KR102097040B1 - Antibiotic peptides targeting toxin-antitoxin system of Streptococcus pneumoniae and use thereof - Google Patents

Abstract

The present invention relates to an antibiotic peptide targeting the toxin-antitoxin system of pneumococcus and uses thereof, and specifically, the antibiotic peptide of the present invention is to form a toxin-antitoxin complex of pneumococci without affecting the active site of the toxin. Inhibition, thereby inducing the death of pneumococcus by RNA decomposition activity of the isolated toxin, and also exhibits antibiotic activity against other bacteria, so it can be usefully used as an antibiotic composition.

Description

Antibiotic peptides targeting toxin-antitoxin system of Streptococcus pneumoniae and use thereof}

The present invention relates to an antibiotic peptide targeting the toxin-antitoxin system of Streptococcus pneumoniae and its use.

Streptococcus pneumoniae is a gram-positive and conditional anaerobic bacterium that is a major pathogen for otitis media, sinusitis, pneumonia, and meningitis, and is usually inhaled by the respiratory tract to stay in the pharynx and nasal cavity While causing illness. In order to remove pneumococcus and relieve symptoms of the above diseases, glycopeptide antibiotics such as vancomycin and penicillin have been mainly used, but pneumococci having resistance to existing antibiotics are continuously being used. With the emergence, new strategies for developing antibiotics are emerging.

Bacteria generally have a toxin-antitoxin system, which plays an important role in physiological processes such as gene regulation, growth, survival and apoptosis. In a normal growth environment, the toxin and its anti-toxin form a stable complex, but under stress, the unstable anti-toxin decomposes to release free toxins. The released toxin exhibits toxicity by inhibiting DNA replication, protein synthesis, cell wall synthesis, and the like by decomposing RNA of host cells or binding to topoisomerase or ribosomes.

The toxin-antitoxin system is classified into six types (type I to VI) depending on how the antitoxin inhibits the toxicity of the toxin. In the type I system, antitoxin is an antisense RNA capable of binding to toxin mRNA, and the translation of toxins is inhibited. In the type II system, toxins and antitoxins in the form of proteins combine with each other to form a non-toxic protein complex. In the type III system, the anti-toxin in the form of RNA directly binds to the toxin protein to form a non-toxic RNA-protein complex. In the type IV system, the toxin and anti-toxin do not bind to each other, and compete against the same cell target. In the type V system, the antitoxin in the form of protein degrades toxin mRNA, and in the type VI system, the antitoxin in the form of protein delivers the toxin protein to the intracellular protease to induce the degradation of the toxin protein (Ki-Young Lee et al. , Toxins) , 8 (10), 2016).

Pneumococci have several toxin-antitoxin systems, of which the HicBA toxin-antitoxin system is a type II system. If the formation of the toxin-antitoxin complex can be artificially suppressed, the toxin-antitoxin system can be an attractive target for the development of new antibiotics, because the toxin with toxicity cannot be neutralized and the cells eventually die.

An object of the present invention is to provide a composition containing an antibiotic peptide targeting the toxin-antitoxin system of pneumococci and an active ingredient thereof.

In order to achieve the above object, the present invention provides an antibiotic peptide that is composed of any one amino acid sequence of SEQ ID NOs: 1 to 4 and inhibits the formation of the HicBA complex, a toxin-antitoxin conjugate of pneumococcus.

In addition, the present invention provides an antibiotic composition containing the antibiotic peptide as an active ingredient.

In addition, the present invention provides a quasi-drug for antibiotics containing the antibiotic peptide as an active ingredient.

In addition, the present invention provides an external preparation for antibiotic containing the antibiotic peptide as an active ingredient.

The antibiotic peptide of the present invention inhibits the formation of the toxin-antitoxin complex of pneumococcus without affecting the active site of the toxin, thereby inducing pneumococcal death by RNA decomposition activity of the isolated toxin, and other bacteria Since it also exhibits antibiotic activity, it can be usefully used as a composition for antibiotics.

1 is a heterodimer of the hetero-tetramer (A), hetero-octamer (B) and heterodimer (C) structure of the Pneumoniae ( S. pneumoniae ) HicBA protein complex, and Y. pestis HicBA protein complex Structure (D), pneumococcal HicB protein tetramer structure (E), and pneumococcal and pestic HicB protein structure comparison (F and G). It represents the C-terminal DNA-binding domain region that is not present in the fungal HicB protein and only present in the Pneumococcal HicB protein).
FIG. 2 is a diagram showing the results of size exclusion chromatography analysis in which multi-angle light scattering (MALS) of HicBA protein complex (A) and HicB protein (B) of pneumococcus is combined.
Figure 3 is a diagram showing the results of analyzing the secondary structure of HicB protein (A) and HicA protein (B) of Pest bacteria ( Y. pestis ) and pneumococci ( S. pneumoniae ).
4 is a graph showing the results of measuring RNA decomposition activity of HicA protein of pneumococcus and VapC26 and VapC30 proteins of Mycobacterium tuberculosis.
Figure 5 is the result of aligning the amino acid sequence of the pneumococcal HicA protein with amino acid sequences such as other HicA protein (A), the RNA decomposition site of the pneumococcal HicA protein and the interaction of the surrounding residues with the HicB protein (B) , And the results of comparing the structure of the pneumococcal HicA protein with the structure of other HicA proteins (C) (A: residues indicated by red circles indicate residues essential for RNA degradation activity; B: black dotted line Refers to the hydrogen bond and salt bridge between each residue; C: yellow circle indicates the site with residues essential for RNA degradation activity).
6 is a view showing the electrostatic surface potential (A and B) of the HicA protein of pneumococcus and the double-stranded RNA binding domain surface portion (A) of the RNA-coupled HicA protein.
7 is a graph comparing the RNA decomposition activity of the protein (H36A) in which the histidine 36 of pneumococcal HicA protein with alanine is compared with the RNA decomposition activity of the HicA protein (A) and E. coli expressing these proteins or HicBA protein complex It is a growth curve (B).
Figure 8 shows the results of the hydrophobic (A) and hydrophilic (B) interaction of the pneumococcal HicB protein and HicA protein, and confirms whether the cytotoxicity of E. coli expressing the complex of the HicB protein mutant and the HicA protein (C) (B: black dotted line means hydrogen bond and salt bridge, and the inserted table shows each base involved in the interaction).
Figure 9 shows the RNA decomposition activity (A) of the HicBA protein complex to which peptides I to IV were added, and the RNA decomposition activity when peptides II to IV were added with 100% of RNA decomposition activity when peptide I was added (B ), And circular dichroism (C) of each peptide.
FIG. 10 shows HicBA protein complex, HicBA protein complex to which peptide I is added, and RNA decomposition activity (A) of HicA protein, and RNA decomposition activity of HicBA protein complex alone to 0%, and RNA decomposition activity of HicA protein alone is 100 It is a diagram showing the RNA decomposition activity (B) of the HicBA protein complex to which peptide I was added in%.

