KR102115854B1 - Composition for preventing or treating of inflammatory skin diseases containing algae chromoprotein - Google Patents

Abstract

The present invention relates to a composition comprising algal pigment protein, and more particularly, to a composition for preventing, treating or improving inflammatory skin diseases comprising algal pigment protein. C-phycocyanin derived from spirulina cultured with lava seawater according to the present invention exhibits de-keratinization, improvement in skin color and suppression of expression of inflammatory factors in animal models of psoriasis, and thus can be used for prevention or treatment of inflammatory skin diseases As such, it can be used in various fields in the field of cell regeneration and prevention, treatment and improvement of skin inflammation.

Description

Composition for preventing or treating inflammatory skin diseases containing algae chromoprotein}

The present invention relates to a composition comprising algal pigment protein, and more particularly, to a composition for preventing, treating or improving inflammatory skin diseases comprising algal pigment protein.

Psoriasis is a chronic inflammatory skin disease in which red papules or plate-shaped rashes, which are covered with silver-white scales, have distinct borders and vary in size, occur repeatedly on the skin of the whole body. It is characterized by inflammation and appears at a frequency of 1-2% of the population. According to the shape and the affected skin part, it is divided into plate shape, droplet shape, pustules, erythema hyperplasia, linear, seborrheic, and eczema, and plate shape accounts for about 90%. If you divide it by skin part, it can be divided into the general form that appears anywhere in the section or limb, and the form that appears in special parts such as the hands, soles, liver, genitals, mucous membranes, and nails.

The cause of psoriasis is not yet fully understood, but in the past, psoriasis was recognized as a simple skin epidermal disease. Recently, various tissues and factors of the skin such as biochemical and genetic factors in the body and dermal vascular and epidermal motility disorders are complex and organic. It is a trend to see as a kind of autoimmune disease that interacts and develops.

The two-way treatment of psoriasis can be broadly divided into three categories: topical skin-applied treatment, phototherapy with ultraviolet light, and systemic treatment with medication. However, conventional systemic psoriasis treatments have been problematic in terms of stability. This is because despite the need for long-term treatment due to the nature of the chronic disease, most of the existing therapies cause cumulative toxicity in the internal organs when used for a long period of time, thereby limiting the period of use. Among them, steroid preparations may cause anthropogenic Cushing's syndrome in long-term use. As a clinical feature of the iatrogenic Cushing's syndrome, moon face, trunk hypertrophy, hypertension, lethargy, fatigue, amenorrhea, hirsutism, abdominal filigree, edema, diabetes, osteoporosis, etc. may appear.

Accordingly, the present inventors extract algae pigment protein from spirulina cultured with lava seawater to replace the therapeutic agent for psoriasis with side effects, and exfoliate, improve skin color and suppress the expression of inflammatory factors in the psoriasis animal model. By confirming, the present invention was completed.

Accordingly, an object of the present invention is to provide a composition for the prevention, treatment or improvement of inflammatory skin diseases comprising algae chromoprotein as an active ingredient.

In order to achieve the above object, the present invention provides a pharmaceutical composition for the prevention or treatment of inflammatory skin diseases comprising algal pigment protein as an active ingredient.

In addition, the present invention provides a cosmetic composition for preventing or improving inflammatory skin diseases comprising algal pigment protein as an active ingredient.

In addition, the present invention provides a food composition for preventing or improving inflammatory skin diseases comprising algal pigment protein as an active ingredient.

C-phycocyanin derived from spirulina cultured with lava seawater according to the present invention exhibits de-keratinization, improvement in skin color and suppression of expression of inflammatory factors in animal models of psoriasis, and thus can be used for prevention or treatment of inflammatory skin diseases As such, it can be used in various fields in the field of cell regeneration and prevention, treatment and improvement of skin inflammation.

