KR102121746B1 - Microorganism for producing poly-3-hydroxybutyrate, method for producing the same, and method for producing poly-3-hydroxybutyrate using the same - Google Patents

Abstract

The present invention relates to a microorganism for producing poly-3-hydroxybutyrate (PHB), a method for producing the microorganism, and a method for producing PHB using the same. According to the present invention, the method is capable of producing high-concentration of PHB, thereby being effectively used for the production of bioplastic which is a substitute for plastic. In addition, according to the present invention, the present invention is capable of lowering production costs of bioplastic in the commercialization thereof.

Description

Microorganisms for producing polyhydroxybutyrate, methods for producing them, and methods for producing polyhydroxybutyrate using the same{Microorganism for producing poly-3-hydroxybutyrate, method for producing the same, and method for producing poly-3-hydroxybutyrate using the same}

The present invention relates to a microorganism for producing polyhydroxybutyrate (poly-3-hydroxybutyrate; PHB), a method for manufacturing the same, and a method for producing polyhydroxybutyrate using the same, more specifically, a threonine synthetic gene and polyhydroxy The present invention relates to a method for producing high concentration of PHB by recombinant E. coli using a polyhydroxyalkanoate (PHA) synthetic gene.

Petrochemical-based plastics are important necessities to improve the quality of life of mankind in modern society, and have excellent properties such as strength, durability, processability, and economic efficiency, and are used in almost all industries. However, despite these excellent properties, the accumulation of non-degradable plastics in the environment has become a global problem.

Solutions for plastic waste disposal include incineration, recycling and biodegradation, but most of these methods can cause potential problems. In order to replace such petrochemical-derived plastics, research on bioplastics with high biodegradability has been conducted, which is a polymer synthesized by starch, cellulose, lactic acid, and glycolic acid, and polysynthesized by microorganisms. It targets hydroxy alkanoate (hereinafter referred to as PHA).

Among them, PHA is a 100% biodegradable polymer, which is synthesized by various microorganisms, which has properties similar to synthetic plastics, and because it is completely decomposed into water and carbon dioxide under aerobic conditions, it is spotlighted as a substitute for plastics.

Polyhydroxybutyrate (PHB) is the first PHA found and the most widely studied bioplastic. PHB is a cell storage material that is accumulated as a carbon source and energy source by various microorganisms, and is a type of polyester composed of 3-hydroxy acid (3HB).

PHB is in the spotlight as a biodegradable plastic to replace the existing petrochemical plastics, but its commercialization is limited due to its high production cost, and its economy is less than that of conventional petrochemical plastics. Many studies have been conducted to lower the production cost of PHB, but commercialization is still difficult.

Accordingly, the present inventors introduced the thrABine- derived threonine synthetic gene thrABC and the polyhydroxyalkanoate (PHA) synthetic gene into E. coli, and have high concentrations of polyhydroxybutyrate (PHB). ).

Accordingly, an object of the present invention is to provide a microorganism for producing PHB transformed by introducing a threonine synthetic gene and a PHA synthetic gene.

Another object of the present invention is to provide a method for producing a microorganism for producing PHB comprising a recombinant microorganism producing step of transforming a microorganism by introducing a threonine synthetic gene and a PHA synthetic gene.

Another object of the present invention is to provide a PHB production method comprising the following steps:

Recombinant microorganism production step of transforming microorganisms by introducing threonine synthesis gene and PHA synthesis gene; And

Culture step of culturing the recombinant microorganism.

Another object of the present invention relates to the use of PHB production of recombinant microorganisms transformed by introducing threonine synthesis gene and PHA synthesis gene.

The present invention relates to a microorganism for producing polyhydroxybutyrate (poly-3-hydroxybutyrate; PHB), a method for manufacturing the same, and a method for producing polyhydroxybutyrate using the same, and the recombinant microorganism according to the present invention can produce high concentration of PHB .

