KR102094024B1 - Apparatus for analysing purine metabolite concentration such as hypoxanthine and xanthine for tumor diagnosis - Google Patents

Apparatus for analysing purine metabolite concentration such as hypoxanthine and xanthine for tumor diagnosis Download PDF

Info

Publication number
KR102094024B1
KR102094024B1 KR1020170184013A KR20170184013A KR102094024B1 KR 102094024 B1 KR102094024 B1 KR 102094024B1 KR 1020170184013 A KR1020170184013 A KR 1020170184013A KR 20170184013 A KR20170184013 A KR 20170184013A KR 102094024 B1 KR102094024 B1 KR 102094024B1
Authority
KR
South Korea
Prior art keywords
purine
concentration
tumor
reactant
unit
Prior art date
Application number
KR1020170184013A
Other languages
Korean (ko)
Other versions
KR20190081458A (en
Inventor
신동진
김창현
Original Assignee
(주)큐브바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)큐브바이오 filed Critical (주)큐브바이오
Priority to KR1020170184013A priority Critical patent/KR102094024B1/en
Publication of KR20190081458A publication Critical patent/KR20190081458A/en
Application granted granted Critical
Publication of KR102094024B1 publication Critical patent/KR102094024B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/26—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving oxidoreductase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y117/00—Oxidoreductases acting on CH or CH2 groups (1.17)
    • C12Y117/03—Oxidoreductases acting on CH or CH2 groups (1.17) with oxygen as acceptor (1.17.3)
    • C12Y117/03002—Xanthine oxidase (1.17.3.2)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
    • G01N21/25—Colour; Spectral properties, i.e. comparison of effect of material on the light at two or more different wavelengths or wavelength bands
    • G01N21/31—Investigating relative effect of material at wavelengths characteristic of specific elements or molecules, e.g. atomic absorption spectrometry
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
    • G01N21/77—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator
    • G01N21/78—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated by observing the effect on a chemical indicator producing a change of colour

Abstract

본 발명은 퓨린 대사체인 하이포잔틴 및 잔틴의 농도를 검출하여 종양을 진단하는 측정장치에 관한 것으로, 본 발명에 따른 측정장치는 소변 내에 존재하는 퓨린 대사체의 농도를 비침습적인 방법으로 검출하여 체내 종양 (악성 또는 양성) 발생 여부를 조기에 진단할 수 있어 치료의 방향과 정도를 예측할 수 있으므로 효과적인 치료는 물론 막대하게 지출될 수 있는 종양의 치료비를 감소할 수 있다. The present invention relates to a measuring device for diagnosing a tumor by detecting the concentrations of hypoxanthine and xanthine, which are purine metabolites, and the measuring device according to the present invention detects the concentration of the purine metabolite present in urine in a non-invasive manner. Since tumors (malignant or benign) can be diagnosed early, the direction and extent of treatment can be predicted, which can effectively reduce the cost of treatment as well as effective treatment of tumors.

Description

종양 진단을 위한 퓨린 대사체의 농도 측정장치{Apparatus for analysing purine metabolite concentration such as hypoxanthine and xanthine for tumor diagnosis} Apparatus for analysing purine metabolite concentration such as hypoxanthine and xanthine for tumor diagnosis}

본 발명은 종양 진단을 위한 장치에 관한 것으로, 보다 상세하게는 종양 진단을 위하여 퓨린 대사체인 하이포잔틴 및 잔틴 (이하 퓨린 대사체)의 농도를 검출하여 종양을 진단하는 측정장치에 관한 것이다.The present invention relates to a device for diagnosing a tumor, and more particularly, to a measurement device for diagnosing a tumor by detecting the concentrations of purine metabolites hypoxanthine and xanthine (hereinafter purine metabolites) for tumor diagnosis.

2014년 통계청 발표에 의하면, 국내 모든 암의 발생자는 217,057 명으로 조사 되었으며 암으로 인한 사망자는 76,855 명으로 주요 사망 원인별 사망률 1위라고 발표하였다. According to the announcement by the National Statistical Office in 2014, all cancer cases in Korea were found to be 217,057, and 76,855 deaths from cancer were the number one cause of death by major cause of death.

기존의 종양 진단은 침습적이고 고통을 수반하여 기피 및 진단 검사의 어려움이 존재하였다. 이러한 이유로 최소 침습적이고 종양의 조기 및 예후를 예측하는 진단법이 차세대 진단 기법으로 부각되었다.Existing tumor diagnosis was invasive and painful, and there were difficulties in evasion and diagnostic tests. For this reason, diagnostic methods that are minimally invasive and predict the early and prognosis of tumors have emerged as next-generation diagnostic techniques.

최근 연구에 의하면, 암 세포의 에너지 대사 및 핵산 합성에 있어 퓨린 대사체의 관련성이 밝혀지고 있다. 암 세포는 정상 세포와 다르게 빠르게 DNA를 합성하고 세포 복제를 한다고 알려져 있으며, 이를 위해서 핵산, 단백질, 아미노산, 포도당 등의 물질이 다량으로 소비를 한다. Recent studies have revealed the relevance of purine metabolites in energy metabolism and nucleic acid synthesis in cancer cells. Cancer cells are known to synthesize DNA rapidly and replicate cells differently from normal cells. To this end, nucleic acids, proteins, amino acids, and glucose are consumed in large quantities.

퓨린 염기는 핵산의 구성 물질로 육각형 고리를 가지는 방향족성 유기 화합물이다. 퓨린 염기의 생합성은 다양한 경로를 거치게 되며 신생경로(De novo pathway)와 회수 경로(Salvage pathway)로 나뉜다. 신생 경로의 경우 PRPP, 아미노산, ATP, 이산화탄소 등과의 반응을 거쳐서 일어나고, 회수경로는 PRPP와 하이포잔틴(hypoxanthine)의 결합으로 이루어진다. Purine base is an aromatic organic compound having a hexagonal ring as a constituent of nucleic acids. The biosynthesis of purine bases goes through a variety of pathways and is divided into a de novo pathway and a salvage pathway. In the case of the new pathway, it occurs through reaction with PRPP, amino acids, ATP, carbon dioxide, etc., and the recovery pathway consists of the combination of PRPP and hypoxanthine.

최근 발표된 논문에 의하면, 암에서는 글루타민의 사용량이 늘어나며 이는 미토콘드리아의 ATP합성에 신생 경로가 발생되어 암세포의 ATP합성을 증가시킨다 보고되었다. 암세포의 특징인 무한 분열을 위해서는 다량의 핵산을 필요로 하고, 신생 경로와 회수 경로의 활발한 반응이 일어나지만, 암세포에서는 글루타민의 사용량이 많아져 신생경로의 생합성 보다 회수 경로의 재사용율이 늘어남에 따라 소변 내 퓨린 대사체의 농도가 감소하는 것으로 사료된다. According to a recently published paper, the use of glutamine increases in cancer, which is reported to increase the ATP synthesis of cancer cells by generating a new pathway in mitochondrial ATP synthesis. Infinite division, which is a characteristic of cancer cells, requires a large amount of nucleic acid, and there is an active reaction between a new pathway and a recovery pathway, but in cancer cells, the amount of glutamine is increased, so the reuse rate of the recovery pathway is increased rather than the biosynthesis of the new pathway. It is thought that the concentration of purine metabolites in the urine decreases.