Hereinafter, the present invention will be described in detail.

The present invention provides an antibiotic peptide consisting of the amino acid sequence of any one of SEQ ID NOs: 1 to 4 and inhibiting the formation of the HicBA complex, a toxin-antitoxin conjugate of pneumococcus.

The peptide corresponds to amino acid residues 56-66 of HicA, a pneumococcal toxin protein, and may inhibit the α2 region consisting of the amino acid sequence of SEQ ID NO: 5 from binding to the antitoxin protein HicB.

The peptide may not affect the activity of pneumococcal toxin.

The peptides include pneumococcus, Bacillus subtilis , Staphylococcus aureus , epidermis, S. epidermidis , Escherichia coli , Shigella dysenteriae , Salmonella typhimurium, Salmonella typhimurium , Pneumococcal pneumoniae ( Klebsiella pneumoniae ) and Pseudomonas aeruginosa ( Pseudomonas aeruginosa ) may be one that exhibits antibiotic activity against any one or more selected from the group consisting of.

The peptide may be synthesized by a conventional chemical synthesis method (WH Freeman and Co., Proteins; structures and molecular principles, 1983) in the art, specifically, liquid phase peptide synthesis (Solution Phase Peptide synthesis), solid phase peptide synthesis ( solid-phase peptide syntheses), fragment condensation and F-moc or T-BOC chemistry, and more specifically, solid-phase peptide synthesis.

In addition, the peptide of the present invention can be prepared by the following genetic engineering method. First, a DNA sequence encoding the peptide is prepared according to a conventional method. DNA sequences can be prepared by amplifying by polymerase chain reaction (PCR) using appropriate primers. Alternatively, DNA sequences may be synthesized by standard methods known in the art, for example, using an automatic DNA synthesizer (eg, a product of Biosearch or Applied Biosystems).

The DNA sequence is operably linked thereto and inserted into a vector containing one or more expression control sequences (eg, promoters, enhancers, etc.) that regulate expression of the DNA sequence. Then, the host cell is transformed with the recombinant expression vector formed therefrom, and then the resulting transformant is cultured under the appropriate medium and conditions to express the DNA sequence. Subsequently, substantially pure peptides encoded by the DNA sequence from the culture are recovered using methods known in the art (eg, chromatography). The genetic engineering method for peptide synthesis of the present invention can refer to the following documents: Maniatis et al., Molecular Cloning: A laboratory Manual, Cold Spring Harbor laboratory, 1982; Sambrook et al., Molecular Cloning: A Laboratory Manual et al.

The peptide may be a variant of amino acids having different sequences by deletion, insertion, substitution, or a combination of amino acid residues within a range that does not affect the function of the protein. Amino acid exchanges in proteins or peptides that do not entirely alter the activity of the molecule are known in the art. In some cases, phosphorylation, sulfation, acrylation, glycosylation, methylation, or farnesylation can be modified. Accordingly, the present invention may include a peptide having a substantially identical amino acid sequence to a peptide composed of the amino acid sequence of any one of SEQ ID NOs: 1 to 4 and a variant or fragment thereof. The substantially identical peptide may have homology to 80% or more, specifically 90% or more, and more specifically 95% or more of the peptide of the present invention.

In a specific embodiment of the present invention, the present inventors isolate and purify the toxin-antitoxin (HicBA) protein complex of pneumococci, determine the structure through X-ray diffraction analysis, and degrade RNA of the HicA toxin protein Amino acid residues essential for activity and hence cytotoxicity were identified (see Figures 1-7).

In addition, the interaction between HicB and HicA proteins forming the HicBA protein complex was confirmed, and amino acid residues of the HicB protein essential for complex formation were identified (see FIG. 8).

In addition, peptides I to IV that mimic the α2 region of the HicA protein that binds to the HicB protein were produced, and the effect of increasing the RNA degradation activity according to the increase in the HicA toxin protein separated according to the inhibition of the formation of the HicBA protein complex of the peptides was confirmed. Peptide I was confirmed for antibiotic activity against 8 bacteria other than pneumococci (see FIGS. 9, 10 and Table 6).

Therefore, the peptide that mimics the α2 region of the HicA protein inhibits the binding of the pneumococcal toxin-antitoxin complex, HicBA, induces the death of pneumococcus, and also exhibits antibiotic activity against other bacteria, thereby making it a peptide for antibiotic use. It can be useful.

In addition, the present invention provides an antibiotic composition containing the antibiotic peptide as an active ingredient.

The antibiotic peptide may have the characteristics described above. In one example, the peptide may be composed of any one amino acid sequence of SEQ ID NO: 1 to 4.

The composition corresponds to amino acid residues 56-66 of the pneumococcal toxin protein HicA, and may inhibit the α2 region consisting of the amino acid sequence of SEQ ID NO: 5 from binding to the antitoxin protein HicB.

The composition may exhibit antibiotic activity against any one or more bacteria selected from the group consisting of pneumococcus, archaea, Staphylococcus aureus, epidermal staphylococcus, E. coli, dysentery, Salmonella typhimurium, pneumococcal and Pseudomonas aeruginosa.

In a specific embodiment of the present invention, the present inventors confirmed the effect of increasing the RNA decomposition activity according to the increase in the HicA toxin protein isolated according to the inhibition of HicBA protein complex formation of the peptides I to IV (see FIGS. 9 and 10), and the peptide I Antibiotic activity was confirmed for Bacillus aureus, Staphylococcus aureus, Epidermal Staphylococcus aureus, E. coli, Heterogeneous bacteria, Salmonella typhimurium, Pneumococcal and Pseudomonas aeruginosa (see Table 6). Therefore, the composition containing the peptide as an active ingredient can be usefully used as an antibiotic composition.

Antibiotic composition comprising the antibiotic peptide of the present invention, but preferably comprises 0.1 to 50% by weight of the antibiotic peptide relative to the total weight of the composition, but is not limited thereto.

The composition of the present invention may further include suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceuticals.

The composition according to the present invention can be used in the form of an oral dosage form such as powder, granule, tablet, capsule, suspension, emulsion, syrup, aerosol, external preparation, suppository, and sterile injectable solution, respectively, according to a conventional method. have. Carriers, excipients and diluents that may be included in the compositions of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, it is prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactants. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations include at least one excipient in the composition of the present invention, for example, starch, calcium carbonate, sucrose It is prepared by mixing (sucrose) or lactose, gelatin, etc. Also, lubricants such as magnesium stearate and talc are used in addition to simple excipients. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweetening agents, fragrances, and preservatives may be included. . Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents, suspending agents may include propylene glycol, polyethylene glycol (PEG), vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin butter, and glycerogelatin may be used.

