KR102108179B1 - Novel protein and uses thereof - Google Patents

Abstract

The present invention relates to a novel protein and a composition comprising the same. The protein and the composition comprising the same of the present invention can acetylate a steroid-based compound or a derivative thereof, and thus is expected to be advantageously used for acetylation of the compound.

Description

Novel protein and uses thereof

The present invention relates to novel proteins capable of acetylating compounds, compositions comprising them and uses thereof.

The method of acetylating a compound by a chemical method randomly attaches an acetyl group through a chemical reaction, so various derivatives are synthesized through a single chemical reaction, and only specific derivatives cannot be synthesized selectively. Therefore, in order to obtain a desired specific derivative, an additional separation and purification process is additionally required, which causes cost and process problems. In this situation, it is desired to create a substance capable of attaching or breaking an acetyl group at a specific position of the compound.

United States Patent Publication US2007-0049538

It is an object of the present invention to provide a novel protein having the activity of an acetyltransferase enzyme.

Another object of the present invention is to provide a nucleic acid molecule encoding a novel protein.

Another object of the present invention is to provide a recombinant expression vector comprising a nucleic acid molecule encoding a novel protein.

Another object of the present invention is to provide a transformant in which a recombinant expression vector containing a nucleic acid molecule encoding a novel protein is transformed into a host cell.

Another object of the present invention is to provide a composition comprising a novel protein capable of acetylating a steroid-based compound.

Another object of the present invention is to provide a method for producing a novel protein.

Another object of the present invention is to provide a method for acetylating a steroid-based compound using a composition containing a novel protein.

1. A protein consisting of the amino acid sequence of SEQ ID NO: 1.

2. A nucleic acid molecule encoding the protein of 1 above.

3. In the above 2, wherein the nucleic acid molecule is a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 2.

4. Recombinant expression vector comprising the nucleic acid molecule of 2 above.

5. A transformant in which the recombinant expression vector of above 4 is transformed into a host cell.

6. A composition for acetylation of a steroid-based compound or a compound derivative containing the protein of the above 1.

7. In the above 6, wherein the steroid-based compound is a composition for acetylation of a steroid-based compound or the compound derivative, which is one of cucurbitacin, ecdysone, cortisol, or estriol.

8. The composition for acetylation of a steroid-based compound or a derivative of the compound of 7 above, wherein the cucurbitacin is one of cucurbitacin B, cucurbitacin D, cucurbitacin E or cucurbitacin I.

9. The composition for acetylation of a steroid-based compound or a compound derivative according to the above 6, wherein the steroid-based compound is cucurbitacin, and the protein acetylates the hydroxy group of carbon 16 of the cucurbitacin.

10. Cultivating the transformant of 5 above; And

Protein production method consisting of the amino acid sequence of SEQ ID NO: 1 comprising the step of separating the protein from the culture of the transformant.

11. A method for acetylation of a steroid-based compound or a compound derivative comprising reacting a composition comprising the protein of 1 with a steroid-based compound or the compound derivative.

12. The method of 11 above, wherein the steroid-based compound is one of cucurbitacin, ecdysone, cortisol, or estriol, or a acetylation method of the steroid-based compound or the compound derivative.

13. The method of 12 above, wherein the cucurbitacin is one of cucurbitacin B, cucurbitacin D, cucurbitacin E or cucurbitacin I, or an acetylation method of the compound derivative.

14. The steroid-based compound according to the above 13, wherein the cucurbitacin B, the cucurbitacin D, the cucurbitacin E or the cucurbitacin I is acetylated with a hydroxy group bound to carbon 16 Or a method for acetylation of the compound derivative.

The present invention relates to a novel protein, the protein of the present invention can be acetylated steroid-based compound or the compound derivative, a composition comprising the same can be used as a composition for acetylation of the steroid-based compound or the compound derivative have.

1 shows sample 1 standard form and sample 1 HPLC data
Figure 2 shows the HPLC data of the standard form of sample 2 and sample 2.
Figure 3 shows the HPLC data of the standard form and sample 3 of the sample.
Figure 4 shows the HPLC data of the standard form and sample 4 of the sample.
5 shows HPLC data of the standard form of Sample 5 and Sample 5.
6 shows HPLC data of the standard form of Sample 6 and Sample 6.
7 shows the HPLC data of the standard form and sample 7 of the sample.
8 shows ¹ H-NMR data of Sample 1.
9 shows ¹³ C-NMR data of Sample 1.
10 shows ¹ H-NMR data of Sample 2.
11 shows ¹³ C-NMR data of Sample 2.
12 shows ¹ H-NMR data of Sample 3.
13 shows ¹³ C-NMR data of Sample 3.
14 shows ¹ H-NMR data of Sample 4.
15 shows ¹³ C-NMR data of Sample 4.

Hereinafter, the present invention will be described in detail.

The present invention provides a novel protein consisting of the amino acid sequence of SEQ ID NO: 1.