한국 공개특허 제2017-0021349호Korean Patent Publication No. 2017-0021349

본 발명의 종양 진단을 위한 퓨린 대사체 검출용 효소 조성물에 있어서 예의 연구 검토한 결과,As a result of extensive studies in the enzyme composition for purine metabolite detection for tumor diagnosis of the present invention,

일반인과 비교해볼 때 종양 발생 환자의 경우 소변 내에 존재하는 퓨린 대사체의 농도가 낮아져, 상기 퓨린 대사체를 종양 발생 진단용 바이오마커로서 사용할 수 있음을 알아내었다.Compared with the general population, it has been found that the concentration of purine metabolites present in urine is low in patients with tumor development, and the purine metabolites can be used as a biomarker for tumor development.

따라서 본 발명의 목적은 피검체의 소변 내에 존재하는 퓨린 대사체를 본 발명에 따른 효소 조성물과 반응시키고, 상기 반응 과정에서 나타나는 색 변화를 흡광도 측정을 통해 소변 내 퓨린 대사체의 농도를 산출하여 종양 발생 여부를 진단할 수 있는 측정장치를 제공하는 것이다. Therefore, an object of the present invention is to react the purine metabolite present in the subject's urine with the enzyme composition according to the present invention, and calculate the concentration of the purine metabolite in the urine through absorbance measurement of color changes occurring in the reaction process. It is to provide a measuring device capable of diagnosing occurrence.

본 발명에 따른 종양 진단을 위한 퓨린 대사체의 농도 측정장치는 검체가 투입되는 검체 투입부, 산화제 및 반응제를 포함하여 상기 검체 투입부로 투입된 상기 검체를 전달받아 상기 검체에 포함되어 있는 퓨린 대사체를 상기 산화제를 이용하여 산화시키는 과정에서 발생하는 수소이온과 상기 반응제가 반응하여 상기 반응제가 변색되는 종양검출부를 포함한다.The apparatus for measuring the concentration of a purine metabolite for tumor diagnosis according to the present invention is a purine metabolite contained in the sample after receiving the sample introduced into the sample input part, including a sample input part, an oxidizing agent, and a reactant. And a tumor detection unit in which the reactant reacts with hydrogen ions generated in the process of oxidizing using the oxidizing agent to discolor the reactant.

본 발명에 따른 측정장치는 소변 내에 존재하는 퓨린 대사체의 농도를 비침습적인 방법으로 검출하여 체내 종양 (악성 또는 양성) 발생 여부를 조기에 진단할 수 있다. 따라서 치료의 방향과 정도를 예측할 수 있으므로 효과적인 치료는 물론 막대하게 지출될 수 있는 종양의 치료비를 감소할 수 있다. The measuring device according to the present invention can detect the concentration of the purine metabolite present in the urine by a non-invasive method and diagnose the tumor (malignant or benign) in the body early. Therefore, since the direction and extent of treatment can be predicted, it is possible to reduce the treatment cost of tumors that can be expended enormously as well as effective treatment.

또한, 본 발명에 따른 측정장치는 종래 사용되는 장비 (핵자기공명(NMR) 등)를 이용하지 않으면서도 실험자의 편차나 소변 샘플의 전처리 등 일련의 과정 없이 보다 용이하게 종양 발생 여부를 진단할 수 있다.In addition, the measuring device according to the present invention can more easily diagnose whether a tumor has occurred without a series of processes such as experimenter deviation or pre-treatment of urine samples without using conventionally used equipment (nuclear magnetic resonance (NMR)). have.

도 1은 본 발명의 바람직한 실시예에 따른 종양 진단을 위한 퓨린 대사체의 농도 측정장치의 구성도이다.
도 2 내지 도 3은 도 1에 따른 종양 진단을 위한 퓨린 대사체의 농도 측정장치의 사시도 및 내부 구조도이다.
도 4는 분석적 성능을 확인한 그래프이다.
도 5는 검출한계, 정량한계 및 직진성을 확인한 그래프이다.
도 6은 임상적 성능(췌장암)을 확인한 그래프이다.
도 7은 임상적 성능(대장암)을 확인한 그래프이다.
도 8은 키트의 형태에 관한 사진이다.
도 9는 잔틴 산화효소 발현 벡터 맵(xanthine oxidase expression vector map) 이다. 1 is a block diagram of a device for measuring the concentration of purine metabolites for tumor diagnosis according to a preferred embodiment of the present invention.
2 to 3 are perspective and internal structural diagrams of a concentration measuring device for purine metabolites for tumor diagnosis according to FIG. 1.
4 is a graph confirming analytical performance.
5 is a graph confirming the detection limit, quantitative limit and straightness.
6 is a graph confirming clinical performance (pancreatic cancer).
7 is a graph confirming clinical performance (colorectal cancer).
8 is a photograph of the form of the kit.
9 is a xanthine oxidase expression vector map.

본 발명의 바람직한 실시예에 따른 종양 진단을 위한 퓨린 대사체의 농도 측정장치(10, 이하 "측정장치"로 칭한다.)는 도 1에 도시된 바와 같이 크게 검체 투입부(20), 종양검출부(30), 제어부(40), 색상안내부(50) 및 통신부(60)로 이루어진다. 본 발명의 바람직한 실시예에 따른 측정장치(10)는 검체를 측정장치에 직접 투입하는 형태, 스트립(Strip)을 장치에 장착한 후 검체를 투입하는 형태, 일반 개인이 사용하는 형태 또는 기관에서 복수의 검체를 분석하는 형태등 다양한 형태로 이루어질 수 있으며, 본 설명에서는 도 2 및 도 3과 같이 일반 개인이 검체를 측정장치에 직접 투입하여 측정하는 형태를 예시로 하여 설명하기로 한다.Purine metabolite concentration measurement device for tumor diagnosis according to a preferred embodiment of the present invention (10, hereinafter referred to as "measurement device") is largely as shown in Figure 1 sample input section 20, tumor detection section ( 30), a control unit 40, a color guide unit 50 and a communication unit 60. The measuring device 10 according to the preferred embodiment of the present invention is a form in which a sample is directly inserted into a measuring device, a form in which a sample is inserted after a strip is mounted on the device, a form used by a general individual, or a plurality of organs It can be made in a variety of forms, such as the form of analyzing the sample, and in this description, a description will be given by taking a form in which a general individual directly measures the sample by measuring the sample.

먼저 상기 검체 투입부(20)는 상기 측정장치(10)를 형성하는 본체부(100)의 일측에 구비될 수 있으며 검체(500)를 상기 측정장치(10)내로 투입하기 위한 부분으로서 투입구가 형성된 개방된 형태, 투입구에 개폐 가능한 마개가 형성된 형태, 또는 일정량의 검체(500)만 투입할 수 있도록 검체 투입량을 조절하기 위한 수단이 구비된 형태 등 다양한 형태로 구성가능하다.First, the sample input unit 20 may be provided on one side of the body unit 100 forming the measuring device 10, and an input port is formed as a portion for introducing the sample 500 into the measurement device 10. It can be configured in a variety of forms, such as an open form, a form with a stopper that can be opened and closed at the inlet, or a means for adjusting the amount of the sample so that only a certain amount of the sample 500 can be introduced.