The present inventors confirmed that a high concentration of PHB was produced from the recombinant E. coli by preparing recombinant E. coli using the threonine synthetic gene and the polyhydroxyalkanoate (hereinafter referred to as PHA) synthetic gene.

Hereinafter, the present invention will be described in more detail.

One aspect of the present invention is a microorganism for producing PHB transformed by introducing a threonine synthesis gene and a PHA synthesis gene.

The term "threonine synthetic gene" in the present specification means a genetic regulatory unit composed of one to several genes in synthesizing threonine and simultaneously expressing the same regulatory action.

The term "PHA synthetic gene" in the present specification means a genetic regulatory unit composed of one to several genes in synthesizing PHA and simultaneously expressing the same regulatory action.

The threonine synthesis gene is a gene encoding a homoserine dehydrogenase (hereinafter referred to as thrA), a gene encoding a homoserine kinase (hereinafter referred to as thrB), and a gene encoding a threonine synthase (hereinafter referred to as thrC). It may be to include, but is not limited to this.

The threonine synthesis gene may be derived from Escherichia coli , and may be composed of a nucleotide sequence represented by SEQ ID NO: 3, but is not limited thereto.

The PHA synthetic gene is a gene encoding beta-ketothiolase (hereinafter referred to as phaA), a gene encoding acetoacetyl-CoA reductase (hereinafter referred to as phaB), and a PHB-synthetase (PHB) -synthase; phaC) may include a gene encoding, but is not limited thereto.

The PHA synthetic gene may be derived from Ralstonia eutropha , but is not limited thereto.

The transformation may be performed by introducing a vector containing a threonine synthetic gene and a PHA synthetic gene into a microorganism, or a vector comprising a threonine synthetic gene and a vector containing the PHA synthetic gene, respectively. Can be.

The term "vector" means a means for expressing a gene of interest in a host cell. For example, viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retroviral vectors and adeno-associated virus vectors. Vectors that can be used as recombinant vectors are plasmids often used in the art (e.g., pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX series, pET series and pUC19, etc.), phages (e.g., λgt4λB, λ-Charon, λΔz1 and M13, etc.) or viruses (e.g., SV40, etc.) can be engineered, but not limited to. .

The recombinant vector can typically be constructed as a vector for cloning or for expression. The expression vector can be used in the art, conventional ones used to express foreign proteins in plants, animals or microorganisms. The recombinant vector can be constructed through various methods known in the art.

The recombinant vector can be constructed using prokaryotic or eukaryotic cells as hosts. For example, when the vector to be used is an expression vector, and a prokaryotic cell is a host, a strong promoter (eg, pL ^λ promoter, CMV promoter, trp promoter, lac promoter, tac promoter) capable of progressing transcription, T7 promoter, etc.), a ribosome binding site for initiation of translation and a transcription/detox termination sequence. When eukaryotic cells are used as hosts, replication origins that operate in eukaryotic cells included in vectors include f1 replication origin, SV40 replication origin, pMB1 replication origin, adeno replication origin, AAV replication origin, and BBV replication origin, etc. It is not limited. In addition, a promoter derived from the genome of a mammalian cell (eg, a metallothionine promoter) or a promoter derived from a mammalian virus (eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, Cytomegalovirus promoter and HSV's tk promoter) can be used and generally have a polyadenylation sequence as the transcription termination sequence.

In one example of the present invention, a transformant can be made by inserting a recombinant vector into a host cell, and the transformant may be obtained by introducing the recombinant vector into an appropriate host cell. Electroporation may be used as a method for introducing the recombinant vector into the host cell, but is not limited thereto.

The host cell is a cell capable of continuously cloning or expressing the expression vector while being stable, and any host cell known in the art can be used.