1 is a view showing the results of purification of C-phycocyanin derived from Spirulina cultured in a medium containing lava seawater.
2 is a view showing the results of confirming the effect of C-phycocyanin treatment of psoriasis on the back skin of the animal model of psoriasis.
3 is a graph showing the results of confirming the effect of C-phycocyanin treatment for psoriasis on the back skin of an animal model of psoriasis.
4 is a view showing the results of confirming the effect of C-phycocyanin treatment of psoriasis on the ear skin of the animal model of psoriasis.
Figure 5 is a view showing the results of confirming the treatment effect of psoriasis C- phycocyanin on the skin of the back and ears of psoriasis-induced nude mice.
FIG. 6 is a diagram showing the results of evaluating the effect of C-phycocyanin treatment for psoriasis treatment on the back and ear skin of a nude mouse induced psoriasis based on self-evaluation criteria.
7 is a view showing the results of observing the skin tissue of the back and ears of the nude mouse induced psoriasis.
8 is a view showing the results of confirming the expression of inflammatory factors in the ear tissue of psoriasis-induced nude mouse.
9 is a view showing the results of confirming the expression of inflammatory factors in the tissues of the nude mouse psoriasis induced.
10 is a view showing the results of confirming the expression of inflammatory factors in the spleen tissue of psoriasis-induced nude mice.

Hereinafter, the present invention will be described in detail.

According to an aspect of the present invention, the present invention provides a composition for the prevention, treatment or improvement of inflammatory skin diseases comprising algal pigment protein as an active ingredient. The composition includes a pharmaceutical composition, a cosmetic composition and a food composition.

In the present invention, “algae” refers to protozoa living in water and having an independent nutritional life with anabolic pigments, and the algae include red algae, green algae and brown algae.

According to a preferred embodiment of the invention, it is preferred that the algae of the invention are spirulina belonging to the blue-green algae.

In the present invention, "algal pigment protein" refers to a pigment protein contained in algae, which acts to absorb solar energy during the photosynthesis process of algae and transfer it to chlorophyll.

According to a preferred embodiment of the present invention, the algal pigment protein of the present invention is preferably C-phycocyanin.

The phycocyanin is a substance represented by the following structural formula and refers to a blue pigment protein that functions to absorb light energy from the photosynthetic system of algae and transmit it to chlorophyll. The molecular weight of phycocyanin is about 45,000, and it forms a high association of phycobilisomes, which are regularly arranged in the chlorophyll thylakoid membrane.

In the present invention, "inflammatory skin disease" refers to a disease in which symptoms such as tissue degeneration, circulation disorders and exudation, and tissue proliferation occur in the skin. Specifically, examples of inflammatory skin diseases include atopic dermatitis, allergic dermatitis, contact dermatitis, acne, seborrheic dermatitis, sweat rash, hives and psoriasis, preferably psoriasis, but the present invention is not limited thereto.

In the present invention, "psoriasis" is an autoimmune disease that affects the skin, more specifically, it is covered with silver-white scales, and red borders or rashes forming a plate with various borders and distinct sizes vary. It refers to chronic inflammatory skin disease that occurs repeatedly on the skin.

In the present invention, "prevention" means all actions to prevent the disease by removing or prematurely detecting the etiology by the composition of the present invention.

In the present invention, "treatment" refers to all actions in which symptoms of a disease are improved by the composition of the present invention.

In the present invention, "improvement" means any action in which the function of a biological metabolism, cell or organ is advantageously changed by the composition of the present invention.

The composition of the present invention may further contain one or more known active ingredients having the effect of preventing or treating inflammatory skin diseases together with the algal pigment protein.

According to a preferred embodiment of the present invention, the composition of the present invention preferably contains algal pigment protein at a concentration of 0.1 to 1000 μg / ml, more preferably algal pigment protein at a concentration of 50 to 500 μg / ml, , Most preferably 250 μg / ml.

In one embodiment of the present invention, the present invention provides a pharmaceutical composition for the prevention or treatment of inflammatory skin diseases comprising algal pigment protein as an active ingredient.

The pharmaceutical composition of the present invention may include one or more pharmaceutically acceptable carriers for administration. Pharmaceutically acceptable carriers can be used by mixing one or more of these components: saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and antioxidants, buffers if necessary. , Other conventional additives such as bacteriostatic agents can be added. In addition, diluents, dispersants, surfactants, binders, and lubricants can be added in addition to formulated into injectable formulations such as aqueous solutions, suspensions, emulsions, pills, capsules, granules or tablets. Furthermore, it can be formulated according to each disease or component in an appropriate manner in the art.