The composition of the present invention can be administered orally or parenterally, any parenteral administration method can be used, systemic or topical administration is possible, but systemic administration is more preferred, and intravenous administration is most preferred.

The preferred dosage of the composition of the present invention depends on the patient's condition and body weight, the degree of disease, the drug form, the route and duration of administration, but can be appropriately selected by those skilled in the art. However, for the desired effect, the effective dose of the antibiotic peptide of the present invention may be 0.001 to 100 mg / kg, specifically 0.01 to 10 mg / kg, and may be administered once to several times a day.

The antibiotic composition of the present invention can be administered to a patient in a single dose by bolus form or infusion for a relatively short period of time, and multiple doses are administered for a long time. Can be administered by fractionated treatment protocol.

In addition, the present invention provides a quasi-drug for antibiotics containing the antibiotic peptide as an active ingredient.

The antibiotic peptide may have the characteristics described above. In one example, the peptide may be composed of any one amino acid sequence of SEQ ID NO: 1 to 4.

The quasi-drug may correspond to amino acid residues 56-66 of the pneumococcal toxin protein HicA, and may inhibit the α2 region consisting of the amino acid sequence of SEQ ID NO: 5 from binding to the antitoxin protein HicB, and the activity of the pneumococcal toxin It may not affect.

In a specific embodiment of the present invention, the present inventors confirmed the effect of increasing the RNA decomposition activity according to the increase in the HicA toxin protein isolated according to the inhibition of HicBA protein complex formation of the peptides I to IV (see FIGS. 9 and 10), and the peptide I Antibiotic activity was confirmed for Bacillus aureus, Staphylococcus aureus, Epidermal Staphylococcus aureus, E. coli, Heterogeneous bacteria, Salmonella typhimurium, Pneumococcal and Pseudomonas aeruginosa (see Table 6). Therefore, quasi-drugs containing the peptide as an active ingredient can be usefully used as quasi-drugs for antibiotics.

When the peptide of the present invention is used as a quasi-drug additive, the peptide can be added as it is or used with other quasi-drugs or quasi-drug components, and can be suitably used according to a conventional method. The mixing amount of the active ingredient can be appropriately determined according to the purpose of use.

The quasi-drug composition of the present invention is not limited thereto, but may preferably be a disinfecting cleaner, shower foam, gagreen, wipes, detergent soap, hand wash, humidifier filler, mask, ointment, patch, or filter filler.

In addition, the present invention provides an external preparation for antibiotic containing the antibiotic peptide as an active ingredient.

The antibiotic peptide may have the characteristics described above. In one example, the peptide may be composed of any one amino acid sequence of SEQ ID NO: 1 to 4.

The external preparation may correspond to amino acid residues 56-66 of HicA, a pneumococcal toxin protein, and inhibit the binding of the α2 region consisting of the amino acid sequence of SEQ ID NO: 5 to the antitoxin protein HicB, and the activity of pneumococcal toxin It may not affect.

In a specific embodiment of the present invention, the present inventors confirmed the effect of increasing the RNA decomposition activity according to the increase in the HicA toxin protein isolated according to the inhibition of HicBA protein complex formation of the peptides I to IV (see FIGS. 9 and 10), and the peptide I Antibiotic activity was confirmed for Bacillus aureus, Staphylococcus aureus, Epidermal Staphylococcus aureus, E. coli, Heterogeneous bacteria, Salmonella typhimurium, Pneumococcal and Pseudomonas aeruginosa (see Table 6). Therefore, an external preparation containing the peptide as an active ingredient may be useful as an external preparation for antibiotic use.

When the peptide of the present invention is used as an external preparation for skin, fatty substances, organic solvents, solubilizers, thickeners and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, Water, ionic or nonionic emulsifiers, fillers, metal ion blockers and chelating agents, preservatives, vitamins, blockers, wetting agents, essential oils, dyes, pigments, hydrophilic or lipophilic actives, lipid vesicles or external preparations for skin It may contain adjuvants commonly used in the field of dermatology such as any other ingredients used. In addition, the ingredients can be introduced in an amount commonly used in the field of dermatology.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

Isolation and purification of HicBA protein complex and selenomethionine (SeMet) labeled HicBA protein complex

1-1. Cloning and transformation of HicB and HicA genes

First, Streptococcus pneumoniae amplified (S. pneumoniae) antitoxin protein chain reaction polymerase using the primers described for the gene encoding the SP1787 SP1786 gene and toxin protein HicA encoding table 1 the HicB (polymerase chain reaction, PCR) of Ordered.

Primer name ^a Sequence (5 '→ 3') ^b Sequence number HicB-F GGAATTC CATATG ATGTTAGTTACGTATCC 7 HicB-R CCG CTCGAG CGGTTAGGCTTGAACTTTCTTATC 8 HicA-F GGAATTC CATATG ATGGTGTTGTCAGGAGG 9 HicA-R CCG CTCGAG CGGTTACAACCCAGCTTGCTTTC 10

^a F means a forward primer, and R means a reverse primer.

^b Underlined sequences refer to restriction sites.

The PCR products of the genes encoding the HicB and HicA proteins were double-cut with restriction enzymes Nde1 and Xho1, and linked to the tag-free pET21a and pET28b, respectively, cut with the same enzyme, and the gene encoding the HicA protein was To the linked pET28b, an N-terminal residual tag (SEQ ID NO: 6: MGSSHHHHHHSSGLVPRGSH) was added. Each plasmid prepared above was co-transformed into Escherichia coli Rosetta2 (DE3) pLysS receptor cells.

1-2. Expression and purification of HicBA protein complex

The HicBA protein complex was isolated and purified using cells co-transformed with plasmids containing the HicB and HicA genes prepared in Example 1-1.

Specifically, the cells were cultured at 37 ° C. using LB (Luria Bertani) medium until the OD ₆₀₀ value reached 0.8. Then, 0.5 mM of IPTG (isopropyl 1-thio-β-D-galactopyranoside) was added to induce protein overexpression, and further cultured at 37 ° C. for 4 hours. The cultured cells were recovered by centrifugation at 4 ° C at 11,355 × and stored at -80 ° C. The obtained cells were suspended in buffer A (20 mM Tris-HCl (pH 7.9) and 500 mM NaCl) containing 5% (v / v) glycerol, crushed using ultrasound, and then crushed. The cells were centrifuged again at 28,306 × for 1 hour to obtain a supernatant. Equilibrated to the supernatant containing the soluble proteins with buffer A Ni ²⁺ affinity column, the column open to the buffer A containing a filling ^{(Ni 2+ affinity open column, Bio} -Rad) and, 50 mM imidazole (imidazole) Was washed. The protein bound to the Ni ²⁺ column was eluted using an imidazole concentration gradient of 100 to 700 mM, and the HicBA protein complex present in the eluted fraction was confirmed by SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis). A buffer containing the HicBA protein complex was subjected to size-exclusion chromatography using a HiLoad 16/600 Superdex 200 prep-grade column (GE Healthcare) to 20 mM Tris (pH 7.5) and 150 mM NaCl It was exchanged with a buffer containing, and the exchanged sample was concentrated to a concentration of 10 mg / mL using an Amicon Ultra centrifugal filter unit (Milipore). The purity of the concentrated HicBA protein complex was confirmed by SDS-PAGE.