Host cells used in the present invention may include E. coli, yeast, animal cells, plant cells, or insect cells, and prokaryotic cells include, for example, E. coli JM109, E. coli BL21, E. Bacillus strains such as coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringiensis, and Salmonella typhimurium, Serratia marcesons and Intestinal bacteria and strains such as various Pseudomonas species, and when transformed into eukaryotic cells, as host cells, yeast (Saccharomyce cerevisiae), insect cells, plant cells and animal cells, such as Sp2/0, CHO (Chinese hamster ovary) K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell line, etc. may be used, but are not limited thereto.

The transport (introduction) of the polynucleotide or a recombinant vector containing the same into the host cell may use a transport method well known in the art. For the transport method, for example, when the host cell is a prokaryotic cell, a CaCl ₂ method or an electroporation method can be used. When the host cell is a eukaryotic cell, a micro-injection method, a calcium phosphate precipitation method, an electroporation method, Liposomal mediated transfection and gene bombardment may be used, but are not limited thereto.

The method for selecting the transformed host cell can be easily performed according to a method well known in the art using a phenotype expressed by a selection label. For example, when the selection marker is a specific antibiotic resistance gene, the transformant can be easily selected by culturing the transformant in a medium containing the antibiotic.

Wherein the microorganism is Escherichia coli; can be a (Escherichia coli hereinafter E. coli), Pseudomonas species (Pseudomonas), LAL Stony O in (Ralstonia) or alkali in jeneseu (Alcaligenes), for example, the E. coli XL1-Blue It is preferred, but is not limited thereto.

Another aspect of the present invention is a method for producing a microorganism for PHB production comprising a step of producing a recombinant microorganism transforming a microorganism by introducing a threonine synthetic gene and a PHA synthetic gene.

The threonine synthetic gene may include a gene encoding thrA, a gene encoding thrB, and a gene encoding thrC, but is not limited thereto.

The threonine synthesis gene may be derived from E. coli, and may be composed of a nucleotide sequence represented by SEQ ID NO: 3, but is not limited thereto.

The PHA synthetic gene may include a gene encoding phaA, a gene encoding phaB, and a gene encoding phaC, but is not limited thereto.

The PHA synthetic gene may be derived from Ralstonia eutropha, but is not limited thereto.

The transformation may be performed by introducing a vector containing a threonine synthetic gene and a PHA synthetic gene into a microorganism, or a vector comprising a threonine synthetic gene and a vector containing the PHA synthetic gene, respectively. Can be.

The microorganism may be E. coli , for example, E. coli XL1-Blue is preferred, but is not limited thereto.

Another aspect of the invention is a method for producing PHB comprising the following steps:

Recombinant microorganism production step of transforming microorganisms by introducing threonine synthesis gene and PHA synthesis gene; And

Culture step of culturing the recombinant microorganism.

The threonine synthetic gene may include a gene encoding thrA, a gene encoding thrB, and a gene encoding thrC, but is not limited thereto.

The threonine synthesis gene may be derived from E. coli, and may be composed of a nucleotide sequence represented by SEQ ID NO: 3, but is not limited thereto.

The PHA synthetic gene may include a gene encoding phaA, a gene encoding phaB, and a gene encoding phaC, but is not limited thereto.

The PHA synthetic gene may be derived from Ralstonia eutropha, but is not limited thereto.

The transformation may be performed by introducing a vector containing a threonine synthesis gene and a PHA synthesis gene into a microorganism, and also a vector comprising a threonine synthesis gene and a vector containing a PHA synthesis gene, respectively. Can be.

The microorganism may be E. coli , for example, E. coli XL1-Blue is preferred, but is not limited thereto.

The culturing step may be performed in a medium containing a carbon source, and the carbon source may be glucose, fructose or sucrose, for example, glucose, It is not limited to this. The medium may be performed in LB (Luria Bertani) medium containing 15 to 25 g/L of glucose, but is not limited thereto.

The culturing step may be performed under aerobic conditions, but is not limited thereto.

The culture step may be performed at 20 to 35°C, 20 to 32°C, 24 to 35°C, 24 to 32°C, or 26 to 35°C, for example, may be performed at 26 to 32°C, It is not limited to this.