The pharmaceutical composition may further include additional components. Examples of such additional ingredients are lactose, talc, starch, magnesium stearate, crystalline cellulose, lactose, gelatin, mannitol, peroxanoic acid, isomerized sugar, polyvinyl alcohol, boric acid and sodium carbonate.

The pharmaceutical composition may be administered orally or parenterally, it is preferable to administer parenterally for rapid effect, it is more preferable to be directly treated in the area where psoriasis symptoms appear. For parenteral administration, intravenous infusion, intramuscular infusion, intra-articular infusion, intra-synovial infusion, intramedullary infusion, intrarahepatic infusion, intralesional infusion, or It can be administered by intracranial injection. Suitable dosages of the pharmaceutical compositions can be variously prescribed by factors such as formulation method, mode of administration, patient's age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion, and response sensitivity. have.

In another embodiment of the present invention, the present invention provides a cosmetic composition for preventing or improving inflammatory skin diseases comprising algal pigment protein as an active ingredient.

The cosmetic composition of the present invention may contain conventional cosmetic base components in addition to the algal pigment protein, and may include, for example, stabilizers, solubilizing agents, conventional inclusion agents such as pigments and fragrances, and carriers. In addition, the cosmetic can be prepared in any formulation conventionally prepared in the art, and is not particularly limited, for example, lotion, essence, lotion, paste, surfactant-containing cleansing, cream, pack, gel, ointment, It can have a formulation of powder, patch or spray (spray).

When the formulation of the cosmetic composition is a paste, cream or gel, it is composed of animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc and zinc oxide as carrier components. One or more selected from the group may be used, and when the formulation is cosmetic lotion or essence, a solvent, solubilizer or emulsifier is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, One or more selected from the group consisting of benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oil, glycerol aliphatic ester, polyethylene glycol, and fatty acid ester of sorbitan can be used.

In addition, when the formulation of the cosmetic composition is a powder or a strain, one or more selected from the group consisting of lactose, talc, silica, aluminum hydroxide, calcium silicate, and polyamide powder may be used as a carrier component, particularly spray In the case of phosphorus, it may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane or dimethyl ether. In addition, when the formulation of the cosmetic composition is a surfactant-containing cleansing, as the carrier component, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, One or more selected from the group consisting of fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, and ethoxylated glycerol fatty acid ester may be used.

In another embodiment of the present invention, the present invention provides a food composition for preventing or improving inflammatory skin disease comprising algal pigment protein as an active ingredient.

The food composition of the present invention may be a health functional food, food additive or dietary supplement. When the composition of the present invention is a food additive, algal pigment protein may be added as it is, or may be suitably used according to a conventional method such as being used in combination with other food or food ingredients.

As a specific example, when preparing food or beverage, the algal pigment protein of the present invention is added in an amount of 15% by weight or less, preferably 10% by weight or less, of the raw material. However, for health and hygiene purposes or for long-term intake for health control purposes, it may be added in an amount below the above range, and since there is no problem in terms of safety, the active ingredient may also be used in an amount above the above range. have. The type of food is not particularly limited, but examples of foods to which the algal pigment protein of the present invention can be added are meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, ice creams Dairy products, including various soups, beverages, teas, drinks, alcoholic beverages, vitamin complexes, etc., and include all healthy foods in the ordinary sense.

When the food composition of the present invention is prepared as a beverage, it may include various components such as various flavoring agents or natural carbohydrates, such as a conventional beverage. The natural carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose; Natural sweeteners such as dextrin and cyclodextrin; Synthetic sweeteners such as saccharin and aspartame can be used. The natural carbohydrate is contained in 0.01 to 10% by weight, preferably 0.01 to 0.1% by weight relative to the total weight of the food composition of the present invention.

The food composition of the present invention is a variety of nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohol, carbonic acid Carbonation agents used in beverages, and the like, and may include, but are not limited to, natural fruit juice, fruit juice beverage, and flesh for preparing vegetable beverages. These ingredients can be used independently or in combination. The additive ratio is not particularly limited, but is preferably included in the range of 0.01 to 0.1% by weight relative to the total weight of the food composition of the present invention.

