KR102117946B1 - Yeast recombinant vector system for recycling multiple-integrated auxotrophic selective markers - Google Patents

Abstract

The present invention relates to a multiple-insertion auxotrophic selection marker recycle yeast recombinant vector systems, specifically to saccharide in my process celebrity bicyclic Ke (Sacchoromyces cerevisiae) multiple insertions selected screening sikimeuro deactivate the marker gene simultaneously in the yeast host chromosomal The present invention relates to a vector set for recycling a label and a technique for producing a multi-insertion selection marker recycling strain using the same. Genetic scissors (CRISPR/Cas9)-gRNA integration vector and donor DNA are transformed together in a recombinant yeast strain to cause multiple deletions of multiple inserted insertion marker genes simultaneously, allowing existing genetic selection markers to be reused. As a technology, it can be applied to the production of a host for producing recombinant proteins and metabolites useful in the bio industry. In particular, the present invention can continuously insert multiple foreign genes into the host chromosome by recirculating multiple insertion selection labels targeting various auxotrophic selection labels, and GRAS-class recombination to mass-produce various recombinant proteins and useful metabolites. It enables the production of yeast strains.

Description

Yeast recombinant vector system for recycling multiple-integrated auxotrophic selective markers}

The present invention relates to a yeast recombination vector system for recycling multiple-insertion nutrient-required selection markers, and in detail, a selection label previously used by inactivating multiple-required nutrition-required selection marker genes from Saccharomyces cerevisiae It is to produce recombinant yeast that can additionally introduce foreign genes by utilizing it.

Yeast Saccharomyces Saccharomyces cerevisiae ) is a GRAS (Generally Recognized as Safe) microorganism that has been used for the production process of traditional fermented foods such as beer and bread for a long time, and is a variety of bio industries, including bioethanol production using biomass resources. It is used in the field. As a single-cell eukaryotic microorganism, Saccharomyces cerevisiae has a gene transcription and translation system that is very similar to that of higher organisms, while it is easy to culture at high concentrations, and also has a protein secretion organ, so it can produce activated proteins through post-translational modifications, compared to E. coli. It is used as a more useful host for mass production of pharmaceutical proteins derived from higher organisms. Recombinant proteins for medical use that have been mass-produced using yeast strains and have been successfully commercialized include hormones (insulin, growth hormone), vaccines (hepatitis vaccine, cervical cancer vaccine), albumin, and hirudin. On the other hand, since there are relatively few secondary metabolites produced by itself, yeast is also interested as a host capable of mass-producing useful metabolites that can be developed as health supplement products or medicines by introducing biosynthetic pathways of secondary metabolites from various organisms. I am receiving. To date, recombinant yeast strains have been developed to mass-produce secondary metabolites of polyphenolic compounds with antioxidant functions such as high functional metabolites, flavonoids, and anthocyanins of several isoprenoids such as artemisinin and ginsenosides. Became.

As described above, in order to develop an industrial recombinant yeast host, introduction and expression of foreign genes are required. In the fermentation process, a frequently used strategy for the production of recombinant yeast in which a foreign gene is stably and continuously overexpressed is a technique of inserting a foreign gene expression cassette into a host chromosome with multiple copies. Transformants in which multiple expressions of foreign gene expression cassettes have been multiplexed by homologous recombination are targeted for a repeat sequence such as a rib element DNA gene or a Ty element present in many copies on a host chromosome. Genetic selection markers used to select such yeast transformants typically include antibiotic resistance or nutritional demand. In the case of antibiotic resistance screening, there are various antibiotic resistance genes available, but their use is restricted to industrial strains by safety and ethics in accordance with biotechnological safety laws. On the other hand, nutritional demand selection labels such as histidine, trypsin, leucine, and uracil are relatively free in terms of safety and ethics, but there are limited available nutritional demand hosts. In particular, when introducing a complex secondary metabolite biosynthetic pathway derived from other living organisms, it is necessary to insert a large number of foreign genes, and thus industrial strain production for producing useful metabolites using a nutritional requirement selection label is further limited. Therefore, in order to produce an efficient industrial strain, there is a need to develop a technology capable of recycling the previously used nutritional requirement screening label.

US Open Patent US 2018/0010151 (published January 11, 2018)

An object of the present invention is to provide a yeast recombination vector system for recycling multiple-insertion nutrient-required selection labels.

Another object of the present invention is to provide a method for recycling a multiple insertion nutritional requirement selection label in a recombinant yeast in which multiple nutritional requirement selection labels are inserted in a yeast chromosome.

In order to achieve the above object, the present invention is an integrated gene scissor (CRISPR/Cas9) recombination vector comprising a guide RNA (gRNA) targeting a Cas9 gene and a nutritional demand selection marker gene; And it provides a yeast recombination vector system for recycling a multi-insertion nutrient-required selection label comprising a donor DNA for introducing a nutritional-requirement selection label gene mutation.

In addition, the present invention comprises the steps of (1) transforming a recombinant yeast having multiple nutrient chromosomal selection labels inserted into a chromosome into a yeast recombinant vector system for recycling the multiple nutrient nutrient selective labeling; And (2) selecting a transformant in which a mutation is introduced into a nutrient chromosome selection marker gene among chromosomes among the transformants. It provides a method to recycle the insert nutritional requirement selection label.

The present invention relates to a multiple-insertion auxotrophic selection marker recycle yeast recombinant vector systems, specifically to saccharide in my process celebrity bicyclic Ke (Sacchoromyces cerevisiae) multiple insertions selected screening sikimeuro deactivate the marker gene simultaneously in the yeast host chromosomal The present invention relates to a vector set for recycling a label and a technique for producing a multi-insertion selection marker recycling strain using the same. Genetic scissors (CRISPR/Cas9)-gRNA integration vector and donor DNA are transformed together in a recombinant yeast strain to cause multiple deletions of multiple inserted insertion marker genes simultaneously, allowing existing genetic selection markers to be reused. As a technology, it can be applied to the production of a host for producing recombinant proteins and metabolites useful in the bio industry. In particular, the present invention can continuously insert multiple foreign genes into the host chromosome by recirculating multiple insertion selection labels targeting various auxotrophic selection labels, and GRAS-class recombination to mass-produce various recombinant proteins and useful metabolites. It enables the production of yeast strains.

