KR102112613B1 - New rice variety having high content of tryptophan and improved taste and breeding method thereof - Google Patents

Abstract

The present invention relates to a seed (Accession No: KACC 98074P) of a new variety of rice, S4-10, having high content of tryptophan and improved taste and a plant derived therefrom. The seed is obtained by crossbreeding Samkwang rice, as a parent plant, and high content tryptophan mutant 5MT-4 line, as a child plant. Thus, a content of tryptophan in the seed is high compared to that of the Samkwang rice, the parent plant, and chalkiness and while belly/core generation rate and protein content of the seed are reduced compared to that of the high content tryptophan mutant 5MT-4 line, the child plant.

Description

New rice variety having high content of tryptophan and improved taste and breeding method thereof}

The present invention relates to a new breed of high-content tryptophan rice with improved taste and a breeding method thereof.

The primary goal of agronomists is to help ensure that sufficient food is provided to the growing population. Today, many foods are available on the market, but they do not provide enough of the nutrients we need. It is necessary to provide high nutrient foods made from delicious and good quality grains, and preserving nutrients in rice also increases its value. Golden rice (Ye et al . (2000) Science 287: 303-305) and iron-fortified rice (Goto et al . (1999) Nat. Biotechnol. 17: 282-286; Cho et al) (2009) J. Plant Biotechnol. 36: 87-95). However, when adding some merits to the rice, the appearance deteriorates and the consumer is turned away, and the high content of tryptophan mutants has this problem.

Tryptophan (tryptophan, Trp) is one of the essential amino acids that our body needs, along with histidine, threonine, valine, methionine, isoleucine, leucine, phenylalanine, and lysine. As is known, essential amino acids are not synthesized by the body, but are necessary for the body to function normally. Therefore, it must be consumed as food, and tryptophan taken as food goes through one of two basic metabolic pathways in the liver. One is used for protein synthesis to perform functions in cells throughout the body, and the other is broken down through a series of metabolic processes known as the kynurenine pathway in the liver. In addition, tryptophan acts as a substrate for synthesizing serotonin in the nervous system, and is required for synthesizing methionine in the pineal gland. In addition, if niacin is insufficient to synthesize the essential cell cofactor, nicotinamide adenine dinucleotide (NAD +), tryptophan is also used instead (Moffett and Namboodiri (2003) Cell Biol. 81: 247-265). Taken together, tryptophan is required for the synthesis of bioactive substances and the regulation of serotonin and methionine. If you do not supply enough tryptophan, you are more likely to get pellagra disease. Pellagra disease is a type of deficiency that can cause dermatitis, dementia, and diarrhea. Synthetic tryptophan is expensive due to its relatively low industrial production efficiency (Ishihara et al . (2007) Metabolomics 3: 319-334). Therefore, if you make food with rice that has been enhanced with tryptophan, it will contribute to helping consumers' health.

Anthranilate synthase (AS) converts the tryptophan synthesis substrate corrismate to anthracinate, which is the first step in tryptophan synthesis. In AS, there are alpha subunits and beta subunits, which are required for the action of a feedback inhibitory enzyme driven by tryptophan. Therefore, it can be seen that AS plays an important role in regulating tryptophan biosynthesis (Ishikawa et al . (2003) Plant Sci. 164: 1037-1045). In the previous study, the rice treated with EMS (Ethyl Methane Sulfonate) was mutated to AS and showed resistance to growth inhibition by tryptophan analogs such as 5MT (5-methyl-tryptophan). 5MT is suitable for the AS allosteric site, which acts as an important feedback factor in sikimate synthesis, one of the tryptophan biosynthesis processes. Therefore, when the AS enzyme cannot distinguish 5MT from tryptophan and reacts to 5MT, further tryptophan synthesis does not occur. In addition, since 5MT cannot participate in tryptophan instead of intracellular protein synthesis, cell growth is also inhibited. However, tryptophan hypersynthetic mutations have been reported to be resistant to this growth inhibition (Kim et al . (2007) J. Radiat. Ind. 1: 1-13).