In the case of long-term intake for health and hygiene purposes or for health control purposes, the food composition of the present invention can be taken for a long time because there is no problem in terms of safety.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example  1. Using lava seawater Spirulina  culture

Lava seawater medium was prepared for culturing Spirulina. More specifically, in order to remove impurities in the lava seawater, sediment precipitated while being stored at 4 ° C. for one week was removed, and then purified through a 0.2 μm membrane filter to obtain high purity lava seawater. Table 1 shows the components of the high purity lava seawater.

The composition of lava seawater Concentration (mg / L) salt 10796 magnesium 1319 calcium 406 potassium 416 bromine 62.0 strontium 7.574 iron 0.002 zinc 0.009 manganese 0.001 vanadium 0.023 Selenium 0.009 germanium <0.001 Silicon-silicate 9.110 Copper 0.005 molybdenum 0.008 Sulfate ion 2402 Chlorine ion 21806 Boron 3.982 Fluoride 0.958

Lava seawater medium was prepared by adding the high purity lava seawater to SOT medium, which is an alkaline inorganic medium.

Using the prepared lava seawater medium, spirulina was cultured at a temperature of 35 ° C, an initial pH of 9.5, and an illuminance of 4500 to 7500 lux.

Example  2. From Spirulina  Selection of active ingredients for treatment of inflammatory skin diseases

In Example 1, a spirulina extract cultured with lava seawater was prepared, and the components of the spirulina extract were purified through Fast Protein Liquid Chromatography (FPLC).

Specifically, spirulina cultured in Example 1 was dried to prepare spirulina powder. 5 g of the prepared spirulina powder was immersed in secondary distilled water, and the elution solution containing 1M Tris (pH8), 0.5M EDTA and 20% sucrose (w / v) was distilled so that the final concentration was 10% (v / v). Mixed in. The prepared mixture was reacted at 4 ° C. for 1 hour so that the components reacted sufficiently. After the reaction was completed, the mixture was centrifuged at 3000 g for 10 minutes, and then the supernatant was taken. The supernatant was recovered by precipitating 30 to 50% of the saturated concentration of ammonium sulfate through an ammonium sulfate precipitation method. To remove the salt of the precipitate, spirulina extract was dialyzed for 3 days using a dialysis membrane (MEMBRA-CEL® dialysis tubing, MWCO 12000-14000, SERVA). Distilled water was changed once a day for 3 days for dialysis. After the desalting process, the spirulina extract was lyophilized to complete the spirulina extract.

FPLC was performed to purify the Spirulina extract, and impurities inside the anion exchange column were washed and equilibrated with a piperazine buffer (pH6). Spirulina extract was injected into anion exchange column (HiTrap Q FF, GE healthcare) equilibrated to pH6, and each component was eluted.

According to the results of the component analysis, spirulina extract cultured with lava seawater includes C-phycocyanin and Chlorophyll, which are pigment proteins, and Gamma Linolenic acid, vitamins, and minerals, which are unsaturated fatty acids. It was confirmed that it was included. Among the components contained in the spirulina extract cultured with lava seawater, C-phycocyanin, a pigment protein, was selected as an active ingredient for the treatment of inflammatory skin diseases.

C-phycocyanin selected as an active ingredient for the treatment of inflammatory skin diseases was purified through FPLC, and the results of the purification were confirmed by measuring absorbance. As a control, commercially available C-phycocyanin was used. The purification results of C-phycocyanin are shown in FIG. 1.

As shown in FIG. 1, it was confirmed that the A ₆₁₅ / A ₂₈₀ value of C-phycocyanin purified using an ion exchange column was similar to that of commercially available C-phycocyanin.

Example  3. psoriasis  In animal models Spirulina  Of derived pigment protein psoriasis  Confirmation of treatment effect

Of the pigment protein derived from spirulina isolated in Example 2 in the psoriasis animal model Psoriasis treatment effect was confirmed. The psoriasis animal model is a mouse (BALB / c-nu) treated with imiquimod cream on the back and ear skin, and is a mouse in which rash and keratin are induced on the back and ear.