1 shows a schematic diagram of the production of an integrated gene scissor vector for recycling a nutritional demand selection label. This is the process of constructing an all-in-one CRISPR-Cas9 vector containing gRNAs targeting four types of nutritionally demanding genetic selection marker genes ( URA3 , TRP1 , LEU2, HIS3 ).
Figure 2 shows a restriction enzyme map of the integrated gene scissor vector for recycling of nutritional demand selection labels. A. URA3 gene cutting function YCpH-C9U3g, B. TRP1 gene with the cutting function with YCpH-C9T1, C. LEU2 gene YCpU-C9L2g capable of cutting, D. HIS3 Gene cutting function YCpU-C9H3g, E. having Sequencing results for DNA sequencing of gRNAs loaded on the vector for recycling nutritional demand selection labels.
Figure 3 shows the process of making a multi-insertion recombinant yeast strain using rDNA-NTS-based vectors. A. Construction of NNV expression cassette multi-introduced strain and confirmation of the number of inserted copies. Left panel: Schematic of the process of multi-insertion into the chromosome through transformation through transformation after excision of the vector for NNV multi-injection with a restriction enzyme, right panel: qRT-PCR analysis of the obtained transformant through qRT-PCR analysis Multiple copy number check results. B. Preparation of tHMG1 expression cassette multi-insertion strain and confirmation of the number of insert copies. Left panel: Schematic for the process of multiple insertion into the chromosome through transformation after excision of tHMG1 vector for multiple insertion with restriction enzymes, right panel: Confirmation of the number of multiple insertions through qRT-PCR analysis on the obtained transformants result.
4 shows a schematic diagram of a multi-insertion selection label recycling strategy using an integrated gene scissors (CRISPR/cas9) vector. A. Strategy I: Multiple insertion URA3 gene inactivation strategy based on donor DNA with protein synthesis termination codon, B. Strategy II: Multiple insertion URA3 gene pop-out strategy by homologous recombination based on repeat sequence (loxP sequence).
Figure 5 shows the results of the selection label recycling by introducing the URA3 mutation in the tHMG1 expression cassette multiple insertion recombinant yeast strain. A, B. uracil auxotrophy selection marker can then reunited by tHMG1 copy number analysis and Western blotting by qPCR tHMG1 Protein expression analysis, C. gene scissors vector pop-out process, D. CRISPR/cas9 vector removal and Western blot results for tHMG1 protein expression.
Figure 6 shows the results of recycling the uracil auxotrophic selection label by URA3 excision in the tHMG1 expression cassette multi-insertion recombinant yeast strain. A, B, uracil auxotrophic screening label recovery , tHMG1 copy number analysis by qPCR and tHMG1 protein expression analysis by Western blotting.
Figure 7 shows the results of the selection label recycling and transgenic vector pop-out by URA3 mutation in the NNV expression cassette multi-insertion recombinant yeast strain. A. Measurement of NNV- CP copy number by qRT-PCR after URA3 inactivation (left panel) and NNV-CP by Western blotting protein Expression analysis result (right panel), B. NNV-CP after gene shear vector pop-out Protein expression analysis results.
Figure 8 shows the results of TRP1 selection label recycling and Cas9 vector popout in the DHCR7 / DHCR24 expression cassette multi-insertion recombinant yeast strain. A. Recycling of trypsin nutritional demand selection markers through growth analysis in selective medium and identification of the scissors vector popout, B, C. Comparison of HPLC-based cholesterol precursor profiles before and after the Cas9 vector pop-out, and DHCR24 via qRT-PCR Copy number confirmation result.
9 is t HMG1 expression cassette multiple insertion shows a selection marker recycle result by the mutagenic HIS3 in the recombinant yeast strains A. uracil auxotrophy selection marker can be reunited after the qRT-PCR t HMG1 copy number analysis by, B. Western block THMG1 by lot Protein expression analysis results.
Figure 10 shows the results of recycling LEU2 selection label in Noda virus capsid protein (NNV-CP) expression cassette multi-insertion recombinant yeast strain. A. Copy number analysis by qPCR after recovery of leucine auxotrophic selection label, and B. NNV-CP by Western blotting Protein expression analysis.

Accordingly, the present inventors have prepared a vector for recycling a multi-insertion selection label based on a gene scissor (CRISPR/Cas9) capable of simultaneously removing or inactivating multiple insertion-neutralization selection marker genes simultaneously with a foreign gene expression cassette. Thus, the technology for producing a recombinant yeast strain capable of recycling the selection label was developed and the present invention was completed.

The present invention is an integrated gene scissor (CRISPR/Cas9) recombination vector comprising a guide RNA (gRNA) targeting a Cas9 gene and a nutritional demand selection marker gene; And it provides a yeast recombination vector system for recycling a multi-insertion nutrient-required selection label comprising a donor DNA for introducing a nutritional-requirement selection label gene mutation.

Preferably, the nutritional demand selection marker gene is URA3 Gene, TRP1 gene, LEU2 gene or HIS3 gene, but is not limited thereto.

Preferably, the guide RNA targeting the nutritional requirement selection marker gene is URA3 represented by SEQ ID NO: 1 Gene target gRNA, TRP1 represented by SEQ ID NO: 2 It may be a gene target gRNA, a LEU2 gene target gRNA represented by SEQ ID NO: 3, or a HIS3 gene target gRNA represented by SEQ ID NO: 4, but is not limited thereto.

Preferably, the integrated gene scissors (CRISPR/Cas9) recombination vector may be a cleavage map of FIGS. 2(A), 2(B), 2(C), or 2(D), but is not limited thereto. no.

Preferably, the donor DNA for introducing a nutritional selection screening marker gene mutation may include a protein synthesis stop codon, but is not limited thereto.

Preferably, the donor DNA for introducing the nutritional requirement selection marker gene mutation is URA3 represented by SEQ ID NO: 5 Donor DNA for transgenic introduction, TRP1 as shown in SEQ ID NO: 6 Donor DNA for gene mutation introduction, LEU2 represented by SEQ ID NO: 7 Donor DNA for gene mutation introduction, or HIS3 represented by SEQ ID NO: 8 The gene may be a donor DNA for introduction, but is not limited thereto.

Preferably, the yeast may be a bicyclic Ke Mai process serenity (Sacchoromyces cerevisiae) a saccharide, and the like.

In addition, the present invention comprises the steps of (1) transforming a recombinant yeast having multiple nutrient chromosomal selection labels into a chromosome into a yeast recombinant vector system for recycling the multiple nutrient nutrient selective labeling; And (2) among the transformants, selecting a transformant in which a mutation is introduced into a nutritional demand selection marker gene in the chromosome. It provides a method for recycling the insert nutritional requirement selection label.

Preferably, the yeast may be a bicyclic Ke Mai process serenity (Sacchoromyces cerevisiae) a saccharide, and the like.

Preferably, the recombinant yeast in which multiple nutritional demand selection markers are inserted into the chromosome is Sacchoromyces. cerevisiae ) A ribosomal DNA nontranscribed spacer (rDNA NTS) may be a recombinant yeast in which multiple nutritional demand selection markers are inserted, but is not limited thereto.

Preferably, in the chromosome of step (2), a transformant in which a mutation is introduced into a nutritional demand selection marker gene is introduced into the nutritional demand selection marker gene, a protein synthesis stop codon is introduced, and the nutritional requirement The constituent selection marker gene may be an inactivated transformant, but is not limited thereto.