Protein consisting of the amino acid sequence of SEQ ID NO: 1 of the present invention is an enzyme capable of acetylating a compound, specifically, an enzyme capable of acetylating a triterpenoid-based compound having four rings or the compound derivative to be.

The 'compound derivative' of the present invention refers to a compound that is changed within a limit that does not significantly change the structure of the parent such as introduction of a functional group, oxidation, reduction, substitution of atoms, etc., using a specific compound as a parent.

The term 'triterpenoid-based compound derivative' of the present invention refers to a compound that is changed within a limit that does not significantly change the structure of the parent, such as introduction of a functional group, oxidation, reduction, substitution of atoms, etc., using the triterpenoid-based compound as a parent.

In the present invention, the triterpenoid-based compound having the four rings may be a steroid-based compound.

The steroid-based compound is a generic term for a compound containing a steroid nucleus structure in which three rings consisting of six carbons and one ring consisting of five carbons are attached. Each bond comprising the four rings included can be a single bond or a double bond:

[Formula 1]

.

.

The steroid-based compound may have at least one hydroxy group. For example, a hydroxy group may be attached to at least one carbon constituting the steroid-based compound.

Specifically, in the present invention, the steroid-based compound may be cucurbitacin, ecdysone, cortisol, or estriol.

The cucurbitacin compound is a compound comprising a structure of Formula 2 as a backbone, and a functional group or a substituent may be attached to at least one carbon included in Formula 2 below:

[Formula 2]

.

.

The cucurbitacin compound or a derivative thereof may have at least one hydroxy group.

Specifically, a hydroxy group may be attached to at least one carbon constituting the cucurbitacin compound or a derivative thereof. For example, carbon # 1, carbon # 2, carbon # 3, carbon # 4, carbon # 5, carbon # 6, carbon # 7, carbon # 8 of the cucurbitacin compound having a backbone of formula 1 9 carbon, 10 carbon, 11 carbon, 12 carbon, 13 carbon, 14 carbon, 15 carbon, 16 carbon, 17 carbon, 18 carbon, 19 carbon, 20 carbon, 21 carbon A hydroxy group may be attached to at least one of carbon, carbon 22, carbon 23, carbon 24, carbon 25 and carbon 26, but is not limited thereto.

The above-mentioned cucurbitacin is cucurbitacin A, cucurbitacin B, cucurbitacin C, cucurvitacin D, cucurvitacin E, cucurvitacin F, cucurvitacin G, cucurbita Shin H, Cucurbitacin I, Cucurvitacin J, Cucurvitacin K, Cucurvitacin L, Cucurvitacin O, Cucurvitacin P, Cucurvitacin Q, Cucurvitacin R , Cucurbitacin S or cucurbitacin T, but is not limited thereto.

The amino acid sequence of SEQ ID NO: 1 is as follows:

MGTMNYMQHLQIVSTETIKPSSPTPPNLNTHTLSLFDQLAPHIFVPLVFFFSHHGHGSGTCVQLLRRSLSMTLSRYYPFAGRIKDNVSVDCNDEGVTFVEARLEGVTVSEILENPRSEIVEVLFVDGLQWKDSKIGALLKVQITFFECGGLSIGVMLSHRLGDLATLVKFVKDWAVVTRNSGFGEEIVNPLFNSADLFPHGDLPAMSGAVVEEGNFTCKRFVFEGSKIVSLKNRISEKVENPSRVEVVSALIYKAIISASRNSQNHPTLLLQTLNLRKRVAPPLPESLVGSLVSFFPVGVGGEREVIELHELVGTMRKEMGEFCNKYAKKYRTKEWPELIKRRLNESREILSKNGNNQLVYRFSSGCNFPIYEVDFGWGAADWVTVAAFKMKNTVMMLDAKNGGGIEALVSLQDHEMAAFQHNQELLAFASLNPSAN (SEQ ID NO: 1).

The protein of the present invention may be derived from nature, or may be synthesized using known protein synthesis methods, for example, by genetic engineering methods or chemical synthesis methods.

The protein of the present invention includes proteins consisting of the above-described amino acid sequences, as well as variants of amino acid sequences thereof, which are also included in the scope of the present invention. Variant of the protein of the present invention means a protein in which one or more amino acid residues in the amino acid sequence of the present invention have different sequences by deletion, insertion, non-conservative or conservative substitution, substitution of amino acid analogs, or a combination thereof. In some cases, the protein of the present invention may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, etc. .

In addition, the protein of the present invention includes proteins consisting of the amino acid sequence of SEQ ID NO: 1 and functional equivalents thereof.

The term 'functional equivalent' means having at least 70% or more, preferably 80% or more, more preferably 90% or more, more preferably 95% or more of sequence homology with the amino acid sequence of SEQ ID NO: 1, Refers to a protein consisting of the amino acid sequence of SEQ ID NO: 1 and substantially physiological activity. 'Substantially homogeneous physiological activity' refers to the activity of acetylating a compound.