3-1. From the back skin psoriasis  Confirmation of treatment effect

The effect of treating psoriasis was confirmed by treating C-phycocyanin derived from Spirulina extract cultured with lava seawater on the back skin of the psoriasis animal model. As a negative control group, the untreated group did not apply any treatment to the back of the mouse, and the imiquimod treated group applied 5 mg of imiquimod cream to the back of the mouse to induce psoriasis. In addition, 5 mg of Novason Cream was applied to the back of the mouse in the psoriasis animal model as a positive control, and 20 μl of C-phycocyanin derived from Spirulina incubated with normal seawater having a concentration of 250 μg / ml was applied to the back of the other sex control. The spirulina-derived C-phycocyanin cultured with normal seawater is extracted from commercial spirulina tablets (Nature's family, Australia). The results of confirming the treatment effect of psoriasis after treating each test substance on the back skin of the psoriasis animal model are shown in FIG. 2, and the results are graphed and shown in FIG. 3.

As shown in FIG. 2, it can be confirmed that keratin and skin rashes, which are psoriasis symptoms, were induced in the back of the treatment group with imiquimod cream. On the other hand, C-phycocyanin-derived group derived from spirulina extract cultured with lava seawater confirmed that denitrification and skin color were improved, and these results indicate that psoriasis symptoms were alleviated.

As shown in FIG. 3, it can be seen that the treatment effect of psoriasis of the C-phycocyanin-derived group derived from spirulina extract cultured with lava seawater is the best, which is derived from the spirulina extract cultured with Novason-treated group and normal seawater. The treatment effect of psoriasis was better than the phycocyanin treatment group.

3-2 in the ear skin psoriasis  Confirmation of treatment effect

The effect of treating psoriasis was confirmed by treating C-phycocyanin derived from spirulina extract cultured with lava seawater in the ear skin of a psoriasis animal model. As a negative control group, the untreated group did not perform any treatment on the mouse ear area, and the imiquimod treatment group applied 5 mg of imiquimod cream to the ear area to induce psoriasis. In addition, 5 mg of Novason Cream was applied to the ear skin of the psoriasis animal model in the positive control group, and 20 μl of C-phycocyanin derived from Spirulina incubated with normal seawater having a concentration of 250 μg / ml was applied to the other positive control group. The results of confirming the effect of C-phycocyanin treatment on psoriasis in the ear skin of the animal model of psoriasis are shown in FIG.

As shown in FIG. 4, it was found that the symptoms were somewhat alleviated in all of the test groups, and in particular, the group treated with C-phycocyanin derived from spirulina extract cultured with lava seawater had excellent denitrification and skin color improvement effects.

Example  4. Psoriasis  In induced nude mice Spirulina  Of derived pigment protein psoriasis  Confirmation of treatment effect

The effect of C-phycocyanin, a pigment protein derived from spirulina cultured in lava seawater in a psoriasis-induced nude mouse, was confirmed. The psoriasis-induced nude mouse is a treatment of imiquimod cream on the skin of the back and ears of the nude mouse (balb-c / nu), and is a psoriasis animal model in which rash and keratin are induced on the back and ear.

4-1. On the back and ear skin psoriasis  Confirmation of treatment effect

C-phycocyanin was treated on the back skin of psoriasis-induced nude mice. Specifically, as the negative control group, the untreated group did not perform any treatment on the back of the mouse, and the imiquimod treatment group treated imiquimod cream on the back to induce psoriasis. In addition, the positive control group was treated with 20 μl of concentrations of 50, 100, 250, and 500 μg / ml of C-phycocyanin derived from spirulina extract cultured in lava seawater in a nude mouse in which psoriasis was induced. The results of confirming the effect of C-phycocyanin treatment for psoriasis on the skin of the back and ears of a psoriasis-induced nude mouse are shown in FIG.

As shown in FIG. 5, it can be confirmed that keratin and skin rash, which are psoriasis symptoms, were induced at the back of the treatment group with imiquimod cream. On the other hand, it was confirmed that the treatment group treated with C-phycocyanin derived from Spirulina extract cultured with lava seawater had improved denitrification and skin color.

4-2. On the back and ear skin psoriasis  Evaluation of treatment effect

The psoriasis treatment effect was evaluated based on the self-evaluation criteria for the results of confirming the psoriasis treatment effect of C-phycocyanin derived from spirulina extract cultured in lava seawater from the back and ear skin of the psoriasis-induced nude mouse. The self-assessment criteria are erythema, scale formation and thickness after visual inspection, based on Sham (1 point), psoriasis degree is low (1-3 points), normal (4-6 points), severe (6-9) Point) (KAUR, A., et al. Nanoemulsion loaded gel for topical co-delivery of clobitasol propionate and calcipotriol in psoriasis.Nanomedicine: nanotechnology, biology, and medicine, 2017, 13.4: 1473-1482.). The evaluation results of the treatment effect of psoriasis are shown in FIG. 6.