1-3. Expression and purification of SeMet labeled HicBA protein complex

SeMet-labeled HicBA protein complex was isolated and purified to resolve phase differences in protein crystal structure analysis.

Specifically, when culturing the cells prepared in Example 1-1, SeMet was performed by performing the experiment in the same manner as described in Example 1-2, except that the cells were cultured in M9 medium containing extra essential amino acids. A labeled HicBA protein complex was obtained.

Structural analysis of HicBA protein complex

2-1. Crystallization of protein

In order to confirm the crystal structure of the HicBA protein complex and SeMet-labeled HicBA protein complex isolated and purified in Example 1, the following experiment was performed.

Specifically, 1 µl of each protein complex solution contained at a concentration of 10 mg / mL in 20 mM Tris (pH 7.5) and 150 mM NaCl solution was mixed with 1 µl of a reservoir solution, and crystal screening 1 , 2 and index kits (Hampton Research) were used to perform initial crystal screening. Each crystal was grown using a sitting-drop vapor diffusion method at 4 ° C, and a solution composed of 0.1 M Tris (pH 8.5) and 2.0 M ammonium sulfate was used as the crystallization solution. . For cryoprotection of the HicBA protein complex, 20% glycerol was added to the solution. The crystals were immediately frozen in liquid nitrogen prior to data collection.

2-2. X-ray diffraction analysis data collection

X-ray diffraction analysis was performed using the crystals obtained in Example 2-1.

Specifically, the X-ray diffraction analysis data of the crystals were collected using the ADSC Quantum Q270r CCD detector at 5C and 7A beamlines of the Pohang Accelerator Center (Korea), and analyzed using the HKL2000 program. The data collection of each crystal is shown in Table 2 below, and the calculated total mass of the HicBA protein complex including the N-terminal histidine tag was 26349.7 Da.

SeMet labeled HicBA crystals Circular HicBA Crystal X-ray source 5C beamline ^a 7A beamline ^a X-ray wavelength ^b (Å) 0.9795 1.0000 Space group ^c P2 ₁ 2 ₁ 2 P2 ₁ 2 ₁ 2 Unit cell parameters ^d a, b, c (Å) 106.88, 116.58, 42.67 106.93, 116.62, 42.68 α, β, γ (°) 90.0, 90.0, 90.0 90.0, 90.0, 90.0 Resolution range ^e (Å) 50.0-2.80 50.0-2.30 Molecules per ASU ^f 2 HicBA homodimers 2 HicBA homodimers Observed reflections ^g (> 1σ) 294913 237881 Unique reflections ^h 12859 24090 <I / σ (I)> ⁱ 50.69 (6.86) ⁿ 30.2 (5.27) ⁿ Completeness ^j (%) 96.7 (87.8) ⁿ 100.0 (100.0) ⁿ Multiplicity ^k 22.9 (22.8) ⁿ 9.9 (10.1) ⁿ R _merge (%) ^l 11.0 (66.6) ⁿ 9.2 (53.7) ⁿ CC _1/2 , CC ^m (0.906, 0.975) ⁿ

^a Pohang Accelerator Center (Korea) beamline

^{b The} wavelength length of the X-ray used

^c Space group: It means the symmetry of the unit cell of crystal, and when the symmetric elements are combined, a total of 230 space groups exist.

^d Unit cell dimension: The value that defines the unit cell, the smallest repeatable unit that makes up the space lattice, and is defined by three crystallographic axes. It is a three-way vector. It means the length (a, b and c) of them and the angle (α, β and γ) they make up with each other.

^e Limitation of model resolution that can be obtained from collected data

^f Asymmetric unit (ASU) included in a molecule

^g Total number of reflections of X-ray diffraction analysis data

^h Number of reflections within the collected range among X-ray diffraction analysis data

^{i This is the} value obtained by dividing the intensity (I) of the reflection data obtained from each shell by the error value, which means that the result is more reliable.

^j Completeness: A value expressed as a percentage of the total number of reflections present in a specific resolution. The higher the resolution, the higher the resolution.

^k multiplicity: the same meaning as the redundancy, which is the number of measured reflections relative to the number of unique reflections. The total number of reflections is low, indicating a high degree of multiplicity (repetition) compared to crystals with low symmetry.

^l R _merge = Σ ( I- < I >) / Σ < I >

R _merge : The degree of agreement between measurement data associated with symmetry, the lower the value, the same meaning as R _sym which means that the result is more reliable.

^m CC (correlation coefficient): A measure of the accuracy of the data used to determine the structure among X-ray data, and the higher the accuracy, the higher the accuracy.

CC _1/2 : A scale to prove the accuracy of CC, calculated using a randomly selected half dataset.

The value in ⁿ parentheses is the value of the highest resolution shell.

2-3. Protein structure determination and structure refinement

The structure of the HicBA protein complex was analyzed at a resolution of 2.80 kHz by single-wavelength anomalous dispersion using SeMet-labeled crystals, and the final structure was determined by molecular replacement. First, a model was formed using PHENIX, and an initial model of structural improvement was formed using a COOT program. The overall geometric structure was verified by MolProbity, and the improved structure was visualized using PyMOL, and the statistical results of the structure improvement of each crystal are shown in Table 3 below.

SeMet labeled HicBA crystals Circular HicBA Crystal R _work ^a (%) 20.2 20.5 R _free ^b (%) 24.0 23.6 No. of atoms / average B factor ^c (Å ² ) Protein 3266 / 55.6 3354 / 40.4 Water oxygen 50 / 50.14 85 / 34.06 RMSD ^d from ideal geometry Bond distance (Å) 0.007 0.005 Bond angle (°) 1.314 0.963 Ramachandran statistics ^e Most favored regions (%) 96.3 98.0 Additional allowed regions (%) 3.2 2.0 Disallowed regions (%) 0.5 0.0 MolProbity score ^f 2.12 (98 ^th percentile) 1.66 (98 ^th percentile) PDB accession code 5YRZ

^{a The} degree of agreement between the actual X-ray diffraction data and the model. The lower the match, the higher the match. (R = Σ _hkl || F _obs |-k | F _calc || / Σ _hkl | F _obs |)

^{b The} degree of agreement between the randomly selected data and the model. 5% of randomly selected data among the obtained data was obtained by calculating in the same manner as R _work .

^It means the range where the atom vibrates and moves from the position of the atom given in the ^c model.

^d Root mean square deviation: The degree to which the structure of the determined model is consistent with the binding length and angle of the conventional molecules, was obtained using REFMAC.