The method may further include a recovery step of recovering PHB from a culture medium in which recombinant microorganisms have been cultured.

The present invention relates to a microorganism for producing polyhydroxybutyrate (poly-3-hydroxybutyrate; PHB), a method for manufacturing the same, and a method for producing polyhydroxybutyrate using the same, according to the above method, a high concentration of polyhydroxybutyrate (poly- Since 3-hydroxybutyrate (PHB) can be produced, it can be effectively used for bioplastic production as a plastic substitute.

In addition, according to the present invention, the production cost can be lowered in the commercialization of bioplastics.

1 is a schematic diagram showing a pRadgro vector map including a threonine synthetic gene derived from E. coli.
Figure 2 is a schematic diagram showing a pKM212-MCS vector map containing polyhydroxy alkanoate (hereinafter referred to as PHA) synthetic gene derived from Ralstonia eutropha .
Figure 3a is a graph comparing the concentration of dry cells of recombinant E. coli transformed with threonine synthetic gene and PHA synthetic gene and recombinant E. coli transformed with PHA synthetic gene only.
3B is a graph comparing glucose consumption of recombinant E. coli transformed with threonine synthetic gene and PHA synthetic gene and recombinant E. coli transformed with PHA synthetic gene only.
3C is a graph comparing PHB concentrations of recombinant E. coli transformed with threonine synthetic gene and PHA synthetic gene and recombinant E. coli transformed with PHA synthetic gene only.
3D is a graph comparing the intracellular PHB content of recombinant E. coli transformed with threonine synthetic gene and PHA synthetic gene and recombinant E. coli transformed with PHA synthetic gene only.

Hereinafter, the present invention will be described in more detail by the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Throughout this specification, "%" used to indicate the concentration of a specific substance, unless otherwise specified, solids/solids (weight/weight)%, solids/liquids (weight/volume)%, and The liquid/liquid is (volume/volume)%.

Example 1: Cloning of the threonine synthetic gene

In order to clone the threonine (Threonine) synthetic gene thrABC , a primer consisting of nucleotide sequences represented by SEQ ID NOs: 1 and 2 was used. The base sequence of the primer for cloning the threonine synthesis gene derived from Escherichia coli represented by SEQ ID NO: 3 is shown in Table 1 below.

Sequence number designation Sequence (5' -> 3') One thrABC forward primer ATTA TCTAGA GCATGCGAGTGTTGAAG (underlined: Xba Ⅰ restriction enzyme recognition cleavage site) 2 thrABC reverse primer ATTA GTCGAC GATAATGAATAGATTTTACTGATG (underlined: Sal I restriction enzyme recognition cleavage site)

'TCT AGA' of the forward primer is a cleavage site recognized by Xba I restriction enzymes (NEB, Ipswitch, MA, USA), and'GTC GAC' in the reverse primer is Sal I restriction enzyme (NEB, Ipswitch, MA, USA) It is a recognized cutting site. Using the prepared primer set, E. coli genomic DNA was used as a template strand, and gene amplification was performed through polymerase chain reaction (PCR).

Plasmid and threonine synthesis genes were restricted to Xba I and Sal I respectively to ligate the amplified gene to the pRadgro vector (D. Appukuttan et al., Applied and Environmental Microbiology 82(4) (2016) 1154-1166) After digestion with an enzyme, ligase was treated. The recombinant plasmid was named pRadgro- thrABC as shown in FIG. 1, and transformation was performed using electroporation on Escherichia coli XL1-Blue, a host for transformation. For comparison, pRadgro vector was transformed into E. coli XL1-Blue as a control.

Example 2: Preparation of transformants

A gene encoding beta-ketothiolase (hereinafter referred to as phaA), a PHA synthetic gene derived from Ralstonia eutropha , as shown in FIG. 2, acetoacetyl-CoA reductase; Pre-sale of pKM212-MCS vector (SJ Park et al., Metabolic Engineering 20 (2013) 20-28) containing a gene encoding phaB) and a gene encoding PHB-synthase (hereinafter phaC) E. coli XL1-Blue was transformed using electroporation, and the transformed E. coli LB (Luria Bertani, LB; BD, Franklin Lakes, NJ, New Jersey, containing 50 ug/ml kanamycin antibiotic) USA) medium plates.

