirmed that only the cancer cells can be accurately targeted and imaged in vivo and externally by the protein-fluorescent complex (Example 6).

Experimental Example 7. Imaging of cancer cells through intravenous injection of protein-fluorescent complex into tumor animal model

1 x 10 ⁷ HT-29 cells were injected directly into the left thigh of the tumor animal model (n=3, each group). After about 3-4 weeks, when the cancer size reaches about 100 mm 2, phosphate buffer (PBS), a lysosomal probe prepared from Example 3, and a protein-fluorescent complex prepared from Example 6 are intravenously injected for 1 hour and 3 hours, respectively. , 6 hours, 24 hours after fluorescence change was observed. At this time, 100 μl of phosphate buffer and lysosomal probe were each injected into the tail vein into a tumor animal model.

4D is an intravenous injection of a phosphate buffer (PBS), a lysosomal probe prepared from Example 3, and a protein-fluorescent complex prepared from Example 6 into a tumor animal model, and changes in fluorescence over time with IVIS Lumina Series III (PerkinElmer, Massachusetts, USA).

Figure 4e is an intravenous injection of a phosphate buffer (PBS), a lysosomal probe prepared from Example 3, and a protein-fluorescent complex prepared from Example 6 into a tumor animal model, and after 24 hours, all organs (liver, lung , Gallbladder, kidney, heart, and cancer), and the fluorescence changes are imaged with IVIS Lumina Series III (PerkinElmer, Massachusetts, USA).

Figure 4f is an intravenous injection of a phosphate buffer (PBS), a lysosomal probe prepared from Example 3, and a protein-fluorescent complex prepared from Example 6 into a tumor animal model, and after 24 hours, cancer tissues are extracted and its fluorescence change is IVIS. Image taken with Lumina Series III (PerkinElmer, Massachusetts, USA).

As shown in Figure 4d, e, f, the lysosomal probe prepared from Example 3 was rapidly discharged from the body over time and hardly accumulated in cancer tissue. In addition, it was confirmed that cancer tissues could not be imaged and spread throughout the animal model body. On the other hand, the protein-fluorescent complex prepared from Example 6 confirmed that the fluorescence accumulated in the cancer tissue even after 24 hours as the delivery effect and accumulation ability were improved due to the protein, so that it was possible to accurately image the position of the cancer tissue.

In addition, after 24 hours of administration, it was confirmed that the fluorescence of the protein-fluorescent complex prepared from Example 6 was more intense in the organs of the extracted animal model.

Through the above-described results, when injected into the protein-fluorescent complex form of the present invention, as it enters the CD47 receptor in the cancerous tissue, the delivery ability and accumulation in the cancerous tissue are activated, and since the fluorescent substance is expressed only in the cell, the phosphor is intracellular. In addition to removing the uncertainty that may occur in, the sensitivity of the fluorescence is increased. In addition to this, the protein-fluorescent complex itself can be used as a substance capable of simultaneously enhancing the phagocytosis of macrophages and acting as an anti-cancer agent itself, fluorescing, that is, diagnosing and treating simultaneously. In addition, it is highly likely to be used as a carrier that can increase the anticancer effect by combining other drugs with this substance in the future.

<110> KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY <120> anti-tumor Protien conjugated with lysosomal protease activatable probe for specific tumor cell imgaing and composition for imgae comprising the same <130> HPC7963 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 1 Gly Phe Leu Gly Gly Gly Lys Gly 1 5 <210> 2 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 2 Gly Phe Leu Gly Gly Gly Arg Gly 1 5 <210> 3 <211> 118 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: SIRPa recombinant protein <400> 3 Glu Glu Glu Leu Gln Ile Ile Gln Pro Asp Lys Ser Val Leu Val Ala 1 5 10 15 Ala Gly Glu Thr Ala Thr Leu Arg Cys Thr Ile Thr Ser Leu Phe Pro 20 25 30 Val Gly Pro Ile Gln Trp Phe Arg Gly Ala Gly Pro Gly Arg Val Leu 35 40 45 Ile Tyr Asn Gln Arg Gln Gly Pro Phe Pro Arg Val Thr Thr Val Ser 50 55 60 Asp Thr Thr Lys Arg Asn Asn Met Asp Phe Ser Ile Arg Ile Gly Asn 65 70 75 80 Ile Thr Pro Ala Asp Ala Gly Thr Tyr Tyr Cys Ile Lys Phe Arg Lys 85 90 95 Gly Ser Pro Asp Asp Val Glu Phe Lys Ser Gly Ala Gly Thr Glu Leu 100 105 110 Ser Val Arg Ala Lys Pro 115 <210> 4 <211> 405 <212> DNA <213> Artificial Sequence <220> <223> SIRPa polynucleotide <400> 4 catatggaag aggagctgca gatcatccag cctgacaagt ccgtgctggt cgctgctggt 60 gaaactgcca ctctgcgttg tacgattacc agcctgttcc cggtgggtcc aatccagtgg 120 ttccgtggtg ctggtccggg tcgtgttctg atctacaacc agcgtcaagg tccgttcccg 180 cgtgtaacta ccgttagcga taccacgaag cgtaacaaca tggacttttc catccgcatt 240 ggcaatatta ccccggccga cgcgggcacc tactattgca tcaaatttcg caaaggctcc 300 ccggatgatg tagaatttaa atctggcgca ggcaccgaac tgtctgttcg cgcaaaaccg 360 gtcgacggtg ggtttctggg tgggggagga tgcggttgaa agctt 405