다음으로 상기 종양 검출부(30)는 산화제 및 반응제를 포함하여 상기 검체 부입부(20)로 투입된 상기 검체(500)를 전달받아 상기 검체(500)에 포함되어 있는 하이포잔틴을 상기 산화제를 이용하여 상기 하이포잔틴을 잔틴 및 요산으로 산화시키는 과정에서 발생하는 수소이온과 상기 반응제가 반응하여 상기 반응제가 변색되는 부분으로서 도 2 및 도 3에 도시된 바와 같이 상기 본체부(100)에 착탈 가능하게 구비된 컵(200) 형태로 구비되며 상기 산화제 및 반응제는 상기 컵(200)의 내측에 코팅 처리된 코팅층(210) 형태로 구비될 수 있다.Next, the tumor detection unit 30 receives the sample 500 input to the sample injection unit 20 including an oxidizing agent and a reactant, and uses hypoxanthine contained in the sample 500 using the oxidizing agent. Hydrogen ions generated in the process of oxidizing hypoxanthine to xanthine and uric acid react with the reactant to discolor the reactant and are detachably provided on the main body 100 as shown in FIGS. 2 and 3. The cup 200 is provided in the form, and the oxidizing agent and the reactant may be provided in the form of a coating layer 210 coated on the inside of the cup 200.

즉, 사용자의 사용 편의성을 향상시키기 위하여 컵(200)의 내측에 상기 산화제 및 반응제를 코팅층(210) 형태로 구비하여 줌으로써 사용자는 상기 컵(200)에 검체(500)를 투입하여 상기 산화제 및 반응제와 검체(500)와의 반응을 통해 일어나는 색상변화를 통해 종양여부를 판단할 수 있다.That is, by providing the oxidizing agent and the reactant in the form of a coating layer 210 inside the cup 200 in order to improve the user's ease of use, the user inserts a sample 500 into the cup 200 to oxidize and It is possible to determine whether or not a tumor is caused by a color change occurring through a reaction between a reagent 500 and a reagent.

그러나 이와 같은 실시예와 달리 사용자의 선택에 따라 상기 산화제 및 반응제를 코팅층(210) 형태가 아닌 용액 형태로 상기 검체(500)의 투입 여부를 감지하여 일정량의 산화제 및 반응제를 투입하는 형태, 또는 젤 및 분말 형태등 사용자의 선택에 따라 다양한 형태로 실시 가능하다.However, unlike this embodiment, according to the user's choice, the type of the oxidizing agent and the reactant is detected in the form of a solution rather than the coating layer 210, and the sample 500 is detected, and a certain amount of the oxidizing agent and the reactant are added. Or it can be implemented in various forms depending on the user's choice, such as gel and powder form.

그리고 사용자의 선택에 따라 상기 측정장치(10) 내에 별도의 구분된 공간을 구비한 후 상기 산화제 및 반응제를 각각 투입하는 형태 또한 가능하다.In addition, according to a user's selection, a separate space is provided in the measurement device 10 and then the oxidizing agent and the reactant are respectively added.

즉, 도 1에 도시된 바와 같이 상기 종양 검출부(30)를 산화부(32), 색상 변화부(34)로 구별된 공간으로 각각 구비하여 준 후 상기 산화부(32) 및 색상 변화부(34)에 산화제 및 반응제를 각각 구비하여 준 후 상기 검체가 상기 산화부(32) 및 색상 변화부(34)를 통과하면서 상기 산화제 및 반응제와 반응하도록 구비하여 준다.That is, as shown in FIG. 1, the tumor detection unit 30 is provided as a space divided into an oxidation unit 32 and a color change unit 34, and then the oxidation unit 32 and color change unit 34 are provided. ) Is provided with an oxidizing agent and a reactant, and then the sample is provided to react with the oxidizing agent and the reactant while passing through the oxidizing part 32 and the color changing part 34.

여기서 상기 산화부(32) 및 색상 변화부(34)는 상기 검체가 이동하는 유로상에 각각 구비하여 주며 사용자가 상기 산화부(32) 및 색상 변화부(34)를 통과하는 검체의 이동을 제어할 수 있는 별도의 제어수단을 구비하여 줄 수 있다.Here, the oxidation unit 32 and the color changing unit 34 are respectively provided on the flow path through which the sample moves, and a user controls movement of the sample passing through the oxidation unit 32 and the color changing unit 34. It can be provided with a separate control means that can be.

그리고 상기 종양 검출부(30)에는 상기 산화부(32)에서 생성되는 수소이온을 포집하기 위한 별도의 수소이온 포집부(36)를 구비하여 줄 수 있다. 상기 수소 이온 포집부(36)는 수소 이온을 포집하기 위한 전극, 나노 분리막 등 다양한 형태로 구비하여 주며 상기 수소 이온 포집부(30)에 반응제를 투입하여 주거나, 수소가 포집된 상기 수소 이온 포집부(30)를 상기 색상 변화부(34)에 투입시켜 색상변화가 일어나도록 구비하여 줄 수 있다.In addition, the tumor detection unit 30 may be provided with a separate hydrogen ion collection unit 36 for collecting hydrogen ions generated by the oxidation unit 32. The hydrogen ion collecting unit 36 is provided in various forms such as an electrode for collecting hydrogen ions, a nano-separation membrane, etc., and a reagent is injected into the hydrogen ion collecting unit 30, or the hydrogen ion is collected by hydrogen. The unit 30 may be provided to the color changing unit 34 to provide a color change.

다음으로 상기 색상 안내부(50)는 상기 종양 검출부(30)를 통해 색상이 변색된 반응제의 변색 정도를 사용자에게 안내하기 위한 장치로서 도 2에 도시된 형태와 같이 투명 유리 형태의 안내창(400)으로 구비된다.Next, the color guide unit 50 is a device for guiding the user of the discoloration degree of a color-discolored reagent through the tumor detection unit 30 to the user. 400).

그러나 사용자에게 보다 정확한 반응제의 변색 정도를 안내하기 위하여 별도의 광원(314) 및 색변화 검출 센서(314)를 구비하여 주고 이를 통해 측정된 데이터를 사용자에게 안내하는 디스플레이 수단(300)을 구비하여 줄 수 있다.However, a separate light source 314 and a color change detection sensor 314 are provided to guide the user to more accurate discoloration of the reactant, and display means 300 is provided to guide the measured data to the user. Can give.

또는 사용자의 선택에 따라서는 상기 검출 센서(314)를 통해 검출된 데이터를 분석하여 사용자에게 직접 종양의 유무를 안내하여 줄 수 있다.Alternatively, depending on the user's selection, the data detected through the detection sensor 314 may be analyzed to guide the presence or absence of a tumor directly to the user.

상기 검출 센서(314)는 파장(UV, 가시광선 등)을 측정하고 이를 사용자에게 안내하는 등 공지된 다양한 색 변화 검출 기술을 이용가능하다.The detection sensor 314 may use a variety of known color change detection techniques, such as measuring a wavelength (UV, visible light, etc.) and guiding it to a user.

상기 제어부(40)는 이와 같은 측정장치(10)를 제어하기 위한 제어수단으로서 사용자가 측정장치(10)의 작동을 제어하기 위한 제어 데이터 값을 입력하면 이에 따라 상기 측정장치(10)를 제어하거나 미리 입력된 제어 데이터 값에 따라 상기 측정장치(10)를 제어한다.The control unit 40 is a control means for controlling the measuring device 10, when the user inputs a control data value for controlling the operation of the measuring device 10, the control device 10 is controlled accordingly or The measuring device 10 is controlled according to a previously input control data value.