As shown in Fig. 6, when psocyanine was treated with a concentration of 250 μg / ml in psoriasis-induced nude mice, the effect was most favorable.

4-3. Observation of tissues in the back and ear skin and measurement of dermal thickness

The dermal thickness of the nude mouse in which psoriasis of Example 4-1 was induced was measured. Specifically, after the experiment of Example 4-1 was over, the back and ear skin tissues of the control and experimental groups were taken. Paraffin blocks were prepared by putting skin tissue in paraffin. After the lamella was prepared with the prepared paraffin block, the tissue contained in the lamella was placed on a slide glass. For more accurate observation, stained tissue was observed by performing H & E staining (hematoxylin & eosin staining) of the tissue located on the slide glass. The results of observing the H & E stained tissue are shown in FIG. 7.

As shown in FIG. 7, the experimental group (c) treated only with imiquimod cream increased in dermal thickness and the skin surface was irregular due to rash. In the C-phycocyanin treatment group (d to g), the thickness of the dermis was reduced compared to the imiquimod cream treatment group (c), and it was confirmed that the cells were regenerated and the skin surface was smooth. In the positive control group, Novason treated group (b), the thickness of the dermis was reduced, but the skin surface was irregular.

Using the Image J program, the dermal thickness of H & E stained tissue was measured 5 times, and the average value was calculated. Table 2 shows the results of measuring the thickness of the dermis.

As shown in Table 2, it can be seen that psoriasis symptoms were alleviated when treated with C-phycocyanin. In particular, the C-phycocyanin 250 μg / ml treatment group showed similar levels of normal nude mouse levels and dermal thickness. have.

The above results indicate that C-phycocyanin derived from Spirulina extract cultured with lava seawater has superior denitrification and cell regeneration effects than Novason, a commercially available psoriasis treatment.

4-3. Psoriasis  In the nude mouse's ear, back, and spleen tissues Inflammatory factors  Expression confirmation

The expression of inflammatory factors in the ears, back, and spleen tissues of psoriasis-induced psoriasis of Example 4-1 was confirmed. Specifically, after the experiment of Example 4-1 was completed, the back, ear, and spleen tissues of the control group and the experimental group were taken. MRNA expression of TNF-α, COX-2, IL-6 and IL-1b, which are inflammatory factors, was confirmed in the tissue obtained through PCR. Primers used for PCR are shown in Table 3 below.

Gene Forward (5 ’→ 3’) Reverse (3 '→ 5') β-actin CCGCGAGTACAACCTTCTTG CATGCCGGAGCCGTTGTC TNF-α GCTTGGTGGTTTGCTACGAC ATGGGCTCCCTCTCATCAGT IL-6 CCTATTGAAAATCTGCTCTG TTGGGGTAGGAAGGACTATT IL-1β AAATGCCTCGTGCTGTCTGA AGGCCACAGGGATTTTGTCG Cox-2 TTCTTGCTGTTCCCACCCATG GACCACGGACCAGACTACTAC

The PCR was performed according to the method described below. Samples were prepared by mixing Ex Taq buffer, primer, dNTP, Taq High-fidelity DNA polymerase and template DNA in a tube. At this time, the template DNA is DNA isolated from the back and ear and spleen tissues of the control group and the experimental group after the experiment of Example 4-1 was completed. In the PCR amplification step, the sample was heated at 94 ° C for 5 minutes, and then reacted at 94 ° C for 30 seconds, at 60 ° C for 30 seconds, and at 72 ° C for 30 seconds, and this was repeated for 25 to 30 cycles. After 25 to 30 cycles, it was held at 72 ° C. for about 7 minutes to undergo a final extension step.

The results of confirming the expression of inflammatory factors in the ear tissues of psoriasis-induced nude mice are shown in FIG. 8, and the results of confirming the expression of inflammatory factors in the back and spleen tissues are shown in FIGS. 9 and 10, respectively.