On the other hand, the recombinant yeast strains produced using the rDNA-NTS-based multiple insertion vector method described in Korean Registered Patent No. 10-1655696 registered by the present inventors include yeast recombination vector for recycling the multiple insertion nutritional requirement screening label of the present invention. The system is particularly useful.

Representative nutritional genetic selection marker genes mentioned in the present invention are HIS3 , LEU2 , TRP1 , and URA3 related to amino acid and base biosynthetic pathways. HIS3 is related to the histidine biosynthetic pathway, which is an amino acid in yeast, so it cannot grow in the minimal medium when there is a genetic mutation, and growth is possible if histidine is added to the minimal medium. LEU2 is a biosynthesis-related gene of leucine, an amino acid in yeast, and does not grow in the minimal medium when mutated, but may grow if leucine is added to the minimal medium. TRP1 is a gene related to the biosynthesis of trypsin, an essential amino acid of yeast, and does not grow in the minimum medium when mutated. If trypsin is added to the minimum medium, growth may occur. URA3 is a gene related to uracil biosynthesis, which is a substance related to RNA monomers in yeast. Strains in which the URA3 gene is deficient by mutation cannot grow in the minimal medium, and growth may occur if uracil is added to the minimal medium.

The bacteria type 2 gene scissors (CRISPR/Cas9) system used in the present invention has emerged as a genomic engineering tool that can be applied to bacteria and eukaryotes. Cas9 has an endonuclease function that cleaves the target DNA determined by gRNA. Double-strand break (DSB) by Cas9 occurs in a specific sequence, the forward sequence of a protospacer adjacent motif (PAM) designated by gRNA. When transformed with a guide RNA and a Cas9 expression vector together with a donor DNA having a homologous sequence, it is possible to perform gene editing with high efficiency by a homologous repair (HR) mechanism.

The method of delivering the recombinant vector used in the present invention so that it can be expressed in yeast can be carried out by a commonly used transformation method. Typically, it is performed by using lithium acetate/DMSO method, electroporation, or the like. Preferably a lithium acetate/DMSO method is performed.

Hereinafter, the present invention will be described in more detail through examples. These examples are only intended to illustrate the present invention more specifically, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

< Example  1> CRISPR-Cas9-based multi-insertion nutritional requirement screening vector production for recycling

In the present invention, since the CRISPR/Cas9 expression cassette and the gRNA expression cassette are mounted in one vector, various nutritional demand selection marker genes ( URA3, HIS3 , TRP1 , LEU2 ) can be selectively inactivated through only one transformation. A set of integrated gene scissor vectors was constructed.

One. URA3 For recirculation YCpH - C9U3g  making

In the vector developed in the present invention, the UCC1 gene target gRNA expression cassette using the SNR52 promoter and SUP4 terminator and the Cas9 expression cassette using the GAP promoter and TPI terminator are simultaneously loaded, and the Coex 413-Cas9-UCC1 gRNA with HIS3 selection label (Table 2) was produced as a matrix. To replace the gRNA of the Coex 413-Cas9-UCC1 gRNA with the gRNA for the URA3 target, the two pairs of primers listed in Table 3 with the Coex 413-Cas9-UCC1 gRNA as the abacus gRNA-URA3 setA fw and rv, and gRNA -URA3 setB fw and rv was amplified PCR1 and PCR2 and URA3 gene segments for a target gRNA connected to some portion SNR52 promoter and terminator SUP4 / GPM1 terminator through a series of PCR fusion (fusion PCR) by using (Fig. 1, top). YCpH-C9U3g was produced by cloning the secured gRNA_URA3 fragment into a T-blunt vector to construct pTB-gRNA_URA3, and then cutting with restriction enzymes of XbaI and SalI to connect with Coba 413-Cas9-UCC1 gRNA treated with XbaI and SalI ( Figure 1, bottom, Figure 2A). Sequencing was performed using primers URA gRNA A Rv and TRP1 gRNA B Fw shown in Table 3 to confirm the gRNA sequence of YCpH-C9U3g (FIG. 2E ). The gRNA for the URA3 gene target consists of 20 base sequences complementary to the URA3 gene containing the PAM sequence (NGG) recognized by Cas9 (FIG. 2E).

2. TRP1 For recirculation YCpH - C9T1g making

As described above, in order to produce a vector YCpH-C9T1g of the gene shears target TRP1 Coex 413-Cas9-UCC1 the gRNA the main plate of the primer, two pairs of which are shown in Table 3 TRP1 gRNA A Rv and TRP1 gRNA A Fv, and TRP1 gRNA B Rv and TRP1 gRNA B PCR1 and PCR2 with Fw, and through the subsequent fusion PCR was amplified TPR1 gRNA target gene fragments attached to the part for SNR52 promoter portion and SUP4 terminator / GPM1 terminator (Figure 1, top). YCpH-C9T1g was produced by cloning the secured gRNA_TGRP1 fragment into a T-blunt vector to construct pTB-gRNA_TRP1, then cutting with restriction enzymes of XbaI and SalI, and connecting with Coba 413-Cas9-UCC1 gRNA treated with XbaI and SalI (YCpH-C9T1g). Figure 1, bottom, Figure 2A). The sequencing using primers TRP1 gRNA A Rv and TRP1 gRNA B Fw shown in Table 3 confirmed the gRNA base sequence of YCpH-C9T1g (FIG. 2E).

3. HIS3 For recirculation YCpU - C9H3g  making

Construction of the integrated gene scissor vector YCpU-C9H3g targeting the nutritional demand selection marker gene HIS3 was carried out in two steps. As described above in the first step, the two pairs of primers HIS3 gRNA A Rv and HIS3 gRNA A Fw, and HIS3 gRNA B Rv and HIS3 gRNA B Fw as described above in Table 3, with a Coex 413-Cas9-UCC1 gRNA as the abacus, used in PCR1 and PCR2, and through the fusion PCR are connected to some portion SNR52 promoter and terminator SUP4 / GPM1 terminator HIS3 The target gRNA gene segment was amplified (FIG. 1, top). YCpH-H3gR was prepared by cloning the secured gRNA_HIS3 fragment into a T-blunt vector to construct pTB-gRNA_HIS3, then cutting with restriction enzymes of XbaI and SalI, and connecting with Coba 413-Cas9-UCC1 gRNA treated with XbaI and SalI.