^e Ramachandran analysis: An analysis showing the spatial angle of the main chain of a polypeptide, which shows the angle at which the chain exists by reflecting steric repulsion and there is no contradiction. It is used as an indicator to evaluate the model.

^{f As} a measure for evaluating the structural model quality of proteins and nucleic acids, the higher the percentile, the higher the quality.

2-4. Structural characterization of HicBA protein complex

Based on the data obtained in Examples 2-2 and 2-3 above, structural characteristics of the HicBA protein complex were confirmed, and size exclusion chromatography coupled with multi-angle light scattering (MALS) was performed. The structure of the HicBA protein oligomer was determined.

Specifically, size exclusion chromatography was performed using a BioSep SEC-x3000 column (Phenomenex) and a 1260 Infinity HPLC system (Agilent Technologies), and the scattering data was a miniDAWN-TREOS line (Wyatt Technology) at an emission wavelength of 657.4 nm. And analyzed using ASTRA 6.0.1.10 software (Wyatt Technology). In the experiment, 100 μM of HicBA protein heterodimer was used, and the solution was analyzed in a solution consisting of 20 mM Tris (pH 7.5) and 150 mM NaCl, which are conditions of the protein crystallization experiment, and all experiments were performed at room temperature.

As a result of analysis based on X-ray diffraction analysis data, the HicBA protein complex crystal structure includes two HicBA protein complex heterodimers, two HicB antitoxin proteins and two HicA toxin proteins are hetero-tetramers ( Hetero-tetramer) was confirmed to form a structure (Fig. 1A). However, the molecular weight of the HicBA protein complex calculated from MALS-coupled size exclusion chromatography was 105 ± 0.1 kDa, which is almost identical to the theoretical molecular weight (105.4 kDa) of the hetero-octamer form of the HicBA protein complex. Thus, it was confirmed that the HicBA protein complex was present in a hetero-octamer form (FIGS. 1B and 2A).

On the other hand, as a result of performing a secondary structural analysis using a 2Struc server, HicB protein has three α-helices (α-helices), three 3 ₁₀ -helixes (η) and four β-strands (β-strands). It was confirmed that the HicA protein contains two α-helixes and three β-strands, and has a double-stranded RNA binding domain fold topology of α-β-β-β-α (FIG. 1C). In addition, compared to the previously known structure of the HicBA protein complex of Yersinia pestis , the Pneumococcal HicBA protein complex has a long and flexible loop between η1 and η2 of the HicB protein, especially predicted as a DNA binding domain. It was confirmed that the C-terminal portion of the HicB protein was not present in the HicBA protein complex of the pest bacteria (FIGS. 1C, 1D, 1F, 1G, and 3).

2-5. Structural characterization of HicB protein

Based on the data obtained in Examples 2-2 to 2-4, structural characteristics of the HicB protein were confirmed.

As a result, it was confirmed that two HicB protein monomers form homodimers mainly through β1, α4, and β4 among the N-terminal domains of each monomer. However, the molecular weight of the HicB protein calculated from MALS-coupled size exclusion chromatography was 71.8 ± 0.8 kDa, which was in close agreement with the theoretical molecular weight of the HicB protein tetramer (71.3 kDa), so that the HicB protein was present in the tetramer form. Was confirmed (FIGS. 1E and 2B).

Isolation and purification of HicA protein

After transforming the pET28b plasmid linked to the gene encoding the HicA protein prepared in Example 1-1 into Escherichia coli Rosetta2 (DE3) pLysS receptor cells, the cells were cultured for 2 hours after IPTG treatment. The HicA protein was isolated and purified in the same manner as described in Example 1-2 above.

Isolation and purification of HicA-H36A protein

Using the gene SP1787 encoding the HicA protein as a template, the manufacturer's instructions using the primers (SEQ ID NOs: 11 and 12) and the site-specific mutation induction kit (EZchangeTM Site-Directed Mutagenesis Kit, Enzynomics) shown in Table 4 below According to PCR, a mutant gene in which histidine 36 of HicA protein was substituted with alanine was obtained. Cells expressing the HicA-H36A protein were produced in the same manner as described in Example 1-1, except that the PCR product was used instead of the PCR product that amplified the gene encoding the HicA protein. Thereafter, the HicA-H36A protein was isolated and purified in the same manner as described in Example 3.

Primer name ^a Sequence (5 '→ 3') Sequence number HicA-H36A-F TAGAGGCGGTAAAGGCTCCGCTATTAAAATGGAAAAGCAAG 11 HicA-H36A-R CTTGCTTTTCCATTTTAATAGCGGAGCCTTTACCGCCTCTA 12 HicB-F22A-F GGAACAGAAGCGACTTATGCTGTCCATTTCCCAGATTTT 13 HicB-F22A-R AAAATCTGGGAAATGGACAGCATAAGTCGCTTCTGTTCC 14 HicB-T33A-F GATTTTGAATACTCAGCTACACAAGGAGAGGGGATTTCT 15 HicB-T33A-R AGAAATCCCCTCTCCTTGTGTAGCTGAGTATTCAAAATC 16 HicB-Q34A-F TTTGAATACTCAGCTACAGCAGGAGAGGGGATTTCTGAG 17 HicB-Q34A-R CTCAGAAATCCCCTCTCCTGCTGTAGCTGAGTATTCAAA 18 HicB-E47A-F GCTTTGGCTATGGGGTCGGCGTGGCTAGGGATAACTGTT 19 HicB-E47A-R AACAGTTATCCCTAGCCACGCCGACCCCATAGCCAAAGC 20 HicB-F80A-F TTAATTGATAATGATCCTGCTAAAGATGATGAAGATTTC 21 HicB-F80A-R GAAATCTTCATCATCTTTAGCAGGATCATTATCAATTAA 22 HicB-T89A-F GATGAAGATTTCGTGTCAGCCTATGACCTTGATAAATCT 23 HicB-T89A-R AGATTTATCAAGGTCATAGGCTGACACGAAATCTTCATC 24

^a F means a forward primer, and R means a reverse primer.

Experimental Example 1. Confirmation of RNA degradation activity of HicA protein

The RNA degradation activity of the HicA protein of pneumococcus was confirmed, and this was compared with the RNA degradation activity of VapC26 and VapC30 proteins of Mycobacterium tuberculosis , a toxin protein having different RNA degradation activity.