In addition, the present invention provides a nucleic acid molecule encoding a protein consisting of the amino acid sequence of SEQ ID NO: 1 of the present invention.

As described above, the sequence of the nucleic acid molecule encoding the protein of the present invention may be modified by substitution, deletion, insertion, or a combination thereof, as long as one or more nucleic acid bases encode a protein having equivalent functions.

The protein consisting of the amino acid sequence of SEQ ID NO: 1 of the present invention is preferably encoded by a nucleic acid molecule having the nucleotide sequence of SEQ ID NO: 2. The nucleic acid molecule sequence may be single chain or double chain, and may be a DNA molecule or an RNA (mRNA) molecule.

The base sequence of SEQ ID NO: 2 is as follows:

ATGGGGACGATGAATTACATGCAACACCTTCAAATTGTTTCAACAGAAACCATTAAACCTTCTTCTCCAACTCCTCCAAATCTCAACACTCATACCCTCTCCCTCTTCGATCAGCTAGCCCCCCACATTTTCGTGCCTCTCGTGTTCTTCTTCTCCCACCACGGTCACGGTTCGGGTACTTGCGTCCAATTGCTTCGACGATCTCTTTCTATGACTCTATCTCGGTACTACCCATTTGCGGGTAGGATTAAAGACAACGTCTCGGTTGACTGTAACGATGAGGGGGTGACTTTTGTGGAGGCTCGGCTCGAGGGCGTGACGGTGTCGGAGATTTTGGAAAACCCTAGAAGTGAGATTGTGGAAGTGTTATTTGTTGATGGGTTGCAATGGAAAGATTCAAAAATTGGAGCTTTGTTGAAGGTTCAAATAACGTTTTTTGAATGTGGAGGATTGAGCATTGGAGTGATGCTGTCTCACAGGCTTGGGGATTTGGCAACGTTAGTGAAGTTCGTAAAAGATTGGGCAGTCGTGACTCGAAACAGCGGTTTTGGGGAAGAAATTGTAAACCCGCTTTTTAACTCTGCGGATTTGTTCCCCCACGGCGACTTACCCGCCATGTCCGGCGCCGTGGTTGAAGAAGGAAATTTCACGTGCAAGAGGTTCGTATTCGAAGGTTCAAAGATTGTATCCCTAAAAAATAGGATTTCAGAGAAGGTGGAGAATCCATCTCGAGTGGAAGTTGTGTCAGCATTAATTTACAAAGCCATCATTTCAGCTTCGCGAAATTCCCAAAACCACCCCACACTGTTGTTACAAACACTAAATTTACGTAAAAGGGTGGCGCCGCCGCTGCCGGAAAGTTTAGTGGGAAGTTTAGTGTCATTCTTCCCGGTGGGTGTGGGCGGAGAAAGAGAAGTAATAGAGCTGCATGAGTTGGTGGGTACAATGAGAAAAGAAATGGGAGAGTTTTGTAACAAATACGCCAAAAAGTACAGAACAA AAGAGTGGCCTGAATTGATAAAAAGACGATTAAATGAATCGAGAGAAATTTTGAGCAAAAATGGGAATAATCAATTGGTTTATAGATTTAGCAGTGGATGCAATTTTCCAATTTATGAAGTGGATTTTGGGTGGGGAGCGGCGGATTGGGTTACTGTGGCGGCGTTTAAGATGAAAAACACCGTAATGATGTTGGACGCCAAAAATGGCGGCGGAATTGAAGCTTTGGTCAGTTTACAAGACCACGAAATGGCTGCCTTCCAACACAATCAGGAGCTTCTTGCTTTTGCTTCTTTGAACCCAAGTGCCAATTAA (SEQ ID NO: 2).

As long as the sequence of the nucleic acid molecule encodes a protein having equivalent functions, at least one nucleic acid base may be changed by substitution, deletion, insertion, or a combination thereof. In addition, homologs of the nucleic acid molecule sequence may be included within the scope of the present invention. The nucleic acid molecule may include a base sequence having a sequence homology of at least 70% with SEQ ID NO: 2, preferably at least 80%, more preferably at least 90%, most preferably at least 95%. The '% of sequence homology' of a nucleic acid molecule is identified by comparing two optimally aligned sequences with a comparison region, and a portion of the nucleic acid molecule sequence in the comparison region is added or deleted compared to the reference sequence for the optimal arrangement of the two sequences That is, it may include a gap.

The nucleic acid molecule sequence encoding the protein of the present invention can be isolated from nature or artificially produced through synthetic or genetic recombination methods. For example, the nucleic acid molecule sequence may be derived from a watermelon plant.

The protein of the present invention can be provided by operatively linking the aforementioned nucleic acid molecule sequence to a vector capable of expressing it.

Furthermore, the present invention provides a recombinant expression vector comprising the nucleic acid molecule.

In the present invention, the term, “recombinant expression vector” is a vector capable of expressing a target protein or a target RNA in a suitable host cell, and can be produced using genetic recombination techniques well known in the art.