In the second step, the produced using YCpH-H3gR vector it is described in the main plate are shown in Table 3. Primer YCpU-HgR and fw1 YCpU-HgR rv1 which was amplified gRNA HIS3 gene expression cassette for a target. Meanwhile, the URA3 gene fragment was amplified by using the primers YCpU-HgR fw2 and YCpU-HgR rv2 shown in Table 3 using YCpU-GAL10p carrying the gene of ScURA 3 as an abacus. YCpNAT-Cas9 (Edgene, https://www.addgene.org/ ) was cut with NcoI and MluI to remove the NAT gene fragment, and infusion with the PCR-amplified URA3 gene fragment and HIS3 target gRNA expression cassette fragment Using the kit (In fusion kit, Takara), three DNA fragments were simultaneously combined in a single reaction, and then transformed into E. coli to produce YCpU-C9H3g linked in vivo. The sequencing using primers YCpU-HgR fw1 and YCpU-HgR rv1 shown in Table 3 confirmed the nucleotide sequence of the gRNA of YCpU-C9H3g (FIG. 2E).

4. LEU2 For recirculation YCpU - C9L2g making

The primer of two pairs described the YCpU-C9H3g as described above, to produce vector YCpU-C9L2g of the gene shears target LEU2 on the main plate Table 3 LEU2 gRNA A Rv and LEU2 gRNA A Fw, and LEU2 gRNA B Rv and The LRNA2 gRNA B Fw was used to amplify the LRNA2 target gRNA gene fragments linked to a part of the SNR52 promoter and a part of the SUP4 terminator/ GPM1 terminator through fusion PCR of PCR1 and PCR2, followed by PCR1 and PCR2 (FIG. 1). YCpU-C9L2g was produced by connecting the fusion PCR fragment with MunC and YCpU-C9H3g from which the HIS3 guide RNA fragment was removed, using an infusion kit (Takara) (FIG. 1, FIG. 2A). The nucleotide sequence of YCpU-C9L2g was confirmed by sequencing using primers LEU2 gRNA A Rv and LEU2 gRNA B Fw shown in Table 3 (FIG. 2E).

< Example  2> Expression cassette multi-insertion recombinant yeast strain production

One. NNV -CP expression cassette multiple insertion recombinant strain production

To produce a recombinant yeast strain in which an NNV-CP expression cassette expressing Noda virus capsid protein using a URA3 selection marker (lox-URA3-loxP) with a 16 bp short promoter having both loxP sequences at both ends is inserted First, the loxP-16URA3-loxP gene fragment was obtained by performing primary PCR using URA3(SmaI) 1-fw and URA3(SmaI) 1-rv primers using pT-NTS-16URA3 (Table 2) as a template. As a template, a second PCR using URA3 (SmaI) 2-fw and URA3 (SmaI) 2-rv primers was performed to obtain loxP-16URA3-loxP gene segments. The obtained loxP-16URA3-loxP gene fragment and pT-NTS-16URA3 were each treated with XbaI/NotI and linked to prepare pT-NTS-16URA3 (loxP). The NNV-CP expression cassette obtained by cutting the previously produced GAL10 promoter-based NNV-CP expression vector YEG-ScNNV (Table 2) by BamHI/XbaI is linked to pT-NTS-16URA3 (loxP) treated with BamHI/XbaI pT- NTS-16URA3 (loxP)-ScNNV vector was constructed. The produced pT-NTS-16URA3 (loxP)-ScNNV was cut with SphI/MlnI to recover the NNV-CP expression cassette NTS-16U(loxP)-tHMG1 linked to the lox-URA3-loxP selection marker, and then CEN.PK2- After transformation into the 1C-2 strain, transformants in which the expression cassette was multiplexed into the NTS site of the host rRNA in the minimal medium (SC-URA) medium lacking uracil were selected (FIG. 3A, left). GDNA and URA3 obtained by the above-described method on the obtained Ura+ transformants QRT-PCR analysis using primers for RT-PCR was performed to secure C/NTS-16U (loxP)-NNV transformant (#10) multiplexed up to 11 copies (FIG. 3A, right).

2. tHMG1  Production of expression cassette multiple insertion recombinant strains

Squalene mass-produced recombinant yeast The prepared to produce a strain pT-NTS-16URA3 (loxP) BamHI to -ScNNV vector / SalI treatment to remove the NNV -CP gene segments associated with the GAL10 promoter, and YCpU-tHMG1 vector (Table 2 ) Was treated with BamHI/SalI to obtain a tHMG1 fragment linked to the GAP promoter to connect to prepare a pT-NTS-16URA3 (loxP)-tHMG1 vector. The prepared pT-NTS-tHMG1 (16U_loxP) vector was cut with SpeI and MluI to recover the tHMG1 expression cassette NTS-16U(loxP)-tHMG1 linked to the lox-URA3-loxP selection label, and recovered Saccharomyces cerevisiae CEN After transforming the strain .PK2-1C-erg7 (Table 1), transformants in which expression cassettes grown in SC-URA medium were multiplexed into the NTS site of the host rRNA were selected (FIG. 3B, left).

In order to measure the number of copies of the inserted tHMG1 expression cassette, genomic DNA was extracted from Ura+ transformants and qRT-PCR (quantitative Real-Time Polymerase Chain Reaction) was performed. To extract genomic DNA from yeast cells, STES (20mM Tris-HCl pH7.5, 500mM NaCl, 10mM EDTA, 1% SDS) buffer solution and glass bead are centrifuged and added in the same amount as the yeast cells recovered. After crushing with TOMY for 5 minutes, 200 ul of TE buffer (10mM Tris-HCl pH8.0, 1mM EDTA) and Phenol/chloroform/isoamyalcohol=24:1:1 were added to each of them and crushed once more. lysate) was collected, and then genome DNA was recovered by ethanol precipitation, followed by treatment with 50 μg/ml RNase. Of a DNA sample for qRT-PCR analysis for the copy number measured 12.5 μl Maxima SYBR Green qPCR Master Mix (Fermentas, USA) and qRT containing the primers of both directions of the ACT1, URA3, HMG1 of 10 pmol (Table 3) -PCR mixture was made. qRT-PCR results were analyzed by CFX96 real-time PCR detection system (Bio-Rad, USA). Multiple inserted URA3 on chromosome Genes and HMG1 The number of copies of the gene is 1 copy in the yeast strain ACT1 It was corrected based on the gene and a standard curve was obtained using plasmid or genome DNA. As a result, a transformant e/NTS-16U (loxP)-tHMG1 in which multiple tHMG1 expression cassettes were introduced up to 8 copies could be selected (FIG. 3B, right).

< Example  3> tHMG1  Expression cassettes from multiple insertion recombinant yeast strains URA3 Screening mark Recirculation

Strategy 1. Donor DNA Recycling of screening markers based on gene inactivation

As a first strategy to recycle the selection marker using gene scissors (CRISPR/Cas9), a repair mechanism of double DNA strand break using donor DNA was utilized (FIG. 4A). The YCpH-C9U3g vector was transformed by a lithium acetate/DMSO method along with a donor DNA having a variant URA3 gene sequence in a recombinant yeast strain into which the tHMG1 expression cassette prepared in Example 2 was multiplexed. The donor DNA for introducing URA3 mutation used in the present invention was prepared by polymerizing URA3 donor-U sense and URA3 donor-d antisense oligonucleotide shown in Table 3, and then expanding and amplifying them by PCR. There are two protein synthesis stop codons in the donor DNA for introduction of URA3 mutation composed of 93 bases.