Next, the pRadgro vector containing the threonine synthesis gene was transformed into the selected recombinant E. coli by electroporation, and the transformation was confirmed on an LB medium plate containing 50 ug/ml kanamycin and 100 ug/ml ampicillin antibiotic. Did. For comparative experiments, the pRadgro vector was transformed into E. coli XL1-Blue, and the transformation was confirmed on an LB medium plate containing 50 ug/ml kanamycin and 100 ug/ml ampicillin antibiotic.

Example 3: Recovery and analysis of polyhydroxybutyrate

In order to produce a high concentration of PHB using the transformed E. coli, 50 ug/ml kanamycin and 100 ug/ml ampicillin antibiotic were pre-incubated for 18 hours at 30°C in LB medium. Subsequently, the pre-cultured recombinant E. coli was inoculated in 30 ml LB medium containing 20 g/l glucose, 0.8 g/L MgSO ₄ (sulfuric acid) and 50 ug/ml kanamycin 100 ug/ml ampicillin antibiotic. Incubated under miracle conditions (30°C, 250 rpm, 48 hr).

Next, the cells were recovered to measure the concentration of dry cells, consumption of glucose, and concentration and content of PHB.

The concentration of the dried cells was measured by collecting 5 ml of the culture solution, centrifuging it, putting it in a pre-weighed microtube, drying it in a dry oven at 80° C. for 24 hours, and weighing it.

The consumption amount of glucose was filtered by centrifuging the supernatant obtained by centrifugation, and then the filtered filtrate was analyzed using high performance liquid chromatography (HPLC).

The concentration and content of PHB were extracted by reacting the dried cell precipitate with 5% (v/v) sulfuric acid and chloroform in a water bath at 98°C for 3 hours, and then extracting the PHB, followed by gas chromatography. Analysis.

As a result, as can be seen in Figures 3a and 3b, in cultured for 48 hours, in recombinant E. coli containing a vector containing a threonine synthesis gene, glucose consumption was not significantly different, but the dry cell concentration increased by about 4.31%.

As can be seen in Figure 3c and 3d, it was confirmed that the production of PHB is increased by about 12.94%, and the content of PHB in the cells was also increased by about 8.33%.

Dry cell concentration (g/L) Glucose consumption (g/L) PHB production (g/L) Yield (g PHB/g glucose) PHB content (wt%) CnCAB+pRadgro 8.36±0.04 20.00 6.03±0.24 0.30 72.00±3.10 CnCAB+thrABC 8.72±0.04 20.00 6.81±0.19 0.34 78.00±1.90