상기 사용자가 측정장치(10)를 제어하기 위한 입력장치(도시하지 않음)는 상기 측정장치(10)에 별도로 구비되는 터치 패널 형태의 디스플레이수단을 이용하거나 사용자의 스마트 기기를 상기 통신부(60)를 통해 상기 측정장치(10)와 연동하도록 구비하여 줄 수 있다.The input device (not shown) for the user to control the measurement device 10 uses the display means in the form of a touch panel provided separately in the measurement device 10 or the user's smart device to the communication unit 60 It can be provided to interlock with the measuring device 10 through.

상기 통신장치(60)는 검체(500)의 측정정보를 사용자에게 안내하거나 별도의 의료기관 데이터베이스 장치와 연동되어 이를 의료기관에 전송가능하도록 구비하여 줄 수 있다.The communication device 60 may provide measurement information of the sample 500 to a user or be provided to be transmitted to a medical institution in connection with a separate medical institution database device.

본 발명의 바람직한 실시예에 따른 측정장치(10)는 이와 같은 간단한 구성을 통하여 사용자의 검체(500)를 측정하여 종양 여부를 판단하여 사용자의 편의성을 향상시킬 수 있다.The measuring device 10 according to the preferred embodiment of the present invention can improve the user's convenience by measuring the user's sample 500 through this simple configuration to determine whether or not it is a tumor.

이하에서는 이와 같은 측정장치(10)에 구비되는 산화제 및 반응제에 대하여 자세히 설명하기로 한다.Hereinafter, the oxidizing agent and the reactant provided in the measuring device 10 will be described in detail.

먼저, 상기 산화제는 잔틴 산화효소 (Xanthine Oxidase)이며, 상기 반응제는 잔1-메톡시 PMS (1-Methoxy-5-methylphenazinium methylsulfate, MePMS) 및 EZ-cytox (WST-8)이며 상기 반응제는 포타슘포스페이트 완충용액과 NP-40을 더 포함한다.First, the oxidizing agent is xanthine oxidase (Xanthine Oxidase), and the reacting agent is xanthine-methoxy PMS (1-Methoxy-5-methylphenazinium methylsulfate, MePMS) and EZ-cytox (WST-8). It further contains a potassium phosphate buffer solution and NP-40.

본 발명은 소변 내에 존재하는 퓨린 대사체의 농도를 검출하기 위한, 잔틴 산화효소(Xanthine Oxidase), 1-메톡시 PMS(1-Methoxy-5-methylphenazinium methylsulfate, MePMS), EZ-cytox(WST-8) 및 포타슘포스페이트 완충용액을 포함하는 종양 진단을 위한 퓨린 대사체 검출용 효소 조성물을 포함한다.The present invention is to detect the concentration of purine metabolites present in urine, xanthine oxidase (Xanthine Oxidase), 1-methoxy PMS (1-Methoxy-5-methylphenazinium methylsulfate, MePMS), EZ-cytox (WST-8 ) And potassium phosphate buffer solution.

상기 포타슘포스페이트 완충용액은 NP-40을 추가로 포함할 수 있다.The potassium phosphate buffer solution may further include NP-40.

상기 EZ-cytox는 수용성의 테트라졸리움염(tetrazolium salt)을 이용한 세포증식 / 독성 측정 키트이다.The EZ-cytox is a cell proliferation / toxicity measurement kit using a water-soluble tetrazolium salt.

상기 효소 조성물은 췌장암, 대장암 등의 진단에 사용될 수 있으나, 이에 제한되는 것은 아니다.The enzyme composition may be used for diagnosis of pancreatic cancer and colon cancer, but is not limited thereto.

본 발명에 대해 구체적으로 설명하면, 퓨린 대사체인 하이포잔틴과 잔틴은 잔틴 산화효소로 인해 각각 잔틴, 요산으로 산화된다 (그림 1 참조). 이 과정에서 아래 반응식 1과 같이 2개의 산소와 2개의 수소가 발생한다.When specifically describing the present invention, hypoxanthine and xanthine, which are purine metabolites, are oxidized to xanthine and uric acid, respectively, by xanthine oxidase (see Figure 1). In this process, as shown in Reaction Scheme 1 below, two oxygen and two hydrogen are generated.

[그림 1][Figure 1]

Figure 112017131123698-pat00001
Figure 112017131123698-pat00001

[반응식 1][Scheme 1]

R-H + H2O + 2O2 -> ROH + 2O2- + 2H+ RH + H 2 O + 2O 2 -> ROH + 2O 2- + 2H +

상기 반응 과정에서 생성된 수소 이온은 EZ-cytox (WST-8, water soluble tetrazolium salt)의 구조를 포르마잔(Formazan) 형태로 변형시킨다(그림 2 참조).Hydrogen ions generated in the reaction process transform the structure of EZ-cytox (WST-8, water soluble tetrazolium salt) into Formazan (see Figure 2).

[그림 2][Picture 2]

Figure 112017131123698-pat00002
Figure 112017131123698-pat00002

상기 과정에서 원래 EZ-cytox (WST-8)의 색은 옅은 주황색을 나타내나, 포르마잔 형태로 변형되면서 진한 주황색을 나타내게 된다. 또한, 상기 수소 이온이 EZ-cytox와 반응할 수 있도록 하는 것이 1-메톡시 PMS (1-Methoxy-5-methylphenazinium methylsulfate, MePMS)인데, 상기 1-메톡시 PMS가 색상을 유도하는 역할을 한다(그림 3 참조).In the above process, the color of the original EZ-cytox (WST-8) shows a pale orange color, but is transformed into a formazan form, resulting in a dark orange color. In addition, it is 1-methoxy PMS (1-Methoxy-5-methylphenazinium methylsulfate, MePMS) that allows the hydrogen ion to react with EZ-cytox, and the 1-methoxy PMS plays a role in inducing color ( See Figure 3).

[그림 3][Figure 3]

Figure 112017131123698-pat00003
Figure 112017131123698-pat00003

상기 하이포잔틴 및 잔틴이 요산으로 산화되는 과정에서 발생되는 수소 이온의 수는 구조가 변형된 EZ-cytox 포르마잔(Formazan)의 수와 동일하고, 즉 하이포잔틴 및 잔틴의 농도와 동일하다.The number of hydrogen ions generated in the process of hypoxanthine and xanthine being oxidized to uric acid is the same as the number of modified EZ-cytox formazan (Formazan), that is, the concentration of hypoxanthine and xanthine.

따라서, 나타나는 색상이 진한 주황색을 나타낼수록 변형된 포르마잔 구조가 많음을 의미하고, 산화 과정에서 수소 이온이 많이 생성되었음을 의미하며, 이는 체내 퓨린 대사체의 농도가 높음을 의미하므로, 이러한 결과는 주로 종양이 발생하지 않은 일반인에게서 나타날 수 있다.Therefore, the darker the color that appears, the more the formazan structure is modified, which means that more hydrogen ions are generated during the oxidation process, which means that the concentration of purine metabolites in the body is high, and these results are mainly It may occur in the general population without tumors.