On the other hand, Korean Patent Publication No. 2018-0055416 discloses 'new varieties of rice, which are varieties of sugary rice', and Korean Patent No. 0687311 discloses 'C3GHi rice breeding method of new varieties of plants', but the taste of the present invention is disclosed. There is no description of the improved high-content tryptophan rice new varieties and their breeding methods.

The present invention has been derived by the above-mentioned needs, the present inventors, to improve the low seed quality and food taste of the high content of tryptophan (tryptophan) rice system, based on Samgwang rice, high content of tryptophan mutant 5MT-4 system And mated as a copy, the seed has a higher tryptophan content than the parent Samgwang rice, and the seed content of chalkiness and cardiac whiteness and protein content is higher than that of the 5MT-4 strain, which is a high content of tryptophan mutant. The present invention was completed by breeding a new breed of high content tryptophan rice, 'S4-10', which has reduced properties and improved taste.

In order to solve the above problems, the present invention is a F ₆ strain obtained by cross-linking it by using Samgwang rice as a parent and a high content of tryptophan mutant 5MT-4 strain as a parent, and the tryptophan content of the seed is 1.0 to 2.0 mg / 100mg. As compared to the parental Samgwang rice, it has a characteristic that the incidence of chalkiness, cardiac whiteness and protein content of the seed is reduced compared to the high content of tryptophan mutant, which is the main component, and the food taste with an accession number of KACC 98074P is improved. It provides a seed of the new high-content tryptophan rice ( Oryza sativa ) 'S4-10' and plants derived from the seed.

In addition, the present invention provides a rice processed food prepared using the seeds of the new rice variety 'S4-10'.

The high content of tryptophan rice varieties 'S4-10', which show improved seed quality and taste characteristics according to the present invention, is an improvement of the low food value shown in the high content of tryptophan rice system, and the new varieties of rice of the present invention are used as materials for growing rice varieties. It is expected to contribute to increasing the income of rice farmers because it is a functional crop.

Figure 1 is the amino acid sequence (B) of the phenotype (A) and anthranilate synthase alpha subunit (ASA) of rice grown in 50 μM 5MT (5-methyl-tryptophan) 1/2 medium. (A): Two high-content tryptophan mutant strains showed excellent growth, while the root growth of the rice during the parent species was reduced. (B): As a result of amino acid sequence alignment of the anthranilic acid alpha subunit ( LOC_Os03g15780.1 ) in rice and high-content tryptophan mutants during parenting , point mutation of F124V (F [TTC] → V [GTC]) This was observed.
2 is a tryptophan biosynthesis pathway and anthranilate synthase (AS) activity in plants, (A) shows a negative feedback control mechanism of the pathway from tryptophan (Trp) to AS, (B) Trp By confirming the inhibition of the activity of AS, it is a result of measuring the AS synthesis activity according to 10 mM glutamine and a substrate with 100 μM corrismate and various concentrations of Trp (0, 10, 100, 250, 500 and 1,000 mM).
Figure 3 shows the quality and appearance of 5MT resistant strain rice, (A) is the moisture content, whole grains (whole grains), chalkiness, broken grains (broken) of the parent species (season rice) and high-content tryptophan mutant strains grains), and (B) physical rice appearance (top: brown rice, bottom: white rice) showing Shimbokbaek (white part in the middle).
Figure 4 is a schematic diagram of the new breed of rice 'S4-10' of the present invention, a short-crossing progeny method was used to introduce a point mutation into the Samgwang rice showing high taste and high quality. Two mating combinations were used: Samgwang × 5MT-4 and Samkwang × 5MT-5.
Figure 5 shows the phenotypic response of plants in 5MT-added medium and the nucleotide sequence and relative mRNA expression level of OsASA ( Oryza sativa anthranilate synthase alpha subunit) gene, (A) cross-brother in 5MT-added medium (Samwang, 5MT) -4, 5MT-5) and F ₅ generation phenotypes, (B) shows the results of sequencing of the OsASA gene of mating parents and progeny (S4-10), (C) Samgwang, It shows the relative mRNA expression levels of the 5MT line and the selected line of OsASA genes.
Figure 6 is a comparison of the quality and appearance between the parent line (Samwang, 5MT-4 and 5MT-5) and the selected line in the F ₆ generation of each mating combination, (A) is the whiteness of the parent and future whiteness As a result of analyzing the degree, (B) is a photograph of the appearance of white rice appearance of the descendant lineage selected with both parents.
7 is a result of analyzing the food-related characteristics of the later generations selected from the parental line (Samwang, 5MT-4, 5MT-5) and F ₆ generations of each mating combination, (A) is the protein content (: nutritional value of rice) , (B) is the viscosity (: viscosity of rice starch), (C) is amylose content (: abrasiveness and strength of rice), (D) is the result of analysis of food taste (: food after cooking).