<110> Industry-University Cooperation Foundation Chonnam University <120> Microorganism for producing poly-3-hydroxybutyrate, method for producing the same, and method for producing poly-3-hydroxybutyrate using the same <130> PN190043 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> thrABC forward primer <400> 1 attatctaga gcatgcgagt gttgaag 27 <210> 2 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> thrABC reverse primer <400> 2 attagtcgac gataatgaat agattttact gatg 34 <210> 3 <211> 4715 <212> DNA <213> Escherichia coli <400> 3 tatctagagc atgcgagtgt tgaagttcgg cggtacatca gtggcaaatg cagaacgttt 60 tctgcgtgtt gccgatattc tggaaagcaa tgccaggcag gggcaggtgg ccaccgtcct 120 ctctgccccc gccaaaatca ccaaccacct ggtggcgatg attgaaaaaa ccattagcgg 180 ccaggatgct ttacccaata tcagcgatgc cgaacgtatt tttgccgaac ttttgacggg 240 actcgccgcc gcccagccgg ggttcccgct ggcgcaattg aaaactttcg tcgatcagga 300 atttgcccaa ataaaacatg tcctgcatgg cattagtttg ttggggcagt gcccggatag 360 catcaacgct gcgctgattt gccgtggcga gaaaatgtcg atcgccatta tggccggcgt 420 attagaagcg cgcggtcaca acgttactgt tatcgatccg gtcgaaaaac tgctggcagt 480 ggggcattac ctcgaatcta ccgtcgatat tgctgagtcc acccgccgta ttgcggcaag 540 ccgcattccg gctgatcaca tggtgctgat ggcaggtttc accgccggta atgaaaaagg 600 cgaactggtg gtgcttggac gcaacggttc cgactactct gctgcggtgc tggctgcctg 660 tttacgcgcc gattgttgcg agatttggac ggacgttgac ggggtctata cctgcgaccc 720 gcgtcaggtg cccgatgcga ggttgttgaa gtcgatgtcc taccaggaag cgatggagct 780 ttcctacttc ggcgctaaag ttcttcaccc ccgcaccatt acccccatcg cccagttcca 840 gatcccttgc ctgattaaaa ataccggaaa tcctcaagca ccaggtacgc tcattggtgc 900 cagccgtgat gaagacgaat taccggtcaa gggcatttcc aatctgaata acatggcaat 960 gttcagcgtt tctggtccgg ggatgaaagg gatggtcggc atggcggcgc gcgtctttgc 1020 agcgatgtca cgcgcccgta tttccgtggt gctgattacg caatcatctt ccgaatacag 1080 catcagtttc tgcgttccac aaagcgactg tgtgcgagct gaacgggcaa tgcaggaaga 1140 gttctacctg gaactgaaag aaggcttact ggagccgctg gcagtgacgg aacggctggc 1200 cattatctcg gtggtaggtg atggtatgcg caccttgcgt gggatctcgg cgaaattctt 1260 tgccgcactg gcccgcgcca atatcaacat tgtcgccatt gctcagggat cttctgaacg 1320 ctcaatctct gtcgtggtaa ataacgatga tgcgaccact ggcgtgcgcg ttactcatca 1380 gatgctgttc aataccgatc aggttatcga agtgtttgtg attggcgtcg gtggcgttgg 1440 cggtgcgctg ctggagcaac tgaagcgtca gcaaagctgg ctgaagaata aacatatcga 1500 cttacgtgtc tgcggtgttg ccaactcgaa ggctctgctc accaatgtac atggccttaa 1560 tctggaaaac tggcaggaag aactggcgca agccaaagag ccgtttaatc tcgggcgctt 1620 aattcgcctc gtgaaagaat atcatctgct gaacccggtc attgttgact gcacttccag 1680 ccaggcagtg gcggatcaat atgccgactt cctgcgcgaa ggtttccacg ttgtcacgcc 1740 gaacaaaaag gccaacacct cgtcgatgga ttactaccat cagttgcgtt atgcggcgga 1800 aaaatcgcgg cgtaaattcc tctatgacac caacgttggg gctggattac cggttattga 1860 gaacctgcaa aatctgctca atgcaggtga tgaattgatg aagttctccg gcattctttc 1920 tggttcgctt tcttatatct tcggcaagtt agacgaaggc atgagtttct ccgaggcgac 1980 cacgctggcg cgggaaatgg gttataccga accggacccg cgagatgatc tttctggtat 2040 ggatgtggcg cgtaaactat tgattctcgc tcgtgaaacg ggacgtgaac tggagctggc 2100 ggatattgaa attgaacctg tgctgcccgc agagtttaac