Recombinant expression vectors of the present invention include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors and viral vectors. The expression vector of the present invention includes a signal sequence or a leader sequence for membrane targeting or secretion in addition to expression control elements such as a promoter, an operator, an initiation codon, a termination codon, a polyadenylation signal and an enhancer, and can be variously prepared according to the purpose .

In addition, the present invention provides a transformant in which the recombinant expression vector is transformed into a host cell.

Transformation is a method of introducing a nucleic acid into an organism, cell, tissue or organ, and can be performed by selecting a suitable standard technique according to a host cell as is known in the art. For example, microprojectile bombardment, electroporation, protoplast fusion, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, agitation with silicon carbide fibers, agrobacteria mediated Transformation, PEG-mediated fusion, PEG-mediated fusion, microinjection, liposome-mediated method, dextran sulfate, lipofectamine, thermal shock, etc., but are not limited thereto. .

The term 'transformant' means a prokaryotic or eukaryotic cell comprising a heterologous nucleic acid molecule introduced into a cell.

As the transformant, the expression level of the protein is different depending on the host cell, it is possible to select and use the most suitable host cell for the purpose of those skilled in the art. The host cell is Escherichia coli (E. coli, Escherichia coli), Bacillus subtilis (Bacillus subtilis), Streptomyces (Streptomyces), Pseudomonas (Pseudomonas), Proteus Mira Billy's (Proteus mirabilis) or Staphylococcus ( Staphylococcus ), fungi, yeast, Saccharomyces cerevisiae , insect cells, plant cells, mammals, but are not limited thereto.

Preferably, the host cell of the present invention may be Escherichia coli (E. coli, Escherichia coli ), and the Escherichia coli strain may include Rosetta2 (DE3), C41 (DE3), SoluBL21, BL21a1, etc. It is not limited to this.

Furthermore, the present invention provides a method for producing a protein consisting of the amino acid sequence of SEQ ID NO: 1.

Method for producing a protein consisting of the amino acid sequence of SEQ ID NO: 1 of the present invention, culturing the aforementioned transformant; And isolating the protein. Specifically, the method for producing a protein consisting of the amino acid sequence of SEQ ID NO: 1 of the present invention comprises: culturing the transformant in a culture medium and inducing expression of the protein; Sedimenting the cells from the protein-derived culture medium using a centrifuge, and crushing the cells using a sonicator; And recovering the supernatant by centrifuging the crushed cells to separate the His-tag protein.

The present invention provides a composition for acetylation of a compound or a derivative thereof containing the protein of the present invention.

The composition comprising the protein of the present invention may acetylate at least one hydroxy group contained in a triphenoid-based compound or derivative thereof, particularly a steroid-based compound or derivative thereof.

The steroid-based compound may be cucurbitacin, ecdysone, cortisol, or estriol, and the cucurbitacin may be cucurvitacin A, cucurvitacin B, cucurvitacin C, cucurvitacin D, Cucurbitacin E, Cucurvitacin F, Cucurvitacin G, Cucurvitacin H, Cucurvitacin I, Cucurvitacin J, Cucurvitacin K, Cucurvitacin L, Cucur Vitacin O, Cucurvitacin P, Cucurvitacin Q, Cucurvitacin R, Cucurvitacin S or Cucurvitacin T, but is not limited thereto.

The composition comprising the protein of the present invention can specifically acetylate the hydroxy group bound to carbon 16 of the cucurbitacin B, cucurbitacin D, cucurbitacin E or cucurbitacin I have. When using the composition containing the protein of the present invention, unlike the case of synthesizing a derivative by a method of attaching an acetyl group by a chemical method, there is an advantage that only the acetylated product at a desired position can be synthesized with high efficiency. That is, by using the composition containing the protein of the present invention, it is possible to obtain an acetylated derivative at a specific position of the compound, so there is no need to go through the separation and purification process to obtain the desired compound, which has advantages in terms of cost and process. have.

In addition, the present invention provides a method for acetylating a triphenoid-based compound, particularly a steroid-based compound or a derivative thereof, using the above-described protein or composition comprising the same.

For example, a method for acetylating a steroid-based compound comprises reacting a composition comprising a protein of the invention with a steroid-based compound or derivative thereof. The steroid-based compound may be cucurbitacin, ecdysone, cortisol, or estriol, as described above, but is not limited thereto.

The steroid-based compound may be cucurbitacin B, and its structure is represented by Formula 3 below:

[Formula 3]

.

.

Through the reaction, a hydroxy group bound to carbon 16 of the cucurbitacin B may be acetylated, and a compound hydroxy group bound to carbon 16 of the cucurbitacin B is acetylated (hereinafter referred to as cucur) Lebitacin BU) is represented by the following formula (4):

[Formula 4]

.

.

 The steroid-based compound may be cucurbitacin D, and the structure is as follows:

[Formula 5]

.

.