YCpH-C9U3g After selecting the transformants surviving in the histidine deficient medium (SC-HIS) using the selection marker HIS3 of the vector, mutations introduced into the URA3 gene by Cas9 protein and gRNA are used to deactivate the inactivated strains (SC-URA) ) That were unable to grow were negatively selected using a replica plate. For 8 selected Ura ^- strains, the copy number of URA3 and tHMG1 was analyzed by qRT-PCR (FIG. 5A), and the expression level of tHMG1 was analyzed by Western blot (FIG. 5B). As a result, about 50% of the selected Ura ^- strains lost URA3 function by Cas9 , but the tHMG1 expression cassette was intact and the number of copies remained unchanged. This means that strategy I, which introduces donor DNA, is multi-inserted URA3. It suggests that it is a very efficient method for producing a recombinant strain capable of recycling the selection label.

The obtained Ura ^- transformants were cultured in 3 ml YPD medium for 24 hours, 48 hours, and 72 hours in order to secure the final transformants from which the CAS9 expression vector capable of generating unintended gene correction was removed. While pop-out of YCpH-C9U3g vector was induced. The strains recovered for each hour. After adjusting the absorbance to 1 for OD ₆₀₀ , 10-fold dilution was continuously performed and plated on a YPD plate medium. Colonies grown in plated YPD medium were selected for histidine deficient medium (SC-HIS) and cloned plate screening in YPD plate medium and selected strains that did not grow in histidine deficient medium but grown in YPD plate medium (FIG. 5C). The amount of expression of the FLAG-tagged tHMG1 protein in the selected strain and the strain before the Cas9 vector removal after replication plate medium was compared and analyzed by Western blot. The yeast cell lysate is TNE (50 mM Tris [pH 7.6], 25 mM NH4Ac, 1 mM PMSF) and protease inhibitor cocktail (Sigma, USA) and 1 mM PMSF to yeast cells recovered through centrifugation. mM EDTA) solution and glass beads were added, and cells were destroyed by bead-beating using TOMY to prepare. The supernatant obtained by centrifuging the cell lysate was separated through SDS-PAGE and analyzed by immunoblotting using FLAG antibody (Roche, USA) and AP-substrate kit (Bio-Rad, USA) It was confirmed that there was no change in expression level compared to before the vector removal (Fig. 5D). This means that the number of copies of the tHMG1 expression cassette multi-inserted during the Cas9 vector removal process remains unaffected.

Strategy 2. Sangdong Gene  Recombination URA3 Recycling screening based on gene removal

The second strategy for recycling the selection label using gene scissors (CRISPR/Cas9) is to remove the selection label gene using a repeat sequence-based homologous recombination mechanism attached to the selection label in the absence of donor DNA (FIG. 4B). . THMG1 expression cassette produced in the present invention include the loxP sequence is URA3 gene pop in and using the URA3 gene as a selective marker attached at both ends by the homologous genetic recombination between the loxP sequences can may be out.

For the recombinant yeast strain into which the tHMG1 expression cassette prepared in Example 2 was multiplexed, only the YCpH-C9U3g vector was transformed by the lithium acetate/DMSO method. After screening the transformants surviving in the histidine-deficient medium (SC-HIS), the mutation was introduced into the URA3 gene by Cas9 protein and gRNA to screen the cloned plate that the inactivated strains did not grow in the uracil-deficient synthetic medium (SC-UraХ2). It was selected by negative. For 8 selected Ura-strains, the copy number of URA3 and tHMG1 was analyzed by qRT-PCR, and the expression level of tHMG1 protein was analyzed by Western blot. As a result, in the case of strategy 2, tHMG1 as well as the multi-inserted selection marker It was confirmed that the expression cassette was also removed at the same time (FIGS. 6A and 6B ). These results suggest that the pop-out strategy using gene scissors (CRISPR/Cas9) in a condition without donor DNA causes multiple simultaneous pop-outs of the expression gene cassette and the selection gene, and thus is not suitable as a selection label recycling strategy. Therefore, as compared with strategy 2, it was confirmed that strategy 1, which introduces donor DNA, is more efficient in recycling the selection label of multiple-inserted cassettes, and the present inventors target a variety of expression cassettes and selection labels based on strategy 1 recycling technology based on strategy 1 To expand.

< Example  4> NNV -CP  In the expression cassette multiple insertion recombinant strain URA3 Recirculation

In order to further apply the first strategy using the donor DNA of Example 3, an attempt was made to recycle the selection marker using gene scissors (CRISPR/Cas9) in recombinant yeast with multiple NNV- CP expression cassettes. Prepared in Example 2 Recombinant yeast strains with multiple insertions of the NNV - CP expression cassette were transformed together with a YCpH-C9U3g vector and a donor DNA with a variant URA3 gene sequence containing two protein synthesis termination codons by lithium acetate/DMSO method. After screening transformants surviving in histidine-deficient medium (SC-HIS), mutations were introduced into the URA3 gene by Cas9 protein and gRNA to screen the inactivated strains from growing in the uracil-deficient synthetic medium (SC-URA). It was selected by negative.

For 8 selected Ura ^- strains, the copy number of URA3 and NNV- CP was analyzed by qRT-PCR (FIG. 7A), and the expression level of NNV- CP was analyzed by Western blot (FIG. 7B). As a result, it was confirmed that many of the Ura ^- transformants conserved the NNV- CP expression cassette in multiple copies. These results demonstrate that the strategy of introducing donor DNA is efficient for the recovery of selection markers even if the type of gene in the expression cassette is different. In order to ensure the final transformant from which the Cas9 expression vector has been removed, NNV-CP in the selected strain and the strain prior to the removal of the Cas9 vector after cloning plate Protein expression was compared and analyzed by Western blot. As a result, it was confirmed that there was no change in expression level before and after the Cas9 vector pop-out (FIG. 7B ). This suggests that the Cas9-based integrated yeast scissor and mutagenesis donor DNA developed in the present invention have high utility as a multi-insertion selection label recycling tool regardless of the type of gene included in the expression cassette.