In order to achieve the object of the present invention, the present invention is obtained by crossing it by using Samgwang rice as a parent and a high content of tryptophan mutant 5MT-4 strain as a parent, and the tryptophan content of the seed is 1.0-2.0 mg / 100mg. Compared to the parent Samgwang rice, it has a characteristic that the incidence of chalkiness, cardiac whiteness and protein content of the seeds are reduced compared to the 5MT-4 strain, which is a high content of tryptophan mutant, and the food content with a deposit number of KACC 98074P. It provides improved high-content tryptophan rice ( Oryza sativa ) seeds of the new breed 'S4-10' and plants derived therefrom.

The high content of tryptophan rice with a deposit number of KACC 98074P according to the present invention 'S4-10' contains tryptophan of 1.45 mg / per 100mg weight of seed, and the tryptophan content of the parental Samgwang rice varieties used for mating is 0.1 ~ 0.2mg It shows a tryptophan content of 10 times higher than that of / 100mg, and the protein content is 15.4% lower than the high-content tryptophan mutant 5MT-4 strain used for crossing, which improves the palatability, and the high-content tryptophan as the main content It is characterized by a reduced incidence of chalkiness and cardiac whiteness of the seeds compared to the mutant 5MT-4 line.

The term 'chalky kernel' refers to a grain in which at least 1/2 of the volume is in a powdery (fragile nature), and refers to the surface of the rice that is transparent and has a powdery appearance. . In addition, the term 'Shimbokbaek' refers to the white part of the grain, and the less powdery granules and Simbokbaek, the better the quality of rice.

The new rice variety 'S4-10' with a deposit number of KACC 98074P according to the present invention,

(A) sowing the seed of the parent Samgwang rice varieties;

(b) seeding seeds of a high content of tryptophan mutant strains;

(c) artificially crossing the parental Samgwang rice and the secondary high-content tryptophan mutant line at flowering time;

(d) harvesting F ₆ generation seeds by cultivating F ₁ to F ₅ generations of mated individuals in a medium containing 5 MT (5-methyl-tryptophan), selecting 5 MT resistant individuals, and advancing in a single-cross generation method. ; And

(e) harvesting F ₆ generation seeds, tryptophan content, the step of selecting the lineage based on the presence of powdery granules and the presence or absence of cardiac; was grown by a breeding method comprising a.

The high-content tryptophan mutant line used as the copy was treated with 2% of Ethyl Methane Sulfonate (EMS) in rice paddy, and then seeded in a 1/2 MS medium containing 500 μM of 5MT to show a strong resistance to 5MT. As a selection, the 124th amino acid residue phenylalanine (F) was applied to the amino acid sequence of the anthranilate synthase alpha subunit (NCBI Reference Sequence: XP_015631311.1) protein having the amino acid sequence of SEQ ID NO: 1. (Valine, V). The high-content tryptophan mutant line used in breeding of the new rice variety 'S4-10' having a deposit number KACC 98074P according to the present invention is a system named 5MT-4, and the sample is stored in the Department of Plant Resources, Chungbuk National University have.