Through the reaction, a hydroxy group bound to carbon 16 of the cucurbitacin D may be acetylated, and a compound hydroxy group bound to carbon 16 of the cucurbitacin D is acetylated (hereinafter referred to as cucur) Lebitacin DU) is represented by the following formula (6):

[Formula 6]

.

.

 The steroid-based compound may be cucurbitacin E, and its structure is represented by Formula 7 below:

[Formula 7]

.

.

Through the reaction, a hydroxy group bound to carbon 16 of the cucurbitacin E may be acetylated, and a compound hydroxy group bound to carbon 16 of the cucurbitacin E is acetylated (hereinafter referred to as cucur) Lebitacin EU) has the following formula (8):

[Formula 8]

.

.

 The steroid-based compound may be cucurbitacin I, and the structure is as follows:

[Formula 9]

.

.

Through the reaction, a hydroxy group bound to carbon 16 of the cucurbitacin I may be acetylated, and a compound hydroxy group bound to carbon 16 of the cucurbitacin I is acetylated (hereinafter referred to as cucur) Lebitacin IU) has the following formula (10):

[Formula 10]

.

.

Through the reaction, at least one hydroxyl group included in the ecdysone may be acetylated. For example, through the reaction, at least one of hydroxy groups bound to carbons 2, 3, 14, 22 or 25 of ecdysone may be acetylated.

The structure of the ecdysone is as follows:

[Formula 11]

.

.

Through the reaction, at least one hydroxyl group included in the cortisol may be acetylated. For example, through the reaction, at least one of hydroxy groups bound to carbons 11, 17, or 21 of cortisol may be acetylated.

The structure of the cortisol is the following formula 12:

[Formula 12]

.

.

Through the reaction, at least one hydroxyl group included in the estriol may be acetylated. For example, through the reaction, at least one of hydroxy groups bound to carbons 3, 16 or 17 of estriol may be acetylated.

The structure of the estriol is represented by the following formula (13):

[Formula 13]

.

.

Furthermore, the present invention can provide an acetylated compound obtained through a reaction using a protein consisting of the amino acid sequence of SEQ ID NO: 1 or a functional equivalent thereof.

The acetylated compound of the present invention may be a compound in which at least one hydroxy group bound to carbon of a steroid-based compound and a derivative thereof is acetylated.

For example, the acetylated compound may be a compound in which a hydroxy group bound to carbon 16 of cucurbitacin is acetylated, for example, cucurbitacin BU, cucurbitacin DU, cucurbita New EU, or cucurbitacin IU, but is not limited thereto.

Further, the acetylated compound may be a compound in which at least one hydroxyl group of ecdysone, cortisol, estriol, or a derivative thereof is acetylated, but is not limited thereto.

Hereinafter, examples will be described in detail to specifically describe the present invention.

[Example]

1. Production of a protein consisting of the amino acid sequence of SEQ ID NO: 1 (acetyltransferase 3; ACT3)

Total RNA was extracted from watermelon (citrullus spp.) Plants, and complementary DNA (cDNA) was prepared using oligo-dT prime and reverse transcription enzyme. Using the prepared cDNA as a template, a polynucleotide encoding ACT3 was amplified by polymerase chain reaction (PCR) using forward primer, reverse primer, and pfu DNA polymerase, and the polynucleotide was separated by gel electrophoresis. And purified. The sequence of the forward primer is the same as SEQ ID NO: 3 (CAAATGGGTCGCGGATCCATGGAGTCAGCATTGAAA), which is a sequence containing the start codon of the polynucleotide encoding ACT3 and the BamH1 restriction enzyme base sequence (GGATCC). The sequence of the reverse primer is the same as SEQ ID NO: 4 (GTGGTGGTGGTGCTCGAGGTGTTGGAGCTGAAGAAC), which is a sequence containing the Xho1 restriction enzyme base sequence (CTCGAG) excluding the termination codon.

The purified polynucleotide encoding ACT3 was cloned into a pET28a (+) recombinant expression vector by infusion cloning.

After transforming the cloned ACT3 recombinant expression vector into the protein expression E. coli BL21a1, mixing with 1 mM IPTG (isopropyl β-D-1-thiogalactopyranoside) in LB (lysogeny broth) culture solution at 180 ° C. at 180 ° C. for ACT3 Expression was induced.

After ACT3 induced culture (2 liters) was centrifuged using a centrifuge to precipitate BL21a1 cells, the precipitated BL21a1 cells were suspended in binding buffer (20mM sodium phosphate, 0.5M NaCl, pH7.4), BL21a1 cells were crushed using a sonicator. After centrifugation of the crushed BL21a1 cell, the supernatant was recovered, His-tag ACT3 was separated using Ni sepharose, and washed with binding buffer, followed by Elution buffer (350 ~ 500mM imidazole, 20mM sodium phosphate, 0.5M NaCl, pH7.4) to recover the ACT3 solution.