As shown in FIG. 8, it was confirmed that the expression of inflammatory factors TNF-α and COX-2 was significantly decreased in the ear tissues of the nude mouse treated with C-phycocyanin derived from Spirulina extract cultured with lava seawater. Did.

In addition, as shown in Figs. 9 and 10, the back and spleen tissues of psoriasis-induced nude mice treated with C-phycocyanin derived from Spirulina extract cultured with lava seawater are TNF-α, COX-2, IL-6. And IL-1b expression was significantly reduced.

These results mean that C-phycocyanin derived from spirulina extract cultured with lava seawater of the present invention reduces psoriasis symptoms by reducing the expression of inflammatory factors, and can also be used to prevent or treat inflammatory skin diseases. .

Overall, the present inventors cultured spirulina using lava seawater, from which C-phycocyanin, an active ingredient for treating inflammatory skin diseases, was extracted. In addition, it was confirmed that the extracted C-phycocyanin has an effect of dekeratinization, skin color improvement and expression of inflammatory factors in the psoriasis animal model. This means that the prepared C-phycocyanin can be utilized for the prevention, treatment and improvement of inflammatory skin diseases, and the C-phycocyanin of the present invention can be variously used in the field of cell regeneration and skin inflammation treatment. have.

Hereinafter, the present invention will be described in more detail through formulation examples. The formulation examples are only for illustrating the present invention, and the scope of the present invention is not to be construed as being limited by the formulation examples.

Formulation example  1. Preparation of pharmaceutical composition for preventing or treating inflammatory skin diseases

1-1. Wild  Produce

20mg of C-phycocyanin from Spirulina cultured with lava seawater

Lactose 100mg

Talc 10mg

The above ingredients are mixed and filled in an airtight fabric to prepare a powder.

1-2. Preparation of injection

10mg of C-phycocyanin from Spirulina cultured with lava seawater

Mannitol 180mg

2974mg of sterile distilled water for injection

Na ₂ HPO ₄ 2H ₂ O 26mg

It is prepared with the above-mentioned ingredient content per ampoule (2ml) according to the method of manufacturing a conventional injection.

1-3. Liquid  Produce

20mg of C-phycocyanin from Spirulina cultured with lava seawater

Iseonghwadang 10g

5 g mannitol

Purified water

Each component is added to the purified water according to the conventional method of dissolving, dissolved, and the lemon flavor is added in an appropriate amount, then the above components are mixed and purified water is added to adjust the total amount to 100 ml, and then sterilized by filling in a brown bottle. To prepare a liquid formulation.

Formulation example  2. Prevention or improvement of inflammatory skin diseases Cosmetic  Preparation of the composition

2-1. Preparation of flexible cosmetic lotion (skin lotion)

C-phycocyanin from Spirulina cultured in lava seawater 0.5%

Beta-1,3-glucan 1.0%

Butylene glycol 2.0%

Propylene glycol 2.0%

Carboxyvinyl polymer 0.1%

PG-12 nonylphenyl ether 0.2%

Polysorbate 80 0.4%

Ethanol 10.0%

Triethanolamine 0.1%

Preservatives, pigments, flavors

Purified water to 100%

2-2. Nutritional makeup ( Milk lotion )

C-phycocyanin from Spirulina cultured in lava seawater 0.5%

Beta-1,3-glucan 1.0%

Wax 4.0%

Polysorbate 60 1.5%

Sorbitan sesquioleate 1.5%

Liquid paraffin 0.5%

Caprylic / Capric Triglyceride 5.0%

Glycerin 3.0%

Butylene glycol 3.0%

Propylene glycol 3.0%

Carboxyvinyl polymer 0.1%

Triethanolamine 0.2%

Preservatives, pigments, flavors

Purified water to 100%

2-3. Preparation of nutrition cream

1.0% of C-phycocyanin from Spirulina cultured with lava seawater

Beta-1,3-glucan 5.0%

Mill blade 10.0%

Polysorbate 60 1.5%

Easy Easy 60 Castor Oil 2.0%

Solbitan sesquioleate 0.5%

Liquid paraffin 10.0%

Squalane 5.0%

Caprylic / Capric Triglyceride 5.0%

Glycerin 5.0%

Butylene glycol 3.0%

Propylene glycol 3.0%

Triethanolamine 0.2%

Preservatives, pigments, flavors

Purified water to 100%

Formulation example  3. Preparation of food composition for preventing or improving inflammatory skin disease