< Example  5> DHCR7 / CHCR24  In the expression cassette multiple insertion recombinant strain TRP1 Jaesoon ring

In order to verify the possibility of recycling the multi-inserted TRP1 into a recombinant strain chromosome using the gene scissor (CRISPR/Cas9) integrated vector set developed in the present invention, the present inventors produced the cholesterol-producing recombinant yeast strain _NTS produced through the previous invention. D24D7/#19 (Korea Patent Application 10-2018-0087372) was used as an experimental strain. In the recombinant yeast strain _NTS D24D7/#19, the ergosterol biosynthesis genes ERG5 and ERG6 genes are deleted, and the cholesterol biosynthesis genes DHCR7 and DHCR24 expression cassettes having TRP1 selection markers as chromosomal rDNA-NTS sites are multiplexed into five copies. _{For the} recovery of TRP1 markers for the _NTS D24D7/#19 strain, TRP1 with the vector YCpH-C9T1g prepared in Example 2 and two protein synthesis termination codons The donor DNA of the base sequence was simultaneously transformed by lithium acetate/DMSO method. The donor DNA used in the present invention was prepared by polymerizing the oligonucleotides of TRP1 donor-U sense and TRP1 donor-d antisense shown in Table 3 and then expanding and amplifying them by PCR (Table 3).

Among his ⁺ transformants surviving the minimal medium (SC-HIS) medium lacking histidine, strains that did not survive the minimal medium (SC-TRP) medium lacking trypsin were negatively screened. In order to induce the pop-out of Cas9 vector YCpH-C9T1g for the His ⁺ , Trp ^- transformants obtained, after 2 days incubation in YPD liquid medium, replication plate screening was performed to simultaneously in SC-TRP and SC-HIS medium. can not survive His ^-, Trp ^- transformants were selected transformants (Fig. 8A). Secured His ^-, Trp ^- transformants were performed in the HPLC-based sterol profiles analyzed for 5 days a sample from the culture medium to make SC looks the same pattern as the parent strain produced cholesterol _NTS D24D7 / 19 #. HPLC-UV/VIS analysis was suspended in a mixed solution of 1 mL KOH/EtOH (3:2) (KOH final concentration 4.5 M) in a 0.05 g/wet weight pellet, incubated at 85°C for 1 hour, and 0.5 mL heptane (sigma) was added. Then, the mixture was mixed using a beadbeator (6,000 rpm, 15 seconds, repeated 3 times). The mixed sample was collected by centrifugation (12,000 rpm, 10 min, 25°C) and the supernatant 0.5 ml heptane layer was recovered (12,000 rpm, 10 min, 25°C), dried, and 200 mL of acetone was added to the dissolved sample. For HPLC-UV/VIS analysis. For HPLC-UV/VIS analysis, Cosmosil C18-PAQ (4.6 mm*250 mm) was used as the column, flow rate was 1 mL/min, analysis solvent was 90% Acetonitrile, and analysis time was 50 min. Peaks corresponding to cholesterol and precursors were analyzed at a wavelength of 203 nm using a UV/Vis detector. As a result of analysis of four His ^-, Trp ^- transformants were confirmed to show almost the same profile as the parental strain sterol _NTS D24D7 / # 19 (FIG. 8B). In addition, in order to analyze whether the number of copies of the DHCR24 / DHCR7 expression cassette is conserved multiple times, the genomic DNA was recovered from a sample cultured on SC medium for 1 day, and then the copy number analysis was performed using the DHCR24 primer (Table 3), and the same copy number It was confirmed that the strain showing (Fig. 8C). These results show that , like multi-inserted URA3 , multi-inserted TRP1 can be efficiently recycled by utilizing the integrated gene scissor vector and donor DNA produced in the present invention.

< Example  6> tHMG1  Expression cassettes from multiple insertion recombinant yeast strains HIS3 Screening mark Recirculation

In order to verify the possibility of recycling the multi-inserted HIS3 into the recombinant strain chromosome using the gene scissor integration vector set developed in the present invention, the present inventors have produced squalene mass production recombinant yeast strain C/NTS-50H produced through the previous invention. -tHMG1 (Moon et. al 2016) was used as an experimental strain. Recombinant yeast strain C/NTS-50H-tHMG1 is a T HMG1 gene expression cassette encoding a truncated HMG-Co A reductase enzyme composed of 503 amino acids with the N-terminal portion removed, and HIS3 is selected as a rDNA-NTS site on the host chromosome. Multiple copies are inserted with three copies. For the recovery of HIS3 markers for the C/NTS-50H-tHMG1 strain, HIS3 with the vector YCpU-C9H3g prepared in Example 2 and two protein synthesis termination codons The donor DNA of the base sequence was simultaneously transformed by lithium acetate/DMSO method. The donor DNA used in the present invention was prepared by polymerizing the oligonucleotides of HIS3 donor-U sense and HIS3 donor-d antisense shown in Table 3, and then expanding and amplifying them by PCR (Table 3).

Among the Ura ⁺ transformants surviving in the minimal medium (SC-URA) medium lacking uracil, strains that did not survive in the minimal medium (SC-HIS) medium lacking histidine were negatively screened. The obtained Ura ⁺ , His ^- transformants were selected and tHMG1 As a result of analyzing the copy number using the HMG1 primer (Table 3) after recovering genome DNA from a sample cultured for 1 day in SC-URA medium to analyze whether the number of copies of the expression cassette is conserved in multiple numbers, the parent strain C/NTS Similar to -50H-tHMG1, strains showing 2-3 copies were identified (FIG. 9A). In addition, Western blotting analysis was performed on samples cultured for 1 day in SC-URA medium in order to confirm that the parent strain C/NTS-50H-tHMG1 exhibits the same monovalve expression pattern, resulting in multiple 2 Ura ⁺ , His ^- traits. The transformants showed almost the same amount of tHMG1 protein expression as the parent strain (Fig. 9B). These results show that multiple inserted HIS3 can be efficiently recycled by utilizing the integrated gene scissor vector and donor DNA produced in the present invention.

< Example  7> NNV -CP  In the expression cassette multiple insertion recombinant strain LEU2 Recirculation

In order to verify the possibility of recycling multiple inserted LEU2 into a recombinant strain chromosome using the gene scissor (CRISPR/Cas9) integrated vector set developed in the present invention, the present inventors produced squalene mass production recombinant yeast strain produced through the previous invention. Y/NTS-16U-NNV (Moon et. al 2016) was used as an experimental strain. Recombinant yeast strain Y/NTS-16U-NNV has NNV-CP encoding the Noda virus shock protein and LEU2 as the rDNA-NTS site on the chromosome The NNV-CP expression cassette with the selection label was inserted multiplexed in 15 copies. For the recovery of the LEU2 marker for the Y/NTS-16U-NNV strain, the donor DNA of the LEU2 base sequence having the vector YCpU-C9L2g prepared in Example 2 and two protein synthesis termination codons was simultaneously lithium acetate/DMSO method It was transformed. The donor DNA used in the present invention was prepared by polymerizing the oligonucleotides of LEU2 donor-U sense and LEU2 donor-d antisense shown in Table 3, and then expanding and amplifying them by PCR (Table 3).