The present inventors were raised by the breeding method as described above, showed a tryptophan content of 10 times or more compared to the parent Samgwang rice varieties, and had a lower protein content compared to the high-content tryptophan mutant 5MT-4 strain, resulting in improved palatability. The lineage having the characteristics was designated as a new variety of rice, ' Oryza sativa L. Japonica rice S4-10 rice', and a representative sample of the seed was deposited with the National Academy of Agricultural Science Microbial Bank on November 18, 2019 (Accession No: KACC 98074P ).

The present invention also provides a rice processed food prepared using the seed of the new rice variety 'S4-10' having the deposit number KACC 98074P. The rice processed food according to the present invention may be retort rice, alpha rice, frozen rice, noodles, porridge, rice cakes, confectionery, beverages, alcoholic beverage, red pepper paste, miso, vinegar or rice bran, but is not limited thereto.

In addition, the present invention provides a breeding method of a new breed of high-content tryptophan rice 'S4-10' with improved taste, including the step of mating rice, as a parent, and crossing the high-content tryptophan mutant 5MT-4 line as a parent. .

More specifically, the breeding method according to the present invention,

(A) sowing the seed of the parent Samgwang rice varieties;

(b) seeding seeds of a high content of tryptophan mutant strains;

(c) artificially crossing the high-content tryptophan mutant line, which is the parent variety, Samgwang rice, and the secondary type, at the time of flowering;

(d) harvesting F ₆ generation seeds by cultivating F ₁ to F ₅ generations of mated individuals in a medium containing 5 MT (5-methyl-tryptophan), selecting 5 MT resistant individuals, and advancing in a single-cross generation method. ; And

(e) selecting a strain based on the tryptophan content of the harvested F _6th generation seeds, the occurrence of powdery granules, and the presence or absence of cardiac bags; but may not include, but is not limited to.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited to the following examples.

Experimental material

The seeded skin was sterilized by washing it with 70% ethanol for 5 minutes and 2.5% with hypochlorous acid twice for 10 minutes. Thereafter, after washing with distilled water several times, the cells were densified in MS (Murashige and Skoog) medium to which 50 μM 5-Methyl-DL-tryptophan (# M0534, Sigma, USA) was added, and irradiated with constant light for 10 days at 30 ° C. Cultured.

Sequencing

A PCR using a anthranilate synthase alpha subunit (Oryza sativa anthranilate synthase alpha subunit, OsASA) primer set to confirm the F124V point mutation of the protein (CCTGGGGATCTGCATAGGAT (SEQ ID NO: 3) Fw:: GGGGAAGCCAGAGGCAAG (SEQ ID NO: 2), Rv) Was performed. The sequencing of the obtained PCR product was performed, and multiple sequence alignment was performed through the method of Corpet (Nucleic Acids Res. (1988) 16: 10881-10890).

Analysis of anthranilate synthase

After crushing the leaves of seedlings cultured for 2 weeks in 1/2 MS medium containing 5-Methyl-DL-tryptophan using liquid nitrogen and a mortar, a single portion of cold anthranilic acidase (AS) extraction buffer After dipping in a solution (0.1 M Tris / HCl pH 7.5, 1 mM chorismate, 20 mM L-glutamine, 10 mM MgCl), 2 mg of polyvinylpolypyrrolidone per 1 g of leaves was added. The solution was centrifuged twice at 30,000 x g for 15 minutes to take a supernatant, and after adding twice the saturated ammonium sulfate volume of the supernatant, re-centrifugation was performed. The pellet obtained by centrifugation was dissolved in 500 μl AS extraction buffer and used for AS analysis. AS activity was measured by the production of chorismate, a dependent product of anthrate. To the pellet solution dissolved with AS extraction buffer solution, 1.5 ml AS buffer 2 (20 mM triethanolamine pH 8.5, 10% glycerol, 1 mM EDTA) and 200 µl of substrate solution were added and the anthrate synthesis level was adjusted to Aminco-Bowman spectrofluorimeter (SLM-Aminco , USA) by measuring fluorescence at 340 nm (excitation) and 400 nm (emission). Anthrate formation was observed by continuously measuring the fluorescence of the mixture after waiting until the reaction stabilized at 30 ° C. while adding tryptophan solution (5 mM) little by little (1, 10, 100, 250, 500, 1,000 mM).