Claims (15)

Focusing on the polypeptide (a) consisting of the amino acid sequence represented by SEQ ID NO: 1 or 2, the fluorescent substance (b) and the quencher (c) are conjugated to both ends of the polypeptide, and the sequence is in the COO-group of the polypeptide (a). SIRPα protein (d) represented by the number 3 is bound, the phosphor (b) is bound to the N-terminus of the polypeptide (a), and is bound to the epsilon amine group of the lysine or arginine amino acid residue of the polypeptide (a). Protein-fluorescent complex to which the ore body (c) is bound. delete According to claim 1,
The protein-fluorescent complex is a protein-fluorescent complex characterized in that it exhibits fluorescence in cancer cells. According to claim 1,
The protein-fluorescence complex has a molecular weight of 18 kDa to 21 kDa, characterized in that the protein-fluorescence complex. According to claim 1,
The fluorescent substance (b) is fluorescein, fluorescein isothiocyanate (FITC), Oregon green, Texas red, Cy2, Cy3, Cy3B, Cy3.5, Cy5, Cy5.5, Cy7 , Indocarbocyanine, rhodamine, oxacarbocyanine, thiacarbocyanine, merocyanine, pyridyloxazole, nitrobenzoxadiazole (nitrobenzoxadiazole), benzoxadiazol, Nile red, Nile orange, acridine yellow, aumarine, crystal violet, and Protein-fluorescent complex, characterized in that any one selected from the group consisting of malachite green (malachite green). According to claim 1,
The quencher (c) is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dabbyl (dabcyl) , Eclipse, Deep Dark Quencher (DDQ), Blackberry Quencher, Iowa black (Iowa black) protein-fluorescent complex, characterized in that at least one selected from the group consisting of. delete According to claim 1,
The protein-fluorescent complex specifically binds to CD47 that is overexpressed in cancer cells, is incorporated into cancer cells, and is decomposed by lysosomal enzymes present in cancer cells after incorporation, thereby restoring fluorescence. . According to claim 1,
The protein-fluorescent complex is a protein-fluorescent complex characterized in that represented by the following structural formula 1.
[Structural Formula 1]

A composition for the diagnosis or imaging of cancer comprising the protein-fluorescent complex according to claim 1. The method of claim 10,
The cancer is breast cancer, ovarian cancer, stomach cancer, colon cancer, lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, uterine cancer, small intestine cancer, rectal cancer, anti-falloptic carcinoma, cervical carcinoma, vaginal carcinoma, esophageal cancer, lymph node cancer, bladder cancer, gallbladder cancer, Endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or urinary tract cancer, kidney cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) system) A composition for the diagnosis or imaging of cancer, characterized in that at least one selected from the group consisting of tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, pituitary adenoma and fibrosarcoma cancer. A composition for preventing or treating cancer using the protein-fluorescent complex according to claim 1 as an active ingredient. The method of claim 12,
The cancer is breast cancer, ovarian cancer, stomach cancer, colon cancer, lung cancer, colon cancer, bone cancer, pancreatic cancer, skin cancer, uterine cancer, small intestine cancer, rectal cancer, anti-falloptic carcinoma, cervical carcinoma, vaginal carcinoma, esophageal cancer, lymph node cancer, bladder cancer, gallbladder cancer, Endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, urethral cancer, penile cancer, prostate cancer, chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, kidney or urinary tract cancer, kidney cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) system) A composition for preventing or treating cancer, characterized in that it is at least one selected from the group consisting of tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, pituitary adenoma and fibrosarcoma cancer. The method of claim 12,
The composition for preventing or treating cancer further includes an anti-cancer agent, and the anti-cancer agent is doxorubicin, cyclophosphamide, mecholrethamine, uramustine, melphalan , Chlorambucil, ifosfamide, bendamustine, carmustine, lomustine, streptozocin, busulfan, dacarbazine ( dacarbazine, temozolomide, thiotepa, altretamine, duocarmycin, cisplatin, carboplatin, nedaplatin, oxa Oxaliplatin, satraplatin, triplatin tetranitrate, 5-fluorouracil, 6-mercaptopurine, capecitabine ), cladribine, clofarabine, cystarbine, floxuridine, fludarabine, gemcitabine, hydroxyurea, Methotrexate, pemetrexed, pentostatin, thioguanine, camptothecin, topotecan, irinotecan, etoposide, etoposide (teniposide), mitosantrone, paclitaxel, docetaxel, izabepilone, vinble Vinblastine, vincristine, vindesine, vinorelbine, estramustine, maytansine, DM1 (mertansine, mertansine), DM4, dolastatin ( Dolastatin), auristatin E, auristatin F, monomethyl auristatin E, monomethyl auristatin F and derivatives thereof Cancer prevention or treatment composition, characterized in that at least one selected from the group. 1) administering the protein-fluorescent complex according to claim 1 to an individual; And
2) obtaining an image by the protein-fluorescent complex from the subject; a method of providing information necessary for the diagnosis of cancer of the subject.

Images