3-1. Production of health food

100 mg of C-phycocyanin from Spirulina cultured with lava seawater

Vitamin mixture

Vitamin A Acetate 70 g

Vitamin E 1.0 mg

Vitamin B1 0.13 mg

Vitamin B2 0.15 mg

Vitamin B6 0.5 mg

Vitamin B12 0.2 g

Vitamin C 10 mg

Biotin 10 g

Nicotinic acid amide 1.7 mg

50 g folic acid

Calcium Pantothenate 0.5 mg

Suitable amount of mineral mixture

Ferrous sulfate 1.75 mg

Zinc oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium phosphate 15 mg

Dibasic calcium phosphate 55 mg

Potassium citrate 90 mg

Calcium carbonate 100 mg

Magnesium chloride 24.8 mg

Although the composition ratio of the vitamin and mineral mixture is a composition suitable for a relatively healthy food in a preferred embodiment, the mixing ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional method for preparing a healthy food. , Granules can be prepared and used in the preparation of healthy food compositions according to conventional methods.

3-2. Production of health drinks

100 mg of C-phycocyanin from Spirulina cultured with lava seawater

Vitamin C 15 g

Vitamin E (powder) 100 g

Iron lactate 19.75 g

Zinc oxide 3.5 g

Nicotinic acid amide 3.5 g

Vitamin A 0.2 g

Vitamin B1 0.25 g

Vitamin B2 0.3 g

Water metering

After mixing the above ingredients according to a conventional health drink manufacturing method, and stirring and heating at 85 for about 1 hour, the resulting solution is filtered, obtained in a sterilized 2 L container, sealed and sterilized, then stored in a refrigerator and then stored in the present invention. It is used for the preparation of healthy beverage compositions.

Although the above composition ratio is a mixture of components suitable for preference beverages in a preferred embodiment, the mixing ratio may be arbitrarily modified according to regional and ethnic preferences such as demand hierarchy, country of use, and usage.

As described above, since a specific part of the present invention has been described in detail, it is obvious to those skilled in the art that this specific technique is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Therefore, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (7)

As a pharmaceutical composition for the prevention or treatment of psoriasis, comprising C-phycoyanin (C-phycoyanin) derived from spirulina cultured in high purity lava seawater medium,
The high purity lava seawater medium is a pharmaceutical composition for the prevention or treatment of psoriasis, characterized in that prepared by adding high purity lava seawater to an alkaline inorganic medium.
A method for preparing a pharmaceutical composition for the prevention or treatment of psoriasis, comprising the following steps, comprising C-phycoyanin derived from spirulina cultured with high purity lava seawater medium as an active ingredient:
(a) adding high purity lava seawater to an alkaline inorganic medium to prepare high purity lava seawater medium;
(b) culturing spirulina with the high purity lava seawater medium; And
(c) obtaining C-phycoyanin from the spirulina.
delete According to claim 1,
The concentration of the C- phycocyanin is 250μg / ml, pharmaceutical composition for the prevention or treatment of psoriasis.
According to claim 1,
The C-phycocyanin is selected from the group consisting of TNF-α (tumor necrosis factor-α), COX-2 (cyclooxygenase-2), IL-6 (interleukin-6) and IL-1b (interleukin-1b). A pharmaceutical composition for the prevention or treatment of psoriasis, which reduces the expression of one or more inflammatory factors.
C-phycoyanin derived from spirulina cultured in high purity lava seawater medium
Cosmetic composition for the prevention or improvement of psoriasis comprising as an active ingredient.
The high purity lava seawater medium is a cosmetic composition for the prevention or improvement of psoriasis, characterized in that prepared by adding high purity lava seawater to an alkaline inorganic medium.
Food composition for the prevention or improvement of psoriasis containing C-phycoyanin (C-phycoyanin) derived from spirulina cultured in high purity lava seawater medium.
The high purity lava seawater medium is a cosmetic composition for the prevention or improvement of psoriasis, characterized in that prepared by adding high purity lava seawater to an alkaline inorganic medium.

Images