Specifically, the Mycobacterium tuberculosis VapC26 and VapC30 proteins were separated and purified by the methods described in Korean Patent Nos. 10-1849347 and 10-1746160, respectively. RNA decomposition activity of each protein was measured according to the manufacturer's instructions using a kit (RNase Alert Kit, IDT). Synthetic RNA used as a substrate has fluorophores and quenchers attached to both ends, respectively. When RNA is decomposed, fluorophores and quenchers are separated, and fluorescence is emitted at 520 nm after excitation at 490 nm. do. To prevent contamination of 4 μM of purified HicA protein in Example 3, 4 μM of VapC26 protein, 4 μM of VapC30 protein, or RNase A 3 × 10 ^-5 units in a solution composed of 20 mM Tris (pH 7.5) and 150 mM NaCl. After preparing by adding RNase inhibitor (40 units, RiboLock ^TM , Thermo Scientific), the synthetic RNA was mixed with each other, and the emitted fluorescence was measured over time with a spectrofluorimeter (SPECTRAmax GEMINI XS spectrofluorometer).

 As a result, the RNA decomposition activity of HicA protein, a toxin protein of pneumococcus, was the highest compared to RNase A, which is a general RNA degrading enzyme, or VapC26 and VapC30 proteins, which are toxin proteins of tuberculosis bacteria (Fig. 4).

Experimental Example 2. Identification of histidine residues essential for RNA decomposition activity of HicA protein

In order to confirm the histidine residues essential for RNA decomposition activity of the purified HicA protein in Example 3, the following experiments were performed.

2-1. Sequence alignment and structural analysis

The amino acid sequence of the Pneumococcal HicA protein is the hypothetical protein of Thermus thermophilus , the HicA protein of Fest, the HicA protein of Burkholderia pseudomallei , and the HicA protein of E. coli Alignment was performed using Cluster Omega 1.2.1 along with the amino acid sequence, which was visualized with ESPript 3.0. In addition, for more specific comparative analysis, structural similarity of pneumococcal HicA protein structure using DALI is targeted for the structures of the other proteins except for the HicA protein of E. coli, whose structure has not yet been identified. Analysis.

As a result, the β2 strand histidine residue was highly conserved in all HicA proteins, and the glycine residue in the loop between the β1 and β2 strands was well conserved (FIG. 5A). In addition, the thermophilic thermophilus protein (PDB code 1WHZ (Chain A)), the bacterial HicA protein (PDB code 4P78 (Chain C and D)) and the Berkholderia pseudomaleic HicA protein (PDB code 4C26 (PDB code 4C26 ( The sequence identity of chain A)) was 29%, 34% and 28%, respectively (FIG. 5C).

As a result of structural analysis, histidine 36, a key residue among the RNA-decomposing active sites of the pneumococcal HicA protein, forms hydrogen bonds with the threonine 33 and glutamate 47 residues of the HicB protein, and in particular, salts with glutamate 47 residues. bridge) to confirm the interaction (FIG. 5B). In addition, the Pneumococcal HicA protein forms a double-stranded RNA binding domain. In the double-stranded RNA binding domain to which RNA is bound (PDB code 1DI2), α1 interacts with a minor groove of RNA, and α2 is RNA. It was confirmed that the interaction with the major groove (major groove) of (Fig. 6).

2-2. Determine whether histidine 36 of HicA protein is essential for RNA degradation activity

The RNA decomposition activity of the HicA protein and HicA-H36A protein purified in Examples 3 and 4 were measured to confirm whether histidine 36 residues are essential for the RNA decomposition activity of the HicA protein.

Specifically, RNA decomposition activity was measured in the same manner as described in Experimental Example 1, except that 1, 2, 4 or 8 μM HicA protein and 8 μM HicA-H36A protein were mixed with synthetic RNA, respectively.

As a result, the HicA protein showed RNA decomposition activity dependent on reaction time and treatment concentration, whereas the HicA-H36A protein in which the histidine 36 residue was substituted with alanine did not show any RNA decomposition activity (FIG. 7A). This suggests that the histidine 36 residue is essential for the RNA degradation activity of the HicA protein.

2-3. Determine if histidine36 of HicA protein is essential for cytotoxicity

Cells expressing HicBA protein complex, HicA protein or HicA-H36A protein in order to confirm that the cytotoxicity according to the RNA decomposition activity of HicA protein appears as the same result according to the results confirmed in Experimental Examples 2-1 and 2-2. The survival rate of was measured.

Specifically, the plasmids containing the HicB and HicA genes prepared in Example 1-1 were co-transformed into E. coli BL21 (DE3), and the plasmids expressing the HicA protein prepared in Example 1-1 and Examples The plasmids expressing the HicA-H36A protein prepared in 4 were transformed into E. coli BL21 (DE3), respectively. Single colonies of transformed cells grown on M9 medium plates containing 0.1% glucose were each cultured overnight and diluted to an OD ₆₀₀ value of 0.1. The diluted cells were further incubated until the cell suspension had an OD ₆₀₀ value of 0.4, and then 0.5 mM IPTG was added to induce protein expression. The cells were further cultured at 37 ° C. for 8 hours after the addition of IPTG, and the absorbance was measured at intervals of 1 hour to obtain a cell growth curve.

As a result, E. coli expressing the HicBA protein complex and E. coli expressing the HicA-H36A protein showed the same growth curve as the control, whereas E. coli expressing the HicA protein showed a significantly lower growth curve than the control (FIG. 7B). This suggests that HicA protein shows cytotoxicity through RNA decomposition activity, neutralizes cytotoxicity when HicBA protein complex is formed, and that the histidine36 residue of HicA protein is essential for the toxicity of HicA protein.

Experimental Example 3. Identification of amino acid residues essential for HicBA protein complex formation

In order to confirm the amino acid residues of the HicB protein essential for the formation of the HicBA protein complex, the following experiments were performed.

3-1. Confirm the interaction between HicB and HicA proteins

The data obtained in Example 2 was analyzed to confirm the interaction between HicB and HicA proteins in the HicBA protein complex.

As a result, in the HicBA protein complex, the HicB protein occupies 1,183 Å ² of the HicA protein, about 43% of the residues of the HicA protein chain D are involved in complex formation, and about 28% of the total surface area of the HicA protein is the binding site It was confirmed to occupy. The hydrophobic interaction at the two protein binding sites is achieved by the leucine 50 and tyrosine 57 residues of the HicB protein phenylalanine 22, methionine 44, phenylalanine 80, phenylalanine 86 and tyrosine 90, and the HicA protein, among them the tyrosine 57 residue of the HicA protein. It was confirmed that the aromatic interaction by plays an important role (Fig. 8A). In addition, the hydrophilic interactions include aspartic acid 12, alanine 19, tyrosine 30, threonine 33, glutamine 34, glutamate 47, threonine 89, glutamate 106 and glutamine 111 residues of HicB protein, arginine 30, lysine 33, serine 35, of the HicA protein. Histidine 36, lysine 38, glutamate 53, asparagine 55, lysine 56, tyrosine 57, threonine 58 and glutamine 65 residues, and in particular the HicB protein aspartic acid 12, glutamate 47, aspartic acid 55 and aspartic acid 83 residues It was confirmed that an additional salt bridge was formed by interaction of HicA protein with histidine 36, lysine 38, lysine 56, and lysine 64 residues (FIG. 8B).