반면, 나타나는 색상이 옅은 주황색을 나타낼수록 변형된 포르마잔 구조가 많지 않음을 의미하고, 이는 산화 과정에서 수소 이온이 적게 생성되었기 때문이며, 즉 체내 하이포잔틴 및 잔틴의 농도가 낮음을 의미하므로, 이러한 결과는 주로 종양이 발생한 환자에게서 나타날 수 있다. On the other hand, the lighter the color appears, the less the modified formazan structure is, and this is because less hydrogen ions are generated in the oxidation process, that is, the hypoxanthin and xanthin concentrations in the body are lower. Can occur mainly in patients with tumors.

따라서, 상기 반응은 수소 이온에 의해서 변형된 포르마잔의 농도를 측정함으로써 간접적으로 퓨린 대사체의 농도를 측정하는 방법이며, 소변에는 다양한 물질과 pH로 인해 반응의 정확도는 떨어지나, 본 발명에서는 반응 조성물의 최적화를 통하여 이를 극복하였다. Therefore, the reaction is a method of indirectly measuring the concentration of a purine metabolite by measuring the concentration of formazan modified by hydrogen ions, and the accuracy of the reaction decreases due to various substances and pH in urine, but in the present invention, the reaction composition This was overcome through optimization of .

본 발명에 따른 종양 진단을 위한 퓨린 대사체 농도 측정방법은Purine metabolite concentration measurement method for tumor diagnosis according to the present invention

피검체의 소변 내에 존재하는 퓨린 대사체의 농도를 측정하는 방법으로서,A method for measuring the concentration of a purine metabolite present in the urine of a subject,

상기 효소 조성물을 이용하여 잔틴 산화효소가 하이포잔틴을 잔틴으로, 잔틴을 요산(Uric acid)으로 산화시키는 과정에서 발생되는 수소 이온이 상기 EZ-cytox의 구조를 포르마잔(Formazan) 형태로 변형시키며, 상기 변형 과정에서 색상이 변화하고, 변화된 색상을 흡광도 측정함으로써 소변 내 하이포잔틴 및 잔틴의 농도를 산출하여 종양 발생 여부를 진단하는 것을 특징으로 한다.Hydrogen ions generated in the process of oxidizing xanthine to xanthine and xanthine to uric acid by the xanthine oxidase using the enzyme composition transform the structure of the EZ-cytox into formazan, The color is changed in the transformation process, and the absorbance of the changed color is measured to calculate the concentrations of hypoxanthine and xanthine in the urine and diagnose whether a tumor has occurred.

상기 색상이 옅은 주황색을 나타내는 경우 흡광도는 450 nm에서 0.654 ± 0.0616 (Mean ± SEM) 로, 상기 색상이 진한 주황색을 나타내는 경우 흡광도는 450 nm에서 2.02 ± 0.175 (Mean ± SEM)로 수치화할 수 있다.If the color represents a pale orange, the absorbance can be quantified as 0.654 ± 0.0616 (Mean ± SEM) at 450 nm, and when the color represents a dark orange, the absorbance can be quantified as 2.02 ± 0.175 (Mean ± SEM) at 450 nm.

본 발명의 일 실시형태에서, 상기 측정방법은 피검체의 임상정보, 예를 들면 임상병리학적 검사, 영상의학적 검사와 같은 방법에 의해 수득된 결과가 추가로 사용될 수 있다.In one embodiment of the present invention, the measurement method may further use results obtained by methods such as clinical information of a subject, for example, clinical pathological examination and imaging medical examination.

이하, 실시예에 의해 본 발명을 보다 구체적으로 설명하고자 한다. 이들 실시예는 오직 본 발명을 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 국한되지 않는다는 것은 당업자에게 있어서 자명하다. Hereinafter, the present invention will be described in more detail by examples. It is apparent to those skilled in the art that these examples are only for describing the present invention, and the scope of the present invention is not limited to these examples.

제조예 1: 잔틴 산화효소의 제조 Preparation Example 1: Preparation of xanthine oxidase

잔틴 산화효소(Xanthine oxidase)는 Bos taurus xanthine dehydrogenase (XDH), Accession No. NM_173972.2에서 산화효소(oxidase) 부분의 유전자를 확보하고 대장균에서 단백질 발현 및 발현하여 사용하였다 (도 6 참조). Xanthine oxidase is Bos taurus xanthine dehydrogenase (XDH), Accession No. In NM_173972.2, the gene of the oxidase part was obtained, and the protein was expressed and expressed in E. coli (see FIG. 6).

(1) 잔틴 산화효소(Xanthine oxidase) 유전자 확보 단계(1) Xanthine oxidase gene securing step

NCBI gene bank의 Accession No. NM_173972.2인 Bos taurus xanthine dehydrogenase(XDH)을 기반으로 IDT (Integrated Device Technoligy, INC.,USA)에서 발현 균주인 E.coli (Escherichia coli)에서 최적화 된 코던으로 합성하였다. 합성된 유전자는 5‘ Not I, 3’ NdeI으로 하여 pUCIDT-kan vector에 삽입하였다. Accession No. of NCBI gene bank Based on NM_173972.2, Bos taurus xanthine dehydrogenase (XDH), it was synthesized with optimized codons from the expression strain E .coli ( Escherichia coli) from IDT (Integrated Device Technoligy, INC., USA). The synthesized gene was inserted into pUCIDT-kan vector as 5 'Not I, 3' NdeI.

잔틴 산화효소(Xanthine oxidase)는 상기 방법으로 확보된 유전자를 pET24a 벡터에 삽입하여 6x His 가 C-말단에 부착된 융합단백질 형태로 제작하였고, BL21 (DE3) 대장균에 형질전환시켜 단백질을 제조하였다(도 6 참조). 그 과정은 아래와 같다.Xanthine oxidase (Xanthine oxidase) was prepared in the form of a fusion protein with 6x His attached to the C-terminus by inserting the gene obtained by the above method into the pET24a vector, and transformed into BL21 (DE3) E. coli to prepare a protein ( See Figure 6). The process is as follows.

상기 반응에 사용된 프라이머쌍의 정보는 하기 표 1과 같다.The primer pair information used in the reaction is shown in Table 1 below.

구분division 염기서열Sequence Xanthine oxidaseXanthine oxidase 순방향 프라이머Forward primer GGGAATTCCATATGGATACGGTCGGGAGACCG
(서열목록 1) GGGAATTCCATATGGATACGGTCGGGAGACCG
(SEQ ID NO: 1) 역방향 프라이머Reverse primer CCGCTCGAGctaCGTGGTAAACTTATCCACGCAAG
(서열목록 2)CCGCTCGAGctaCGTGGTAAACTTATCCACGCAAG
(SEQ ID NO: 2)

(2) 형질전환 대장균 배양단계(2) transformation E. coli culture step

a. pET24a 벡터의 NdeI, XhoI 제한효소 자리(site)에 잔틴 산화효소(Xanthine oxidase) 유전자를 삽입함으로써 6x His 융합 단백질을 생산하는 재조합DNA를 완성하였다.a. The recombinant DNA producing 6x His fusion protein was completed by inserting the Xanthine oxidase gene into the NdeI and XhoI restriction sites of the pET24a vector.

b. 생산된 재조합 DNA를 BL21(DE3) 대장균에 형질전환 하였다.b. The produced recombinant DNA was transformed into BL21 (DE3) E. coli.

c. 해당 대장균주를 3 L LB(Luria broth) 배양액에서 16 ℃, 200 rpm 하에서 OD600 ~ 0.7까지 배양 후 0.1M IPTG 를 처리하여 단백질생산을 유도하였다.c. The E. coli strain was cultured in 3 L LB (Luria broth) culture medium at OD600 to 0.7 at 16 ° C and 200 rpm, and then treated with 0.1M IPTG to induce protein production.