The recovered ACT3 solution was concentrated using 30KDa cut off centricon, exchanged with storage buffer (10% glycerol, 50mM sodium phosphate, 0.1M sodium citrate, pH 7.4) and stored at -80 ° C for use.

2. ACT3 enzyme reaction

Cucurvitacin B (hereinafter referred to as CuB), Cucurvitacin D (hereinafter referred to as CuD), Cucurvitacin E (hereinafter referred to as CuE), Cucurvitacin I (hereinafter referred to as CuI), Ecdyson respectively , Cortisol and estriol, 400 μM of acetyl-CoA (aceryl coenzyme A) and 40 μg of ACT3 were added to the enzyme reaction buffer (50 mM sodium phosphate buffer, pH7.4) and then enzymatically reacted at 30 ° C. for 1 hour. Each reacted product was fractionated with 100% etyl acetate, the fraction solution was dried with a centrifugal vacuum concentrator, and each was dissolved in 120 μl of 100% methanol and used as an analysis sample.

Samples for analysis obtained from the results obtained by the reaction of each substrate (CuB, CuD, CuE, CuI, ecdysone, cortisol, or estriol) with ACT3 are shown in Table 1 below.

Sample 1 Sample 2 Sample 3 Sample 4 Sample 5 Sample 6 Sample 7 CuB + ACT3 enzyme reaction product CuD + ACT3 enzyme reaction product CuE + ACT3 enzyme reaction product CuI + ACT3 enzyme reaction product Ecdysone
+ ACT3 enzyme reaction product Cortisol
+ ACT3 enzyme reaction product Estriol
+ ACT3 enzyme reaction product

3. High performance liquid chromatography (HPLC) analysis of enzyme reaction results

To confirm the results of the ACT3 enzyme reaction, each sample in Table 1 was analyzed using high performance liquid chromatography (HPLC).

Prior to the analysis of the sample, the retention time for the standard form of each sample was checked. The standard foam is a material used as a substrate for each sample, specifically, the standard foam of sample 1 is CuB, the standard foam of sample 2 is CuD, the standard foam of sample 3 is CuE, the standard foam of sample 4 is CuI, and sample 5 The standard form of Edison, the standard form of Sample 6 is cortisol, and the standard form of Sample 7 is estriol.

The conditions of the HPLC used for the analysis of the enzyme reaction product are shown in Table 2 below.

Condition equipment Pump, autosampler, UV detector (Shimadzu, Japan) column Syncronis C18, 250 × 4.6mn (Thermo Scientific, USA) Solvent condition A solvent: 100% acetonitrile, 0.1% formic acid
B solvent: water, 0.1% formic acid
Linear gradient:
30% A solvent, 70% B solvent (5min)
70% A solvent, 30% B solvent (20 ~ 30min)
30% A solvent, 70% B solvent (40 ~ 45min)
Flow rate: 1ml / min Detection wavelength 230nm

Samples 1 to 7 were analyzed through HPLC, and it was confirmed that peaks of other retention times were detected, in addition to peaks such as retention time for the standard form of each sample. Through this, it was confirmed that the enzyme reaction occurred by ACT3. Could.

HPLC results for the standard form and sample of each sample are shown in Figures 1-7.

4. LC-MS (liquid chromatography-mass spectrometry) analysis of the enzyme reaction result

LC-MS analysis was performed to find the molecular weight of the newly detected substance according to HPLC analysis.

The conditions of LC-MS used for molecular weight analysis of the enzyme reaction product are shown in Table 3 below.

Condition equipment ACQUITY UPLC system, SYNAPT G2-Si HDMS (Waters) Column

Waters Acquity BEH C18 1.7 μm (2.1 x 100mm)
column temp .: 40

Solvent condition A solvent: water, 0.1% formic acid
B solvent: 100% acetonitrile, 0.1% formic acid
Linear gradient:
95% A solvent, 5% B solvent (initial)
95% A solvent, 5% B solvent (2.5min)
30% A solvent, 70% B solvent (5.0min)
30% A solvent, 70% B solvent (9.0min)
0% A solvent, 100% B solvent (9.5min)
0% A solvent, 100% B solvent (10.5min)
95% A solvent, 5% B solvent (11min)
95% A solvent, 5% B solvent (12min)
Flow rate: 0.3ml / min Detection wavelength 230nm Mass spectrometry conditions Mode: ESI (-)
Capillary voltage: 2 kV
Source temp: 400 ^o C
Sampling cone: 10
Desolvation Gas Flow (L / hr): 900.0

Table 4 below shows the LC-MS values of the standard form and enzyme reaction products of each sample.

Standard Form of Sample 1 (CuB) Standard Form of Sample 2
(CuD) Standard Form of Sample 3 (CuE) Standard Form of Sample 4 (CuI) LC-MS value 603.3170 561.3064 601.3013 559.2908 Sample 1 (CuB-U) Sample 2 (CuD-U) Sample 3 (CuE-U) Sample 4 (CuI-U) LC-MS value 645.3275 603.3170 643.3119 601.3013

In addition, 1H-NMR (600 MHz, CD3OD, δH) and 13C-NMR (150 MHz, CD3OD, δC) analysis were additionally performed. 1H-NMR data and 13C-NMR data of each enzyme reaction product are shown in FIGS. 8 to 16.