mRNA expression level investigation

The relative mRNA expression of the mated parent and selected later OsASA ( Oryza sativa anthranilate synthase alpha subunit) was quantified. The leaves of the two-week-old seedlings were collected and total RNA was extracted using RNAiso Plus (Takara, Japan). For the cDNA synthesis was performed using ^{ReverTra Ace ® qPCR RT master mix with} gDNA remover, qRT-PCR is used to iQTMSYBR ^® Green supermix was performed with Bio-Rad real time PCR machine. The control group was set to the ß-tubulin gene.

Physicochemical analysis

After drying the harvested rice at 55 ° C. for 3 days, it was confirmed that the moisture content was about 14%. After peeling the seed coat using a brown rice machine, it was made into brown rice, and was coated with a rice cleaning machine (MC-90A, Toyoseiki) at a rate of 90%. The coated rice was weighed 15g and crushed with a 100-mesh screen by Cyclotec Sample Mill (Foss North America [Tecator] No.1093-003). The ground samples were used for viscosity measurement, amylose content, and amino acid content analysis (Lee et al. (2014) Plant Breed. Biotech. 2: 301-312). Separation granules were separated with a sorter and the selected rice was used for further analysis. The rice quality tester was used to investigate complete beauty, crushing, deep lip lip, and damaged lip. Water content, protein content, amylose content, and whiteness were measured using an Infratec Grain Analyzer.

Viscosity measurement

The viscosity of a rice sample was measured using a japonica rice method with a rapid visco analyzer (RVA) developed in Japan's food organization. By measuring the viscosity for a long time, it was possible to distinguish the luxury characteristics of similar quality rice experiments. After placing 25 ml of distilled water and 3 g of rice flour in a metal container, the paddle was placed in the container and mounted on an RVA device. All luxury parameters were measured in 3 replicates for each sample in Rapid Visco Units (RVU). Food taste was measured using two instruments, one sample was measured with a Satake Rice Taste Analyzer using 10 g of white rice, and the other sample was analyzed using a TOYO taste meter system (MB-90A and MA-90B) using 33 g of white rice per sample. , Japan).

Agricultural traits and statistical analysis

Two parents (Samwang rice, 5MT-4) and later agricultural traits were examined in the packaging, and data were measured and tested for significance in 3 replicates. The measurement method was in accordance with the Standard Evaluation System, and the significance was tested by the Duncan Multiple Range Test.

Example 1. Development of high-content tryptophan rice

In the present invention, molecular properties and phenotypic analysis of two 5 MT (5-methyl-tryptophan) resistant strains developed by treating EMS (Ethyl Methane Sulfonate) in rice was carried out. The two high content tryptophan mutant lines were named 5MT-4 and 5MT-5, respectively. The main point in the present invention is the anthranilate synthase gene that regulates the biosynthesis of tryptophan by inhibiting the feedback of the tryptophan biosynthetic pathway in plants by using the tryptophan content, seed characteristics, and food taste of the cultivation line. It was selected in 1/2 MS medium containing 50 μM of 5 MT involved in the inhibition of the protein. As shown in FIG. 1A, while the seedling growth of 5MT-4 and 5MT-5 was a parent species in 1/2 MS medium with 5 MT added, it was found that the growth of roots was superior to that of rice (WT in FIG. 1). , As a result of sequencing, a point mutation occurred on the ORF of the anthranilic acid alpha subunit ( ASA ) gene ( LOC_Os03g15780 ), whereby phenylalanine (F) was changed to valine (Valine, V) at the 124th amino acid residue. It was confirmed (Fig. 1B).