(3) 대장균 파쇄 단계(3) Escherichia coli crushing step

a. 배양된 대장균을 원심분리기로 침전 후, 상등액은 버리고 침전된 대장균을 200 ml PBS로 재부유 시켰다가 원심분리기로 침전시킴으로써 세척과정을 수행하였다.a. After the cultured E. coli was precipitated by centrifugation, the supernatant was discarded, and the precipitated E. coli was resuspended in 200 ml PBS, followed by precipitation by centrifugation to perform a washing process.

b. 침전된 대장균에 40 ml- 0.5 M NaCl, 5mM imidazole, 20 mM Tris-HCl, pH 7.9;를 넣고 재부유 시켰다. b. The precipitated E. coli was resuspended with 40 ml-0.5 M NaCl, 5 mM imidazole, 20 mM Tris-HCl, pH 7.9;

c. 초음파 세포파쇄기에서 대장균을 Energy 38% max, 토탈 셀 브레이킹 타임(tal cell breaking time) 10 분(2초 sonic treatment/4초 pause) 조건 하에서 파쇄하였다. 대장균 샘플을 담은 병은 세포파쇄과정동안 얼음에 담긴 상태를 유지하였다.c. In the ultrasonic cell disruptor, E. coli was crushed under the conditions of Energy 38% max, total cell breaking time 10 minutes (2 seconds sonic treatment / 4 seconds pause). The bottles containing E. coli samples remained on ice during the cell disruption process.

d. 파쇄된 대장균은 13000 rpm, 30분, 4 ℃ 조건에서 원심분리 하였다.d. The crushed E. coli was centrifuged at 13000 rpm, 30 minutes and 4 ° C.

e. 원심분리 후 상등액만 코니칼 튜브(conical tube)에 모아두었다.e. After centrifugation, only the supernatant was collected in a conical tube.

(4) Ni-NTA Agarose resin을 이용한 his tag-융합단백질 정제(4) Purification of his tag-fusion protein using Ni-NTA Agarose resin

a. 위의 단계에서 얻어진 수용성 단백질이 포함된 상등액을 Ni-NTA Agarose resin 과 혼합하고 30분간 4 ℃ 조건하에서 흔들어 주면서 his tag-융합단백질과 Ni-NTA Agarose resin이 서로 결합하도록 유도하였다.a. The supernatant containing the water-soluble protein obtained in the above step was mixed with Ni-NTA Agarose resin and shaken at 4 ° C for 30 minutes to induce his tag-fusion protein and Ni-NTA Agarose resin to bind to each other.

b. 수용성 단백질이 포함된 상등액과 resin 혼합액을 컬럼에 투입하고 컬럼 코크를 열어 중력방식으로 액체를 분리하였다.b. The supernatant containing the water-soluble protein and the resin mixture were added to the column and the column coke was opened to separate the liquid by gravity.

c. 워싱 버퍼(Washing buffer) (0.5 M NaCl, 60mM imidazole, 20 mM Tris-HCl, pH 7.9) 400 ml을 통과시켜 불순물과 융합단백질 이외의 단백질을 제거하였다.c. 400 ml of washing buffer (0.5 M NaCl, 60 mM imidazole, 20 mM Tris-HCl, pH 7.9) was passed through to remove impurities and proteins other than the fusion protein.

d. 일루션 버퍼(Elution buffer) (0.25 M NaCl, 500mM imidazole, 20 mM Tris-HCl, pH 7.9) 3 ml을 투입하고 10분간 방치한 후 단백질을 회수하였다.d. 3 ml of Elution buffer (0.25 M NaCl, 500 mM imidazole, 20 mM Tris-HCl, pH 7.9) was added and left to stand for 10 minutes to recover the protein.

e. d 과정을 2회 반복하였다.e. The d process was repeated twice.

(5) FPLC-size exclusion법을 이용한 단백질 정제(5) Protein purification using FPLC-size exclusion method

a. 회수된 단백질을 superdex S200 (GE healthcare) 컬럼이 장착된 FPLC에 투입하고 단백질을 크기에 따라 분리하였다. a. The recovered protein was introduced into a FPLC equipped with a superdex S200 (GE healthcare) column, and the protein was separated according to size.

b. 얻어진 프랙션(fraction) 샘플들 가운데 his tag 융합단백질에 해당하는 프랙션(fraction)을 PAGE(polyacrylamide gel electrophoresis) 법으로 확인하고 최종적으로 원하는 his tag 융합단백질을 확보하였다.b. Among the obtained fraction samples, a fraction corresponding to his tag fusion protein was confirmed by a polyacrylamide gel electrophoresis (PAGE) method, and finally a desired his tag fusion protein was obtained.

c. Abs 280값을 측정하고 얻어진 값으로부터 단백질 농도를 환산하여 하기 표 2에 기재하였다.c. The Abs 280 value was measured and the protein concentration was converted from the obtained value and is shown in Table 2 below.

구분division 단백질 농도(OD280nm)Protein concentration (OD 280 nm) 효소 활성Enzyme activity 1 mg xanthine oxidase/ml1 mg xanthine oxidase / ml 2.422.42 2.7 μU2.7 μU

잔틴 산화효소 DNA 시퀀스(Xanthine oxidase DNA sequence) 및 잔틴 산화효소 단백질 시퀀스(Xanthine oxidase protein sequence)는 각각 서열목록 3 및 4로 첨부하였다.The xanthine oxidase DNA sequence and the xanthine oxidase protein sequence were attached as SEQ ID NOs: 3 and 4, respectively.

또한, 본 발명에서 사용되는 1-메톡시 PMS(1-Methoxy-5-methylphenazinium methylsulfate, MePMS), EZ-cytox (WST-8), 포타슘포스페이트 완충용액 및 NP-40의 구입처는 아래 표 3에 기재하였다. In addition, the place of purchase of 1-methoxy PMS (1-Methoxy-5-methylphenazinium methylsulfate, MePMS), EZ-cytox (WST-8), potassium phosphate buffer solution and NP-40 used in the present invention are listed in Table 3 below. Did.

삭제delete

품명Product Name 회사company 카탈로그 넘버Catalog number EZ-cytoxEZ-cytox ㈜대일랩서비스Daeil Lab Service EZ-3000EZ-3000 1-Methoxy PMS1-Methoxy PMS Dojindo Molecular Technologies, Inc.Dojindo Molecular Technologies, Inc. M003M003 Potossium phosphate monobasicPotossium phosphate monobasic 덕산약품Deoksan Pharmaceutical 432432 NP-40, 70% in H2ONP-40, 70% in H2O Sigma AldrichSigma Aldrich NP-40SNP-40S

실시예 1: 효소 조성물의 제조Example 1: Preparation of enzyme composition

하기 표 4에 작성한 바와 같이, 효소 활성(enzyme activity)이 7.5 μunit/μl인 잔틴 산화 효소(xanthine oxidase) 1 ㎕에 각각 전체 반응 볼륨(100 ㎕)의 10% EZ-Cytox와 0.5% MePMS Mix solution 10.5 ㎕, 0.1% NP-40이 함유된 50 mM potassium Phosphate buffer pH 7.5 Mix solution을 38.5 ㎕ 넣어 효소 반응 조성물 (Reaction mixture) 총 50 ㎕을 제조하였다. As written in Table 4, 10% EZ-Cytox and 0.5% MePMS Mix solution in the total reaction volume (100 μl) in 1 μl of xanthine oxidase having an enzyme activity of 7.5 μunit / μl, respectively. 10.5 µl, 38.5 µl of 50 mM potassium phosphate buffer pH 7.5 Mix solution containing 0.1% NP-40 was added to prepare a total of 50 µl of the enzyme reaction composition.