Among the Ura ⁺ transformants surviving in the minimal medium (SC-URA) medium lacking uracil, strains that did not survive in the medium (SC-LEU) lacking leucine were negatively screened. Western blotting analysis was performed on samples cultured for 1 day in SC-URA medium to confirm that the obtained Ura ⁺ , Leu ^- transformants showed the same monovalve expression pattern as the parent strain Y/NTS-16U-NNV. As a result, the analyzed 1 Ura ⁺ , Leu ^- transformants NNV-CP protein almost identical to the parent strain It showed the expression level (Fig. 10B). In addition, in order to analyze whether the number of copies of the NNV-CP expression cassette was conserved multiple times, the genomic DNA was recovered from a sample cultured for 1 day in SC-URA medium, and the number of copies was analyzed using the NNV cp primer (Table 3). It was confirmed that the strain showing the copy number (Fig. 10A). These results show that multiple inserted LEU2 can be efficiently recycled by utilizing the integrated gene scissor vector and donor DNA produced in the present invention.

Strain Genotype Source/Reference CEN.PK2-1C MATa ura3-52 trp1-289 leu2-3,112 his3-Δ1 MAL2-8C SUC2 (Moon et al., 2016) CEN.PK2-1C-erg7 CEN.PK2-1C carrying pMET3- ERG7 (Jung et al., 2014) e/NTS-16U(loxP)-tHMG1 CEN.PK2-1C-erg7/NTS-16U(loxP)-tHMG1 The present invention C/NTS-16U(loxP)-NNV CEN.PK2-1C/NTS-16U(loxP)-NNV The present invention _NTS D24D7/#19 CEN.PK2-1C/erg5Δ::KlLEU2-DHCR24 /erg6Δ::KlURA3-DHCR7/NTS-DHCT24DHCR7-TRP1 Korean Patent Application 10-2018-0087372 C/NTS-50H-tHMG1 CEN.PK2-1C/ NTS-50H-tHMG1 (Moon et al., 2016) Y/NTS-16U-NNV Y2806/NTS-16U(loxP)-NNV (Moon et al., 2016)

Plasmid Relevant characteristics Source pT-NTS-16URA3 pGEM-T easy-5' NTS2-p(16)URA3-3' NTS2 (Moon et al., 2016) YEG-ScNNV YEGa-MCS:P _GAL10 -NNV (Kim et al., 2014) pT-NTS-NNV (16U) pGEM-T easy-5' NTS2- P _GAL10 -NNV-p(16)URA3-3' NTS2 (Moon et al., 2016) YCpU-tHMG1 pRE316 derivative containing the tHMG1 under the control of TEF1 promoter and the GAL7 terminator Korean Patent Application 10-2017-0182421 pT-loxP-16URA3 pGEM-T easy-loxP-16URA3-loxP The present invention pT-NTS-NNV(16U_loxP) pGEM-T easy-5' NTS2- P _GAL10 -NNV-loxP-p(16)URA3-loxP-3' NTS2 The present invention pT-NTS-tHMG1 (16U_loxP) pGEM-T easy-5' NTS2- P _GAL10 -tHMG1-loxP-p(16)URA3-loxP-3' NTS2 The present invention Coex 413-Cas9-UCC1 gRNA Yeast CEN- HIS3 vector containing Cas9 and UCC1 targeting gRNA SNU, Hahn J.-S. (unpublished) YCpH-C9-U3g Yeast CEN- HIS3 vector containing Cas9 and URA3 targeting gRNA The present invention YCpH-C9-T1g Yeast CEN- HIS3 vector containing Cas9 and TRP 1 targeting gRNA The present invention YCpU-C9-L2g Yeast CEN- URA3 vector containing Cas9 and LEU2 targeting gRNA The present invention YCpU-C9-H3g Yeast CEN- URA3 vector containing Cas9 and HIS3 targeting gRNA The present invention

Primers Gene Sequence (5'-> 3') Construction of the loxP - 16 URA3 - loxP  cassette URA3(SamI) 1 fw loxP-16 URA3 GTATAATGTATGCTATACGAAGTTATTAGG CCCGGG GGGTAATAACTGATATAATT URA3(SamI) 1 rv URA3 - loxP CATTATACGAAGTTATATTAAGGGTT CCCGGG GAAACGAAGATAAATCATGTCG URA3(SamI) 2 fw loxP CCC TCTAGA AACCCTTAATATAACTTCGTATAATGTATGCTATACGAAG URA3(SamI) 2 rv loxP ATAAGAAT GCGGCCGC CCTAATAACTTCGTATAGCATACATTATACGAAGTTATATTAAGG RT- PCR  analysis ACT1 RT-fw ACT1 ATTGCCGAAAGAATGCAAAAGG ACT1 RT-rv ACT1 GAACCACCAATCCAGACGGAGT URA3 RT-fw URA3 AGAATTGTCATGCAAGGGCTCC URA3 RT-rv URA3 TCCACCCATGTCTCTTTGAGCA HMG1 RT-fw HMG1 TTCCGTATCCATGCCATCC HMG1 RT-rv HMG1 GTAGCATGCGGGCCTCTTA NNV RT-fw NNV CCAGACGGAGCCGTTTTTCA NNV RT-rv NNV CTGCGTTGCCTGCGAACTTT Construction of Cas9  all in one vector Total gRNA A fw TRP1 gRNA CTAG TCTAGA TTTTGTAGTGCCCTCT Total gRNA B rv TRP1 gRNA ACGC GTCGAC GAATAATGTAATCGTG URA3gRNA A rv URA3 gRNA CCAAGTACAATTTTTTACTCGATCATTTATCTTTCACTGCGG URA3gRNA B fw U RA3 gRNA GAGTAAAAAATTGTACTTGGGTTTTAGAGCTAGAAATAGCAA TRP1gRNA A rv TRP1 gRNA ATAGAAAGAGAACAATTGACGATCATTTATCTTTCACTGCGG TRP1gRNA B fw TRP1 1 gRNA GTCAATTGTTCTCTTTCTATGTTTTAGAGCTAGAAATAGCAA LEU2gRNA A fw LEU2 gRNA TTTCCTTGCAATAACCGGGTCAATTGTCTTTGAAAAGATAATGTATGATTATG LEU2gRNA A rv LEU2 gRNA TAATGGCTTCGGCTGTGATTGATCATTTATCTTTCACTGCGG LEU2gRNA B fw LEU2 gRNA AATCACAGCCGAAGCCATTAGTTTTAGAGCTAGAAATAGCAA LEU2gRNA B rv LEU2 gRNA AATTATATCAGTTATTACCCCAATTGAGACATAAAAAACAAAAAAAGCACCAC HIS3gRNA A rv HIS3 gRNA CCCTTTAAAGAGATCGCAATGATCATTTATCTTTCACTGCGG HIS3gRNA B fw HIS3 gRNA ATTGCGATCTCTTTAAAGGGGTTTTAGAGCTAGAAATAGCAA URA3 marker fw URA3 selection marker GCTTTTTTTGTTTTTTATGTCT CAATTG GGGTAATAACTGATATAATTAA URA3 marker rv URA3 selection marker TCACATCCGAACATAAACAA CCATGG TTTCAATTCAATTCATCATTT Donor DNA URA3 donor-U sense URA3 TCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTA TAATAA GCCAAGTACAATTTTTTACTC URA3 donor-d antisense URA3 ACCAATGTCAGCAAATTTTCTGTCTTCGAAGAGTAAAAAATTGTACTTGGC TTATTA TAATGC TRP1 donor-U sense TRP1 TCCGATGCTGACTTGCTGGGTATTATATGTGTG TAATAA AATAGAAAGAGAACAATTGACCCG TRP1 donor-d antisense TRP1 TACAAGACTTGAAATTTTCCTTGCAATAACCGGGTCAATTGTTCTCTTTCTATT TTATTA CAC HIS3 donor-U sense HIS3 GTAAAGCGTATTACAAATGAAACCAAGATTCAGATTGCGATCTCTTTAAAGGG HIS3 donor-d antisense HIS3 TTCTGGGAAGATCGAGTGCTCTATCGCTAGGGG TTATTA ACCCTTTAAAGAGATC LEU2 donor-U sense HIS3 CCAGGTGACCACGTTGGTCAAGAAATCACAGCCGAAGCCATTAAG TAATAA CTTAAAG LEU2 donor-d antisense HIS3 ATCGAACTTGACATTGGAACGAACATCAGAAATAGCTTTAAG TTATTA CTTAATG