Anthranilic acidase is the target of feedback inhibition by tryptophan, the final product of the tryptophan biosynthesis circuit, and regulates enzyme activity. Mutants that are insensitive to feedback of anthranilic acidase accumulate a large amount of tryptophan, an essential amino acid (Fig. 2A). ). Two selected 5MT resistant strains were analyzed for anthranilic acidase activity in tryptophan (0, 10, 100, 250, 500, and 1,000 μM) and 10 mM glutamine, 100 μM corrismate conditions with rice. As shown in FIG. 2B, as the concentration of tryptophan increased, the activity of anthranilic acidase in WT was gradually decreased, whereas in the case of two 5MT resistant strains, the concentration of tryptophan was increased despite the increase in the concentration of tryptophan. Anthranilic acid enzyme activity was increased.

Example 2. Seed and food quality of high-content tryptophan rice

The tryptophan content of the two selected 5MT resistant strains was found to be at least 5 times or 30 times higher than that of the parent product, and stable growth in 5MT added medium was confirmed. However, as in most tryptophan studies, the high-content tryptophan lines showed low seed quality and taste.

As a result of conducting the rice quality and taste test by selecting the selected resistant system, despite the standard moisture content, the two 5MT resistant systems exhibited a number of cardiac bags and powdery granules (FIG. 3).

Example 3. Food quality and excellent seed development of high content tryptophan rice hybrid system

Using 5MT resistant rice system with increased tryptophan content, in order to breed high quality and gourmet rice varieties, select 5MT resistant system and Samgwang rice, which has excellent agricultural characteristics, to introduce 5MT resistant rice Female mating was conducted (Fig. 4). The mating system was used to determine the resistance of the medium containing 5MT, and the growth was confirmed around 10-14 days. As a result, the growth of the ground and roots was similar to that of the 5MT resistant system (FIG. 5A). As a result of mutation verification by analyzing the nucleotide sequence of the OsASA ( Oryza sativa anthranilate synthase alpha subunit) gene in the selected mating combination (S4-10), a point sequence mutation occurred at the same position as the 5MT resistant strain, and the amino acid The sequence was confirmed to be substituted (F124V) (FIG. 5B). In addition, since anthranilic acid synthase is an important regulator of tryptophan biosynthesis, the relative mRNA expression of OsASA of the selected mating parent (5MT-4) and mother ( Samwang rice) and selected high-content tryptophan strains, S4-10 , was selected. As a result, the relative expression level of OsASA in Samgwang rice was higher than that of the selected high-content tryptophan strains (FIG. 5C).

The offspring showing excellent agricultural traits in the packaging and excellent growth in 5MT-containing medium were selected and harvested in large quantities of F ₆ generation seeds, and the seed quality and taste test were conducted. As a result, the incidence of segregation was reduced in the lines selected in the F ₆ generation, as opposed to the identification of cardiac regurgitation and segregation at 5MT-4 and 5MT-5, and superior seeds were not found. Phenotype was confirmed (Fig. 6). This phenotype is the result of supporting high quality and gourmet taste by quantitative data such as protein content, viscosity and amylose content.

As a result of analyzing the protein content to measure the general nutritional component, the selected strains showed significantly lower protein content than 5MT-4 and 5MT-5, which is expected to improve the quality and taste of the new rice strain (Fig. 7A). In the case of amylose content, the amylose content of 20% or less was shown in all upbringing lines (Fig. 7C), and the S4-9, S4-10 and S5-7 lines in palatability compared to 5MT-4 and 5MT-5, and Samgwang rice. When it did, it showed excellent values (Fig. 7D). Using the rice powder sample, the amino acid content of the parent and selected F ₆ strains was measured, and the 20 individual amino acid values are shown in Table 1.