gccgagggtg atgttgccgc 2160 ttttatggcg aatctgtcac aactcgacga tctctttgcc gcgcgcgtgg cgaaggcccg 2220 tgatgaagga aaagttttgc gctatgttgg caatattgat gaagatggcg tctgccgcgt 2280 gaagattgcc gaagtggatg gtaatgatcc gctgttcaaa gtgaaaaatg gcgaaaacgc 2340 cctggccttc tatagccact attatcagcc gctgccgttg gtactgcgcg gatatggtgc 2400 gggcaatgac gttacagctg ccggtgtctt tgctgatctg ctacgtaccc tctcatggaa 2460 gttaggagtc tgacatggtt aaagtttatg ccccggcttc cagtgccaat atgagcgtcg 2520 ggtttgatgt gctcggggcg gcggtgacac ctgttgatgg tgcattgctc ggagatgtag 2580 tcacggttga ggcggcagag acattcagtc tcaacaacct cggacgcttt gccgataagc 2640 tgccgtcaga accacgggaa aatatcgttt atcagtgctg ggagcgtttt tgccaggaac 2700 tgggtaagca aattccagtg gcgatgaccc tggaaaagaa tatgccgatc ggttcgggct 2760 taggctccag tgcctgttcg gtggtcgcgg cgctgatggc gatgaatgaa cactgcggca 2820 agccgcttaa tgacactcgt ttgctggctt tgatgggcga gctggaaggc cgtatctccg 2880 gcagcattca ttacgacaac gtggcaccgt gttttctcgg tggtatgcag ttgatgatcg 2940 aagaaaacga catcatcagc cagcaagtgc cagggtttga tgagtggctg tgggtgctgg 3000 cgtatccggg gattaaagtc tcgacggcag aagccagggc tattttaccg gcgcagtatc 3060 gccgccagga ttgcattgcg cacgggcgac atctggcagg cttcattcac gcctgctatt 3120 cccgtcagcc tgagcttgcc gcgaagctga tgaaagatgt tatcgctgaa ccctaccgtg 3180 aacggttact gccaggcttc cggcaggcgc ggcaggcggt cgcggaaatc ggcgcggtag 3240 cgagcggtat ctccggctcc ggcccgacct tgttcgctct gtgtgacaag ccggaaaccg 3300 cccagcgcgt tgccgactgg ttgggtaaga actacctgca aaatcaggaa ggttttgttc 3360 atatttgccg gctggatacg gcgggcgcac gagtactgga aaactaaatg aaactctaca 3420 atctgaaaga tcacaacgag caggtcagct ttgcgcaagc cgtaacccag gggttgggca 3480 aaaatcaggg gctgtttttt ccgcacgacc tgccggaatt cagcctgact gaaattgatg 3540 agatgctgaa gctggatttt gtcacccgca gtgcgaagat cctctcggcg tttattggtg 3600 atgaaatccc acaggaaatc ctggaagagc gcgtgcgcgc ggcgtttgcc ttcccggctc 3660 cggtcgccaa tgttgaaagc gatgtcggtt gtctggaatt gttccacggg ccaacgctgg 3720 catttaaaga tttcggcggt cgctttatgg cacaaatgct gacccatatt gcgggtgata 3780 agccagtgac cattctgacc gcgacctccg gtgataccgg agcggcagtg gctcatgctt 3840 tctacggttt accgaatgtg aaagtggtta tcctctatcc acgaggcaaa atcagtccac 3900 tgcaagaaaa actgttctgt acattgggcg gcaatatcga aactgttgcc atcgacggcg 3960 atttcgatgc ctgtcaggcg ctggtgaagc aggcgtttga tgatgaagaa ctgaaagtgg 4020 cgctagggtt aaactcggct aactcgatta acatcagccg tttgctggcg cagatttgct 4080 actactttga agctgttgcg cagctgccgc aggagacgcg caaccagctg gttgtctcgg 4140 tgccaagcgg aaacttcggc gatttgacgg cgggtctgct ggcgaagtca ctcggtctgc 4200 cggtgaaacg ttttattgct gcgaccaacg tgaacgatac cgtgccacgt ttcctgcacg 4260 acggtcagtg gtcacccaaa gcgactcagg cgacgttatc caacgcgatg gacgtgagtc 4320 agccgaacaa ctggccgcgt gtggaagagt tgttccgccg caaaatctgg caactgaaag 4380 agctgggtta tgcagccgtg gatgatgaaa ccacgcaaca gacaatgcgt gagttaaaag 4440 aactgggcta cacttcggag ccgcacgctg ccgtagctta tcgtgcgctg cgtgatcagt 4500 tgaatccagg cgaatatggc ttgttcctcg gcaccgcgca tccggcgaaa tttaaagaga 4560 gcgtggaagc gattctcggt gaaacgttgg atctgccaaa agagctggca gaacgtgctg 4620 atttaccctt gctttcacat aatctgcccg ccgattttgc tgcgttgcgt aaattgatga 4680 tgaatcatca gtaaaatcta ttcattatcg tcgac 4715