Reaction mixtureReaction mixture Volume (50 ㎕)Volume (50 μl) 50 mM potassium Phosphate buffer pH7.550 mM potassium Phosphate buffer pH 7.5 38.5 ㎕38.5 μl 0.1% NP-400.1% NP-40 Xanthine oxidase (7.5 μunit/ml)Xanthine oxidase (7.5 μunit / ml) 1 ㎕1 μl 10% EZ-Cytox10% EZ-Cytox 10.5 ㎕10.5 μl 0.5% 1-Methoxy PMS 0.5% 1-Methoxy PMS

실시예 2: 소변 시료 채취 Example 2: Urine sample collection

정상인과 종양 환자의 소변 채취는 동일하며 다음과 같이 수행하였다.Urine collection was the same for normal and tumor patients and was performed as follows.

아침 기상 후 첫 소변을 채취함에 있어 요도로부터 흘러나오는 처음 소변은 채취하지 않으며, 중간 소변에서 샘플을 채취하였다.In the first urine collection after the morning wake-up, the first urine flowing out of the urethra was not collected, and samples were taken from the intermediate urine.

실험예 1: 퓨린 대사체의 농도 측정Experimental Example 1: Purine metabolite concentration measurement

소변 내에 존재하는 퓨린 대사체의 농도를 측정하기 위해 채취된 정상인과 종양 환자의 소변 각각 50 ㎕를 상기 실시예 1의 효소 반응 조성물과 반응시켰다 (각각 총 100 ㎕). 반응물은 실온(25 ℃)에서 차광하여 5분간 반응시키고 ELISA reader를 이용하여 450 nm에서 흡광도를 측정하여 소변 내 농도를 산출하였다. 그 결과를 아래 표 5에 기재하였다.In order to measure the concentration of the purine metabolite present in the urine, 50 µl each of the urine of normal and tumor patients collected was reacted with the enzyme reaction composition of Example 1 (100 µl each). The reaction was shaded at room temperature (25 ° C.) for 5 minutes, and absorbance was measured at 450 nm using an ELISA reader to calculate the concentration in urine. The results are listed in Table 5 below.

구분 division Optical Density(Mean ± SEM)Optical Density (Mean ± SEM) 평균의 차이(Mean ± SEM)Mean difference (Mean ± SEM) 95% CI95% CI 정상인소변 Normal urine 2.02 ± 0.1752.02 ± 0.175 1.37 ± 0.1611.37 ± 0.161 1.05 to 1.691.05 to 1.69 종양환자소변Tumor patient urine 0.654 ± 0.06160.654 ± 0.0616

상기 표 5에서 보듯이, 효소 반응 조성물과 반응하여 산출된 퓨린 대사체의 농도를 정상인의 소변과 종양 환자의 소변과 비교했을 때, 정상인의 소변은 진한 주황색을 나타내는 반면, 종양 환자의 소변은 옅은 주황색을 띄고 있는 것을 확인하였다. As shown in Table 5, when the concentration of the purine metabolite calculated by reacting with the enzyme reaction composition was compared with that of normal humans and urine of tumor patients, the urine of normal humans was dark orange, while the urine of tumor patients was pale. It was confirmed to be orange.

이를 통해, 종양 환자의 소변에서 퓨린 대사체의 농도는 감소됨을 알 수 있었다.Through this, it was found that the concentration of purine metabolites in the urine of tumor patients was reduced.

실험예 2: 분석적 성능 확인Experimental Example 2: Analytical Performance Check

본 발명의 효소 조성물의 분석적 성능을 확인하기 위하여 직선성(linearity), 검출한계 (Limit Of Detect, LOD), 정량한계(Limit Of Quantitation, LOQ), 변동계수(Coefficient of Variation, CV) 등의 항목으로 분석법 검증(validation)을 실시하였다. 본 과정은 효소 조성물이 퓨린 대사체의 농도 의존적으로 반응이 잘 되는지를 검증하는 과정으로, 간략히 설명하면 다음과 같다. In order to confirm the analytical performance of the enzyme composition of the present invention, items such as linearity, limit of detection (LOD), limit of quantitation (LOQ), coefficient of variation (CV), etc. As a result, method validation was performed. This process is a process for verifying that the enzyme composition reacts well depending on the concentration of the purine metabolite, and briefly described as follows.

직진성은 퓨린 대사체 농도 의존적으로 효소 반응이 되고 선형회귀 분석을 통해 검증하는 방법이다. 검출 한계와 정량 한계는 본 발명의 효소 조성물의 퓨린 대사체의 검출 능력을 검증하는 방법이다. 변동 계수는 직진성 실험을 3회 반복 후 편차를 보는 과정이다. Straightness is an enzyme reaction that is dependent on the concentration of purine metabolites and is verified by linear regression analysis. The detection limit and the quantitative limit are methods for verifying the ability of the enzyme composition of the present invention to detect purine metabolites. The coefficient of variation is the process of seeing the deviation after repeating the straightness experiment three times.

분석적 성능을 검증하기 위하여, 퓨린 대사체의 검량선을 그리기 위한 농도로 0, 2, 4, 8, 16, 32 μM 농도의 범위를 설정하였다. 퓨린 대사체의 회귀직선은 y = 0.0013x - 0.0001 , 상관계수 R2(coefficient of correlation)가 0.9987로써 좋은 직선성 (Linearity)을 나타냈고(도 1), LOD (32 μM), LOQ (0, 2, 4, 8, 16, 32 μM), CV(2.8%)를 나타내었다(도 2).To verify the analytical performance, a range of concentrations of 0, 2, 4, 8, 16, 32 μM was set as the concentration for drawing the calibration curve of the purine metabolite. The regression line of the purine metabolite was y = 0.0013x-0.0001, the correlation coefficient R 2 (coefficient of correlation) was 0.9987, showing good linearity (FIG. 1), LOD (32 μM), LOQ (0, 2, 4, 8, 16, 32 μM), and CV (2.8%) (FIG. 2).

실험예 3: 임상적 성능 확인Experimental Example 3: Clinical performance confirmation

본 발명의 효소 조성물을 이용하여 정상인 33명, 췌장암 환자 48명, 대장암 환자 32명의 실험을 진행 하였으며, 임상 시험에 참여한 사람들은 나이, 성별, 암의 종류, 암의 기수, 병리학적 소견, 영상 의학적 소견, 주치의 소견 등으로 분류하여, 본 발명의 효소 조성물을 통한 진단과 비교 하였다(서울 아산병원 연구임상, IRB-20160815).Using the enzyme composition of the present invention, 33 normal subjects, 48 pancreatic cancer patients, and 32 colon cancer patients were tested, and those who participated in the clinical trials were age, sex, type of cancer, radix of the cancer, pathological findings, and imaging It was classified into medical findings and physician's findings, and compared with the diagnosis through the enzyme composition of the present invention (Seoul Asan Hospital clinical trial, IRB-20160815).