Interestingly, it was confirmed that not all F ₆ generation strains inherited high-content tryptophan, and that the tryptophan content in the S4-10 strain was significantly increased than that of Samgwang rice, and the agricultural traits of the selected S4-10 strain and As a result of investigating the quantity components, it was found that there was no significant difference from the Samgwang rice and high content tryptophan system (5MT-4) used as the parental parent (Table 2).

The S4-10 strain has a tryptophan content of 10 times or more compared to the parent Samgwang rice varieties, and the protein content is lower than that of the high-content tryptophan mutant strain (5MT-4), resulting in improved palatability. The representative seed of the S4-10 strain was deposited with the National Institute of Agricultural Science Microbial Bank on November 18, 2019 (Accession No: KACC 98074P).

It is believed that the lineage selected through the present invention can be used as a material for research on transcript expression of an agriculturally important gene and for evaluation of varieties. The development of high-quality strain-resistant 5MT, such as S4-10, could be used as a material to cultivate new high-content tryptophan rice varieties, and furthermore, it could provide farmers with improved nutrition and quality rice. do.

National Academy of Agricultural Science KACC98074P 20191118

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> New rice variety having high content of tryptophan and improved          taste and breeding method thereof <130> PN19457 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 606 <212> PRT <213> Oryza sativa <400> 1 Met Glu Ser Ile Ala Ala Ala Thr Phe Thr Pro Ser Arg Leu Ala Ala   1 5 10 15 Arg Pro Ala Thr Pro Ala Ala Ala Ala Ala Pro Val Arg Ala Arg Ala              20 25 30 Ala Val Ala Ala Gly Gly Arg Arg Arg Thr Ser Arg Arg Gly Gly Val          35 40 45 Arg Cys Ser Ala Gly Lys Pro Glu Ala Ser Ala Val Ile Asn Gly Ser      50 55 60 Ala Ala Ala Arg Ala Ala Glu Glu Asp Arg Arg Arg Phe Phe Glu Ala  65 70 75 80 Ala Glu Arg Gly Ser Gly Lys Gly Asn Leu Val Pro Met Trp Glu Cys                  85 90 95 Ile Val Ser Asp His Leu Thr Pro Val Leu Ala Tyr Arg Cys Leu Val             100 105 110 Pro Glu Asp Asn Met Glu Thr Pro Ser Phe Leu Phe Glu Ser Val Glu         115 120 125 Gln Gly Pro Glu Gly Thr Thr Asn Val Gly Arg Tyr Ser Met Val Gly     130 135 140 Ala His Pro Val Met Glu Val Val Ala Lys Glu His Lys Val Thr Ile 145 150 155 160 Met Asp His Glu Lys Gly Lys Val Thr Glu Gln Val Val Asp Asp Pro                 165 170 175 Met Gln Ile Pro Arg Ser Met Met Glu Gly Trp His Pro Gln Gln Ile             180 185 190 Asp Gln Leu Pro Asp Ser Phe Thr Gly Gly Trp Val Gly Phe Phe Ser         195 200 205 Tyr Asp Thr Val Arg Tyr Val Glu Lys Lys Lys Leu Pro Phe Ser Gly     210 215 220 Ala Pro Gln Asp Asp Arg Asn Leu Pro Asp Val His Leu Gly Leu Tyr 225 230 235 240 Asp Asp Val Leu Val Phe Asp Asn Val Glu Lys Lys Val Tyr Val Ile                 245 250 255 His Trp Val Asn Leu Asp Arg His Ala Thr Thr Glu Asp Ala Phe Gln             260 265 270 Asp Gly Lys Ser Arg Leu Asn Leu