Claims (16)

A polyhydroxybutyrate (poly-3-hydroxybutyrate) transformed by introducing a threonine synthetic gene and a polyhydroxyalkanoate (hereinafter referred to as PHA) synthetic gene consisting of the nucleotide sequence represented by SEQ ID NO: 3 PHB) microorganism for production. The gene of claim 1, wherein the threonine synthesis gene is a gene encoding a homoserine dehydrogenase (hereinafter referred to as thrA), a gene encoding a homoserine kinase (hereinafter referred to as thrB), and a threonine synthase (hereinafter referred to as threonine synthase). thrC) is a microorganism for producing PHB. delete The method of claim 1, wherein the PHA synthetic gene is a gene encoding beta-ketothiolase (hereinafter referred to as phaA), a gene encoding acetoacetyl-CoA reductase (hereinafter referred to as phaB), and It contains a gene encoding a PHB-synthase (PHB-synthase; phaC hereinafter), a microorganism for producing PHB. The microorganism for PHB production according to claim 1, wherein the PHA synthetic gene is derived from Ralstonia eutropha . The microorganism for PHB production according to claim 1, wherein the transformation is performed by introducing a vector containing a threonine synthetic gene and a vector containing a PHA synthetic gene into a microorganism. The microorganism of claim 1, wherein the microorganism is Escherichia coli . A polyhydride comprising a recombinant microorganism producing step of transforming microorganisms by introducing a threonine synthetic gene and a polyhydroxy alkanoate (hereinafter referred to as PHA) synthetic gene consisting of the nucleotide sequence represented by SEQ ID NO: 3 Method for producing microorganisms for producing hydroxybutyrate (hereinafter referred to as PHB). The method of claim 8, wherein the threonine synthesis gene is a gene encoding a homoserine dehydrogenase (hereinafter referred to as thrA), a gene encoding a homoserine kinase (hereinafter referred to as thrB), and a threonine synthase (hereinafter referred to as threonine synthase). thrC), a method for producing a microorganism for producing PHB. delete The gene of claim 8, wherein the PHA synthetic gene is a gene encoding beta-ketothiolase (phaA), a gene encoding acetoacetyl-CoA reductase (phaB), and PHB-synthase (PHB-synthase; phaC) containing a gene for encoding, a method for producing a microorganism for producing PHB. The method of claim 8, wherein the PHA synthetic gene is derived from Ralstonia eutropha , a method for producing a microorganism for producing PHB. The method of claim 8, wherein the transformation is carried out by introducing a vector containing a threonine synthetic gene and a vector containing a PHA synthetic gene into a microorganism. The method according to claim 8, wherein the microorganism is Escherichia coli . A polyhydroxybutyrate (PHB) production method comprising the following steps:
A recombinant microorganism manufacturing step of transforming microorganisms by introducing a threonine synthetic gene and a polyhydroxy alkanoate (hereinafter referred to as PHA) synthetic gene consisting of the nucleotide sequence represented by SEQ ID NO: 3; And
Culture step of culturing the recombinant microorganism. The method of claim 15, wherein the culturing step is performed in a medium containing a carbon source.

Images