3-2. Identification of amino acid residues of HicB protein essential for HicBA protein complex formation

Among the amino acid residues of the HicB protein involved in the formation of the HicBA protein complex, threonine 33, glutamine 34, glutamate 47 and threonine 89 residues involved in hydrophilic interaction, and phenylalanine 22 and phenylalanine 80 residues involved in hydrophobic interaction were selected to select the residues. Proteins substituted with alanine were produced.

Specifically, using the gene SP1786 encoding HicB protein as a template, using the primers (SEQ ID NOs: 13 to 24) and the site-specific mutagenesis kit (EZchangeTM Site-Directed Mutagenesis Kit, Enzynomics) described in Table 4 above. PCR was performed according to the manufacturer's instructions to obtain each mutant gene, which was linked to pET21a in the same manner as described in Example 1-1 above. The pET28b-HicA and pET21a-HicB prepared in Example 1-1 were co-transformed into E. coli BL21 (DE3), and the pET28b-HicA and pET21a-HicB mutants (F22A, prepared in Example 1-1) were co-transformed. T33A, Q34A, E47A, F80A or T89A) were co-transformed into E. coli BL21 (DE3). Each transformed cell was cultured in an LB plate containing 0.5 mM IPTG at 37 ° C. for 18 hours.

As a result of observing the cultured cells, E. coli grew well without cytotoxicity in the control with the empty vector inserted and E. coli expressing the HicBA protein complex, and the complex of T33A, Q34A, F80A or T89A and HicA proteins among mutants of HicB protein In E. coli expressing, cytotoxicity was not similar to that of the control, whereas cell growth was significantly inhibited in E. coli expressing the complex of F22A or E47A and HicA protein among mutants of HicB protein (FIG. 8C). This suggests that phenylalanine 22 and glutamate 47 residues are essential among amino acid residues of HicB protein when HicB protein inhibits toxicity through complex formation with HicA toxin protein.

Production of HicA protein mimic peptides

7 residues (glutamate 53, asparagine 55, lysine 56, which contain 11 residues (lysine 56 to alanine 66, KYTERGIRKQA, SEQ ID NO: 5), which are the α2 helix regions of the HicA protein, and are involved in forming a complex with the HicB protein. Four HicA protein mimic peptides including tyrosine 57, threonine 58, lysine 64, and glutamine 65) were designed and prepared by requesting ANYGEN (http://www.anygen.com) (Table 5). When producing peptides, it is advantageous to mimic the helix structure to prevent protein hydrolysis, and it is important to prepare peptides of optimal length to reduce selectivity and prevent self-aggregation, so consider the peptides in consideration of this. It was produced.

Peptide name order Peptide length (aa) Molecular weight (Da) Sequence number Peptide I ELNKYTERGIRKQAG (53-67) ^a 15 1,763 One Peptide II GELNKYTERGIRKQAG (52-67) ^a 16 1,820 2 Peptide III ELNKYTERGIRKQAGL (53-68) ^a 16 1,876 3 Peptide IV GELNKYTERGIRKQAGL (52-68) ^a 17 1,933 4

^a The number in parentheses is a number indicating the sequence of amino acids of the corresponding sequence among the amino acid sequences of the entire HicA protein.

Experimental Example 4. Confirmation of circular dichroism (CD) of HicA protein mimic peptide

CD spectroscopy of the HicA protein-mimicking peptide prepared in Example 5 was performed to measure the helicity of each peptide.

Specifically, the peptides I to IV prepared in Example 5 were dissolved in a solution composed of 20 mM Tris (pH 7.5) and 150 mM NaCl at a concentration of 25 μM, respectively, and a light path of 1 mm at 20 ° C. CD spectral analysis was performed using a cell having a (Chirascan Plus spectropolarimeter, Applied Photophysics, Ltd.). The CD scan was measured from 260 to 190 nm with a band width of 1 nm, and the scan rate was 100 nm / min. The helicity of each peptide was quantitatively measured based on mean residue ellipticity ([θ] ₂₂₂ ).

As a result, the helicity of the peptides I, II, III and IV was 39.8, 25.5, 25.5 and 33.3%, respectively, and the peptide I showed the highest helicity (FIG. 9C).

Experimental Example 5. Confirmation of the inhibitory effect of HicA protein mimic peptides on HicBA protein complex formation

To confirm the inhibitory effect of the HicA protein mimetic peptide prepared in Example 5 on HicBA protein complex formation, after adding the HicA protein mimetic peptide to the HicBA protein complex, RNA decomposition activity was measured.

Specifically, the HicBA protein complex purified in Example 1-2 was prepared in a solution composed of 20 mM Tris (pH 7.5) and 150 mM NaCl at a final concentration of 4 μM, and the final concentrations of the peptides I to IV in the same solvent. The mixture was mixed with HicBA protein complex at 4 μM, and incubated at 37 ° C for 30 minutes. Thereafter, RNA decomposition activity was measured in the same manner as described in Experimental Example 1.

As a result, when HicA protein mimic peptides were added to the HicBA protein complex, RNA degradation was increased, and among them, the effect of peptide I was the greatest (FIGS. 9A and 9B). This is interpreted as a result of an increase in the degree of RNA degradation as the number of separated HicA proteins increases, as the formation of the HicBA protein complex is competitively inhibited by the addition of the HicA protein mimic peptides. present.

Experimental Example 6. Confirmation of the inhibitory effect of peptide I on HicBA protein complex formation

The concentration-dependent effect of peptide I, which confirmed the best inhibitory effect of HicBA protein complex formation in Experimental Example 5, was confirmed by measuring RNA degradation activity.

Specifically, instead of peptides I to IV, when peptide I was mixed with 4 μM of HicBA protein complex at 2, 4, 8, or 16 μM, and RNA degradation activity of 4 μM of HicA protein purified in Example 3 was measured. RNA decomposition activity was measured in the same manner as described in Experimental Example 5 except for the above.

As a result, the HicA protein showed RNA decomposition activity, while the HicBA protein complex had no RNA decomposition activity, whereas when peptide I was added to the HicBA protein complex, the concentration of the RNA decomposition activity increased (FIGS. 10A and 10B). . This suggests that the degree of RNA degradation increased as the number of isolated HicA proteins increased by peptide I competitively inhibiting the formation of the HicBA protein complex.

Experimental Example 7. Confirmation of the antibiotic activity of peptide I

The antibiotic activity of peptide I was confirmed by measuring the minimum inhibitory concentration (MIC) for Gram positive and negative bacteria.

Specifically, three gram-positive strains and five gram-negative strains listed in Table 6 are cultured at 37 ° C. for 24 hours with 0.4 to 100 μM of peptide I, respectively, and the minimum concentration at which cell growth is completely inhibited is MIC. It is represented by.