Leu Leu Ser Lys Val His Asn Ser         275 280 285 Asn Val Pro Lys Leu Ser Pro Gly Phe Val Lys Leu His Thr Arg Gln     290 295 300 Phe Gly Thr Pro Leu Asn Lys Ser Thr Met Thr Ser Asp Glu Tyr Lys 305 310 315 320 Asn Ala Val Met Gln Ala Lys Glu His Ile Met Ala Gly Asp Ile Phe                 325 330 335 Gln Ile Val Leu Ser Gln Arg Phe Glu Arg Arg Thr Tyr Ala Asn Pro             340 345 350 Phe Glu Val Tyr Arg Ala Leu Arg Ile Val Asn Pro Ser Pro Tyr Met         355 360 365 Ala Tyr Val Gln Ala Arg Gly Cys Val Leu Val Ala Ser Ser Pro Glu     370 375 380 Ile Leu Thr Arg Val Arg Lys Gly Lys Ile Ile Asn Arg Pro Leu Ala 385 390 395 400 Gly Thr Val Arg Arg Gly Lys Thr Glu Lys Glu Asp Glu Met Gln Glu                 405 410 415 Gln Gln Leu Leu Ser Asp Glu Lys Gln Cys Ala Glu His Ile Met Leu             420 425 430 Val Asp Leu Gly Arg Asn Asp Val Gly Lys Val Ser Lys Pro Gly Ser         435 440 445 Val Lys Val Glu Lys Leu Met Asn Ile Glu Arg Tyr Ser His Val Met     450 455 460 His Ile Ser Ser Thr Val Ser Gly Glu Leu Asp Asp His Leu Gln Ser 465 470 475 480 Trp Asp Ala Leu Arg Ala Ala Leu Pro Val Gly Thr Val Ser Gly Ala                 485 490 495 Pro Lys Val Lys Ala Met Glu Leu Ile Asp Glu Leu Glu Val Thr Arg             500 505 510 Arg Gly Pro Tyr Ser Gly Gly Leu Gly Gly Ile Ser Phe Asp Gly Asp         515 520 525 Met Leu Ile Ala Leu Ala Leu Arg Thr Ile Val Phe Ser Thr Ala Pro     530 535 540 Ser His Asn Thr Met Tyr Ser Tyr Lys Asp Thr Glu Arg Arg Arg Glu 545 550 555 560 Trp Val Ala His Leu Gln Ala Gly Ala Gly Ile Val Ala Asp Ser Ser                 565 570 575 Pro Asp Asp Glu Gln Arg Glu Cys Glu Asn Lys Ala Ala Ala Leu Ala             580 585 590 Arg Ala Ile Asp Leu Ala Glu Ser Ala Phe Val Asp Lys Glu         595 600 605 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 ggggaagcca gaggcaag 18 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 cctggggatc tgcataggat 20

Claims (4)

Samgwang rice as the parent, high content of tryptophan mutant 5MT-4 strains obtained by crossing this, obtained by seeding tryptophan content of 1.0 ~ 2.0 ㎎ / 100mg compared to the parent Samgwang rice, high content of the secondary Compared to the 5MT-4 line of tryptophan mutants, it has a characteristic of reduced seed incidence (chalkiness), incidence of cardiac bags, and protein, and improved high-content tryptophan rice ( Oryza sativa ) with improved food taste with deposit number KACC 98074P. Seed of 'S4-10'. The method of claim 1, wherein the high content of tryptophan mutant 5MT-4 strain is a rice seedling, and the rice-derived anthranilate synthase alpha subunit protein consisting of the amino acid sequence of SEQ ID NO: 1 is Oryza sativa anthranilate synthase alpha subunit protein. Seed of new rice variety 'S4-10', characterized in that the 124th amino acid residue phenylalanine (Phenylalanine) in the amino acid sequence is a mutated lineage substituted with Valine. A plant of 'S4-10', a new rice variety derived from the seed of the new rice variety 'S4-10', with a deposit number of claim 1, KACC 98074P. A rice processed food manufactured using the seeds of the new rice variety 'S4-10' of claim 1.

Images