1. Restriction enzyme recognition sites and termination codons are underlined.

2. loxP sequences are indicated in bold letters.

The specific parts of the present invention have been described in detail above, and it is obvious that for those skilled in the art, these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Yeast recombinant vector system for recycling multiple-integrated          auxotrophic selective markers <130> ADP-2018-0308 <160> 8 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> URA3 guide RNA <400> 1 gagtaaaaaa ttgtacttgg 20 <210> 2 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> TRP1 guide RNA <400> 2 gtcaattgtt ctctttctat 20 <210> 3 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> LEU2 guide RNA <400> 3 aatcacagcc gaagccatta 20 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> HIS3 guide RNA <400> 4 attgcgatct ctttaaaggg 20 <210> 5 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> URA3 donor DNA <400> 5 tccatggagg gcacagttaa gccgctaaag gcattataat aagccaagta caatttttta 60 ctcttcgaag acagaaaatt tgctgacatt ggt 93 <210> 6 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> TRP1 donor DNA <400> 6 tccgatgctg acttgctggg tattatatgt gtgtaataaa atagaaagag aacaattgac 60 ccggttattg caaggaaaat ttcaagtctt gta 93 <210> 7 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> LEU2 donor DNA <400> 7 ccaggtgacc acgttggtca agaaatcaca gccgaagcca ttaagtaata acttaaagct 60 atttctgatg ttcgttccaa tgtcaagttc gat 93 <210> 8 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> HIS3 donor DNA <400> 8 gtaaagcgta ttacaaatga aaccaagatt cagattgcga tctctttaaa gggttaataa 60 cccctagcga tagagcactc gatcttccca gaa 93

Claims (11)

An integrated gene scissor (CRISPR/Cas9) recombination vector comprising a guide RNA (gRNA) targeting a Cas9 gene and a nutritional requirement selection marker gene; And a donor DNA for introducing a nutritional selection screening marker gene mutation, wherein the donor DNA for introducing a nutritional selection screening gene mutation is a donor for introducing a URA3 gene mutation represented by SEQ ID NO:5. for DNA, the introduction TRP1 mutation shown in SEQ ID NO: 6 donor (donor) DNA, SEQ ID NO: HIS3 donor for the gene mutation introduction represented by the LEU2 gene mutagenic donor (donor) DNA or SEQ ID NO: 8 for indicated by 7 (donor ) DNA recombination yeast recombination vector system for recirculation of nutritionally selective screening markers characterized by being DNA. The method of claim 1, wherein the nutritional demand selection marker gene is URA3 Yeast recombination vector system for recycling of multiple insertion nutritional demand selection markers, characterized in that the gene, TRP1 gene, LEU2 gene or HIS3 gene. The method of claim 1, wherein the guide RNA targeting the auxotrophic selection marker gene is represented by SEQ ID NO: 1 URA3 Gene targeting gRNA, TRP1 gene targeting gRNA, SEQ ID NO: 3 multiple insertion auxotrophic selection for labeling recycled, characterized in that the HIS3 gene target gRNA represented by the LEU2 gene target gRNA or SEQ ID NO: 4, represented by the represented by SEQ ID NO: 2 Yeast recombination vector system. According to claim 1, wherein the integrated gene scissors (CRISPR / Cas9) recombinant vector is characterized in that it has a cleavage map of Figure 2 (A), Figure 2 (B), Figure 2 (C) or Figure 2 (D). Yeast recombination vector system for recycling multiple insert nutritional requirement screening labels. delete delete According to any one of claims 1 to 4, wherein the yeast is Saccharomyces cerevisiae ( Sacchoromyces cerevisiae ) Yeast recombination vector system for multiple insertion nutritional demand selection label recycling. (1) transforming the recombinant yeast having multiple nutrient chromosomal selection labels inserted into the chromosome into a yeast recombinant vector system for recycling multiple nutrient selective nutrient labeling according to any one of claims 1 to 4; And
(2) Among the transformants, multiple inserts from recombinant yeast in which a plurality of nutritional demand selection markers are inserted into a yeast chromosome, comprising the step of selecting a transformant in which a mutation is introduced into a nutritional demand selection marker gene in the chromosome. How to recycle nutritional screening labels. The method according to claim 8, wherein the yeast is Saccharomyces cerevisiae ( Sacchoromyces cerevisiae ), characterized in that the nutrient chromosome selection label in the yeast chromosome is inserted multiple times in the recombinant yeast multiple insertion nutritional requirement selection label recycling How to. The method of claim 8, wherein the recombinant yeast auxotrophic selection marker in the chromosome are inserted into the multiple saccharide as MY access celebrity bicyclic Ke (Sacchoromyces cerevisiae ) In a recombinant yeast in which a multiplicity of nutritional agglutination selection markers is inserted in a yeast chromosome, characterized in that it is a recombinant yeast in which a multiplicity of nutritional agglutination selection markers is inserted into a ribosomal DNA nontranscribed spacer (rDNA NTS). A method of recycling multiple insert nutritional requirement selection labels. The method of claim 8, wherein the transformant is introduced into a mutation in the nutrient chromosome selection marker gene in step (2), a protein synthesis termination codon is introduced into the nutrient selection marker gene, A method for recycling a multiple insertion nutritional requirement selection label in a recombinant yeast in which multiple nutritional requirement selection labels are inserted into a yeast chromosome, characterized in that the nutritional requirement selection label gene is an inactivated transformant.

Images