 Through NMR analysis, the CuB + ACT3 enzymatic reaction product contained in Sample 1 is CuB-U (structure of Chemical Formula 4) (see FIGS. 8 and 9), and the CuD + ACT3 enzymatic reaction product contained in Sample 2 is CuD-U (Structure of Chemical Formula 6) (see FIGS. 10 and 11), and the CuE + ACT3 enzymatic reaction product included in Sample 3 is CuE-U (Structure of Chemical Formula 8) (see FIGS. 12 and 13), and included in Sample 4 It was confirmed that the CuI + ACT3 enzymatic reaction product was CuI-U (structure of Chemical Formula 10) (see FIGS. 14 and 15).

According to the analysis results, it was confirmed that the hydroxy group contained in the steroid-based compound can be acetylated using ACT3 of the present invention.

<110> SEJONG UNIVERSITY INDUSTRY ACADEMY COOPERATION FOUNDATION <120> Novel protein and uses thereof <130> 19P02014 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 437 <212> PRT <213> Artificial Sequence <220> <223> ACT3 <400> 1 Met Gly Thr Met Asn Tyr Met Gln His Leu Gln Ile Val Ser Thr Glu   1 5 10 15 Thr Ile Lys Pro Ser Ser Pro Thr Pro Pro Asn Leu Asn Thr His Thr              20 25 30 Leu Ser Leu Phe Asp Gln Leu Ala Pro His Ile Phe Val Pro Leu Val          35 40 45 Phe Phe Phe Ser His His Gly His Gly Ser Gly Thr Cys Val Gln Leu      50 55 60 Leu Arg Arg Ser Leu Ser Met Thr Leu Ser Arg Tyr Tyr Pro Phe Ala  65 70 75 80 Gly Arg Ile Lys Asp Asn Val Ser Val Asp Cys Asn Asp Glu Gly Val                  85 90 95 Thr Phe Val Glu Ala Arg Leu Glu Gly Val Thr Val Ser Glu Ile Leu             100 105 110 Glu Asn Pro Arg Ser Glu Ile Val Glu Val Leu Phe Val Asp Gly Leu         115 120 125 Gln Trp Lys Asp Ser Lys Ile Gly Ala Leu Leu Lys Val Gln Ile Thr     130 135 140 Phe Phe Glu Cys Gly Gly Leu Ser Ile Gly Val Met Leu Ser His Arg 145 150 155 160 Leu Gly Asp Leu Ala Thr Leu Val Lys Phe Val Lys Asp Trp Ala Val                 165 170 175 Val Thr Arg Asn Ser Gly Phe Gly Glu Glu Ile Val Asn Pro Leu Phe             180 185 190 Asn Ser Ala Asp Leu Phe Pro His Gly Asp Leu Pro Ala Met Ser Gly         195 200 205 Ala Val Val Glu Glu Gly Asn Phe Thr Cys Lys Arg Phe Val Phe Glu     210 215 220 Gly Ser Lys Ile Val Ser Leu Lys Asn Arg Ile Ser Glu Lys Val Glu 225 230 235 240 Asn Pro Ser Arg Val Glu Val Val Ser Ala Leu Ile Tyr Lys Ala Ile                 245 250 255 Ile Ser Ala Ser Arg Asn Ser Gln Asn His Pro Thr Leu Leu Leu Gln             260 265 270 Thr Leu Asn Leu Arg Lys Arg Val Ala Pro Pro Leu Pro Glu Ser Leu         275 280 285 Val Gly Ser Leu Val Ser Phe Phe Pro Val Gly Val Gly Gly Glu Arg     290 295 300 Glu Val Ile Glu Leu His Glu Leu Val Gly Thr Met Arg Lys Glu Met 305 310 315 320 Gly Glu Phe Cys Asn Lys Tyr Ala Lys Lys Tyr Arg Thr Lys Glu Trp                 325 330 335 Pro Glu Leu Ile Lys Arg Arg Leu Asn Glu Ser Arg Glu Ile Leu Ser             340 345 350 Lys Asn Gly Asn Asn Gln Leu Val Tyr Arg Phe Ser Ser Gly Cys Asn         355 360 365 Phe Pro Ile Tyr Glu Val Asp Phe Gly Trp Gly Ala Ala Asp Trp Val     370 375 380 Thr Val Ala Ala Phe Lys Met Lys Asn Thr Val Met Met Leu Asp Ala 385 390 395 400 Lys Asn Gly Gly Gly Ile Glu Ala Leu Val Ser Leu Gln Asp His Glu                 405 410 415 Met Ala Ala Phe Gln His Asn Gln Glu Leu Leu Ala Phe Ala Ser Leu             420 425 430 Asn Pro Ser Ala Asn         435 <210> 2 <211> 1314 <212> DNA <213> Artificial Sequence <220> <223> ACT3 <400> 2 atggggacga tgaattacat gcaacacctt caaattgttt caacagaaac cattaaacct 60 tcttctccaa ctcctccaaa tctcaacact cataccctct ccctcttcga tcagctagcc 120 ccccacattt tcgtgcctct cgtgttcttc ttctcccacc acggtcacgg ttcgggtact 180 tgcgtccaat tgcttcgacg atctctttct atgactctat ctcggtacta cccatttgcg 240 ggtaggatta aagacaacgt ctcggttgac tgtaacgatg agggggtgac ttttgtggag 300 gctcggctcg agggcgtgac ggtgtcggag attttggaaa accctagaag tgagattgtg 360 gaagtgttat ttgttgatgg gttgcaatgg aaagattcaa aaattggagc tttgttgaag 420 gttcaaataa cgttttttga atgtggagga ttgagcattg gagtgatgct gtctcacagg 480 cttggggatt tggcaacgtt agtgaagttc gtaaaagatt gggcagtcgt gactcgaaac 540 agcggttttg gggaagaaat tgtaaacccg ctttttaact ctgcggattt gttcccccac 600 ggcgacttac ccgccatgtc cggcgccgtg gttgaagaag gaaatttcac gtgcaagagg 660 ttcgtattcg aaggttcaaa gattgtatcc ctaaaaaata ggatttcaga gaaggtggag 720 aatccatctc gagtggaagt tgtgtcagca ttaatttaca aagccatcat ttcagcttcg 780 cgaaattccc aaaaccaccc cacactgttg ttacaaacac taaatttacg taaaagggtg 840 gcgccgccgc tgccggaaag tttagtggga agtttagtgt cattcttccc ggtgggtgtg 900 ggcggagaaa gagaagtaat agagctgcat gagttggtgg gtacaatgag aaaagaaatg 960 ggagagtttt gtaacaaata cgccaaaaag tacagaacaa aagagtggcc tgaattgata 1020 aaaagacgat taaatgaatc gagagaaatt ttgagcaaaa atgggaataa tcaattggtt 1080 tatagattta gcagtggatg caattttcca atttatgaag tggattttgg gtggggagcg 1140 gcggattggg ttactgtggc ggcgtttaag atgaaaaaca ccgtaatgat gttggacgcc 1200 aaaaatggcg gcggaattga agctttggtc agtttacaag accacgaaat ggctgccttc 1260 caacacaatc aggagcttct tgcttttgct tctttgaacc caagtgccaa ttaa 1314 <210> 3 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> ACT3_forward primer <400> 3 caaatgggtc gcggatccat ggagtcagca ttgaaa 36 <210> 4 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> ACT3_reverse primer <400> 4 gtggtggtgg tgctcgaggt gttggagctg aagaac 36