Classification Bacteriology ATCC number MIC (μM) Gram training Bacillus subtilis 6633 6.3-12.5 Staphylococcus aureus 6538p 6.3 Staphylococcus epidermis 12228 12.5 Gram voice E. coli 25922 12.5-25 Shigella dysenteriae 9752 25 Salmonella typhimurium 14028 50 Klebsiella pneumoniae 10031 6.3 Pseudomonas aeruginosa 27853 12.5-25

^a American Type Culture Collection

As a result, for all 8 bacteria, peptide I showed a MIC of 6.3 to 50 μM, and showed the strongest antibiotic activity against Staphylococcus aureus ( S. aureus ) and pneumococcal ( K. pneumoniae ) (Table 1). 6).

<110> Seoul National University R & DB Foundation <120> Antibiotic peptides targeting toxin-antitoxin system of          Streptococcus pneumoniae and use thereof <130> 2018P-07-025 <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> peptide I <400> 1 Glu Leu Asn Lys Tyr Thr Glu Arg Gly Ile Arg Lys Gln Ala Gly   1 5 10 15 <210> 2 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> peptide II <400> 2 Gly Glu Leu Asn Lys Tyr Thr Glu Arg Gly Ile Arg Lys Gln Ala Gly   1 5 10 15 <210> 3 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> peptide III <400> 3 Glu Leu Asn Lys Tyr Thr Glu Arg Gly Ile Arg Lys Gln Ala Gly Leu   1 5 10 15 <210> 4 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> peptide IV <400> 4 Gly Glu Leu Asn Lys Tyr Thr Glu Arg Gly Ile Arg Lys Gln Ala Gly   1 5 10 15 Leu     <210> 5 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> alpha 2 region of HicA protein <400> 5 Lys Tyr Thr Glu Arg Gly Ile Arg Lys Gln Ala   1 5 10 <210> 6 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> tag <400> 6 Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro   1 5 10 15 Arg Gly Ser His              20 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HicB-F <400> 7 ggaattccat atgatgttag ttacgtatcc 30 <210> 8 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> HicB-R <400> 8 ccgctcgagc ggttaggctt gaactttctt atc 33 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> HicA-F <400> 9 ggaattccat atgatggtgt tgtcaggagg 30 <210> 10 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> HicA-R <400> 10 ccgctcgagc ggttacaacc cagcttgctt tc 32 <210> 11 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> HicA-H36A-F <400> 11 tagaggcggt aaaggctccg ctattaaaat ggaaaagcaa g 41 <210> 12 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> HicA-H36A-R <400> 12 cttgcttttc cattttaata gcggagcctt taccgcctct a 41 <210> 13 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HicB-F22A-F <400> 13 ggaacagaag cgacttatgc tgtccatttc ccagatttt 39 <210> 14 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HicB-F22A-R <400> 14 aaaatctggg aaatggacag cataagtcgc ttctgttcc 39 <210> 15 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HicB-T33A-F <400> 15 gattttgaat actcagctac acaaggagag gggatttct 39 <210> 16 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HicB-T33A-R <400> 16 agaaatcccc tctccttgtg tagctgagta ttcaaaatc 39 <210> 17 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HicB-Q34A-F <400> 17 tttgaatact cagctacagc aggagagggg atttctgag 39 <210> 18 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HicB-Q34A-R <400> 18 ctcagaaatc ccctctcctg ctgtagctga gtattcaaa 39 <210> 19 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HicB-E47A-F <400> 19 gctttggcta tggggtcggc gtggctaggg ataactgtt 39 <210> 20 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HicB-E47A-R <400> 20 aacagttatc cctagccacg ccgaccccat agccaaagc 39 <210> 21 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HicB-F80A-F <400> 21 ttaattgata atgatcctgc taaagatgat gaagatttc 39 <210> 22 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HicB-F80A-R <400> 22 gaaatcttca tcatctttag caggatcatt atcaattaa 39 <210> 23 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HicB-T89A-F <400> 23 gatgaagatt tcgtgtcagc ctatgacctt gataaatct 39 <210> 24 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> HicB-T89A-R <400> 24 agatttatca aggtcatagg ctgacacgaa atcttcatc 39

Claims (8)

An antimicrobial peptide consisting of the amino acid sequence of any one of SEQ ID NOs: 1 to 4 and inhibiting the formation of the HicBA complex, a toxin-antitoxin conjugate of pneumococcus.
The antimicrobial peptide of claim 1, wherein the peptide corresponds to amino acid residues 56-66 of HicA, a pneumococcal toxin protein, and inhibits the α2 region consisting of the amino acid sequence of SEQ ID NO: 5 from binding to the antitoxin protein HicB. .
The antimicrobial peptide of claim 1, wherein the peptide does not affect the activity of pneumococcal toxin.
Pneumococcal, Bacillus subtilis , Staphylococcus aureus , Staphylococcus aureus , S. epidermidis , Escherichia coli , E. coli (Shigella dysenteriae), Salmonella typhimurium (Salmonella typhimurium), pneumonia rod bacteria (Klebsiella pneumoniae) and Pseudomonas aeruginosa (Pseudomonas aeruginosa) antimicrobial composition for showing the antibacterial activity on any one or more bacteria selected from the group consisting of.
According to claim 4, The antimicrobial composition corresponds to amino acid residues 56-66 of HicA, a pneumococcal toxin protein, and inhibits the α2 region consisting of the amino acid sequence of SEQ ID NO: 5 from binding to the antitoxin protein HicB. Streptococcus pneumoniae, Bacillus subtilis (Bacillus subtilis), Staphylococcus aureus (Staphylococcus aureus), Staphylococcus epidermidis (S. epidermidis), E. coli (Escherichia coli), Shigella (Shigella dysenteriae), Salmonella typhimurium (Salmonella typhimurium), bacterial pneumonia bar ( Klebsiella pneumoniae ) and Pseudomonas aeruginosa ( Pseudomonas aeruginosa ) antimicrobial composition showing antibacterial activity against any one or more bacteria selected from the group consisting of.
delete Pneumococcal, Bacillus subtilis , Staphylococcus aureus , Staphylococcus aureus , S. epidermidis , Escherichia coli , E. coli (Shigella dysenteriae), Salmonella typhimurium (Salmonella typhimurium), pneumonia bar quasi for antibacterial showing antibacterial activity for any one or more bacteria selected from the group consisting of bacteria (Klebsiella pneumoniae) and Pseudomonas aeruginosa (Pseudomonas aeruginosa).
Pneumococcal, Bacillus subtilis , Staphylococcus aureus , Staphylococcus aureus , S. epidermidis , Escherichia coli , E. coli (Shigella dysenteriae), Salmonella typhimurium (Salmonella typhimurium), pneumonia rod bacteria antibacterial external preparation for showing the antibacterial activity on any one or more bacteria selected from the group consisting of (Klebsiella pneumoniae) and Pseudomonas aeruginosa (Pseudomonas aeruginosa).

Images