Claims (14)

Protein consisting of the amino acid sequence of SEQ ID NO: 1.
A nucleic acid molecule encoding the protein of claim 1.
The method according to claim 2, The nucleic acid molecule is a nucleic acid molecule consisting of the nucleotide sequence of SEQ ID NO: 2.
Recombinant expression vector comprising the nucleic acid molecule of claim 2.
A transformant in which the recombinant expression vector of claim 4 is transformed into a host cell.
A composition for acetylation of a steroid-based compound or a compound derivative comprising the protein of claim 1.
The composition for acetylation of a steroid-based compound or the compound derivative of claim 6, wherein the steroid-based compound is one of cucurbitacin, ecdysone, cortisol, or estriol.
The composition for acetylation of a steroid-based compound or the compound derivative according to claim 7, wherein the cucurbitacin is one of cucurbitacin B, cucurbitacin D, cucurbitacin E or cucurvitacin I.
The composition for acetylation of a steroid-based compound or the compound derivative according to claim 6, wherein the steroid-based compound is cucurbitacin, and the protein acetylates the hydroxy group of carbon 16 of the cucurvitacin.
Culturing the transformant of claim 5; And
Protein production method consisting of the amino acid sequence of SEQ ID NO: 1 comprising the step of separating the protein from the culture of the transformant.
A method for acetylating a steroid-based compound or a compound derivative comprising reacting a composition comprising the protein of claim 1 with a steroid-based compound or the compound derivative.
The method of claim 11, wherein the steroid-based compound is one of cucurbitacin, ecdysone, cortisol, or estriol.
The method for acetylating a steroid-based compound or the compound derivative according to claim 12, wherein the cucurbitacin is one of cucurbitacin B, cucurbitacin D, cucurbitacin E, or cucurbitacin I.
The method according to claim 13, wherein the cure-based compound for acetylating a hydroxy group bound to carbon 16 of the quercusitacin B, the quercusitacin D, the quercusitacin E or the quercusitacin I or the Method for acetylation of compound derivatives.

Images