그 결과 도 3, 4에 나타낸 바와 같이, 퓨린 대사체 농도는 췌장암, 대장암 환자에서 정상인에 비해 감소하는 것을 확인하였다. 또한, 도 3, 4 에 나타낸 각각의 ROC 곡선에 대한 내용을 아래 표 6에 기재하였다.As a result, as shown in Figs. 3 and 4, it was confirmed that the purine metabolite concentration decreased in patients with pancreatic cancer and colorectal cancer compared to normal people. In addition, the contents of each ROC curve shown in FIGS. 3 and 4 are shown in Table 6 below.

암종carcinoma Pvalue Pvalue AUCAUC 특이도Specificity 민감도responsiveness 우도비 Likelihood 췌장암Pancreatic cancer < 0.0001<0.0001 0.92720.9272 90.32%90.32% 78.72%78.72% 8.138.13 대장암Colorectal cancer < 0.0001<0.0001 0.93660.9366 90.32%90.32% 82.76%82.76% 8.558.55

이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 본 발명이 속한 기술분야에서 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아님은 명백하다. 본 발명이 속한 기술분야에서 통상의 지식을 가진 자라면 상기 내용을 바탕으로 본 발명의 범주 내에서 다양한 응용 및 변형을 행하는 것이 가능할 것이다.Since the specific parts of the present invention have been described in detail above, it is obvious that for those skilled in the art to which the present invention pertains, this specific technology is only a preferred embodiment, and the scope of the present invention is not limited thereto. Do. Those of ordinary skill in the art to which the present invention pertains will be able to make various applications and modifications within the scope of the present invention based on the above.

따라서, 본 발명의 실질적인 범위는 첨부된 특허청구범위와 그의 등가물에 의하여 정의된다고 할 것이다.Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

10: 농도 측정장치 20: 검체 투입부 30:종양검출부
40: 제어부 50: 색상안내부 60: 통신부10: concentration measuring device 20: sample input section 30: tumor detection section
40: control unit 50: color guide unit 60: communication unit

<110> CUBEBIO <120> The diagnosis method for tumor by purine metabolite concentration analysis such as hypoxanthine and xanthine <130> DP18800 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 32 <212> RNA <213> Artificial Sequence <220> <223> Xanthine Oxidase primer <400> 1 gggaattcca tatggatacg gtcgggagac cg 32 <210> 2 <211> 35 <212> RNA <213> Artificial Sequence <220> <223> Xanthine Oxidase primer <400> 2 ccgctcgagc tacgtggtaa acttatccac gcaag 35 <210> 3 <211> 2235 <212> DNA <213> Artificial Sequence <220> <223> Xanthine Oxidase DNA Sequence <400> 3 gatacggtcg ggagaccgct gcctcacttg gctgcagcga tgcaggccag tggagaggct 60 gtatattgtg acgacatacc gcggtatgag aatgaattat ttttacgctt ggttacgtcc 120 acacgcgccc acgctaaaat taaaagcata gatgtctccg aagctcaaaa ggtacctggt 180 tttgtgtgtt ttttatcggc ggatgacata ccaggcagta atgaaacagg tcttttcaat 240 gacgagacag tcttcgcgaa agacactgtc acgtgtgtag ggcacataat tggtgccgtt 300 gtcgctgaca caccggagca tgctgagcgc gcggctcatg tagtgaaagt aacttatgag 360 gaccttccag caataatcac tatagaagac gcaattaaaa acaactcgtt ttatggctct 420 gagcttaaaa ttgaaaaagg tgaccttaaa aagggattct cagaagctga taacgtcgtc 480 tcgggcgaac tgtatatcgg aggtcaggat catttctatt tagaaaccca ctgcacgata 540 gccataccga aaggagagga aggggaaatg gagttatttg tctctacaca gaacgctatg 600 aaaacgcaat ctttcgtagc caaaatgtta ggcgtcccag taaatcgtat tttggtccgg 660 gttaagagaa tgggaggtgg attcgggggt aaggagactc gctctacttt agtttccgtc 720 gccgttgcgc tggcagcata caagacaggt catcctgtgc gctgcatgct ggaccggaac 780 gaagacatgc tgatcacggg tggccggcac cccttcttag cacgctataa ggtcggcttc 840 atgaagaccg gaacgatcgt tgcccttgag gtcgatcact atagcaacgc gggaaactca 900 cgtgatctgt cccattctat tatggaacgg gctttatttc acatggacaa ctgctataag 960 atcccaaaca ttcgtggcac aggtagactt tgtaaaacga atttaagctc gaatacagcg 1020 ttcagaggct ttggaggtcc gcaagctctt ttcatagcag agaactggat gagcgaggtt 1080 gctgtaacat gtggtttacc tgcagaagaa gtccgctgga agaatatgta taaggaaggg 1140 gatttgacac atttcaatca gcgtttagaa ggattcagtg ttcccagatg ttgggatgaa 1200 tgcttgaaaa gttcgcaata ctatgcgcgt aagtcggagg tagacaagtt taataaggag 1260 aattgttgga aaaagagagg actgtgcatt attccaacaa aatttggtat atcgtttacc 1320 gtaccctttt taaatcaagc aggagccttg atccatgtgt atacagatgg ttccgttctg 1380 gtaagtcacg gcggaacaga gatggggcaa ggtttacaca ctaagatggt acaagttgct 1440 agtaaagctc tgaagattcc tatatccaag atttatataa gcgaaacatc taccaacacg 1500 gttcctaaca gttcgccgac agcggcgtcg gtgagtacag atatctacgg acaggcggtc 1560 tatgaggctt gtcaaacgat acttaagcgc ttggagccct ttaagaaaaa aaatccggac 1620 ggaagttggg aggattgggt catggcggca taccaagata gagtaagtct ttccacgacg 1680 ggattctatc gtaccccaaa cctgggatat tcctttgaaa ccaactcagg taatgctttt 1740 cattatttta catacggtgt ggcatgcagc gaggtggaaa ttgattgttt aaccggagac 1800 cacaagaacc tgcgcaccga cattgttatg gatgtgggtt cctccttaaa tcccgccata 1860 gatatcggcc aggtagaagg tgcatttgtc caaggtttag gtctgttcac actggaggag 1920 cttcattact ctccagaagg ctcccttcac acgcggggac cctcaacata taaaattccg 1980 gcattcggtt ctattccgac ggagtttaga gtttctttgt tgcgcgactg cccgaacaag 2040 aaggccatct atgcttctaa agcggtcggg gagcccccgt tgttcctggg tgcgagcgtg 2100 ttttttgcaa tcaaggacgc tatacgcgcg gctagagcgc agcatactaa taacaatacg 2160 aaggaactgt tccgcctgga tagcccggcc acgcccgaaa aaatccggaa tgcttgcgtg 2220 gataagttta ccacg 2235 <210> 4 <211> 645 <212> PRT <213> Artificial Sequence <220> <223> Xanthine Oxidase Protein Sequence <400> 4 Val Ala Asp Thr Pro Glu His Ala Glu Arg Ala Ala His Val Val Lys 1 5 10 15 Val Thr Tyr Glu Asp Leu Pro Ala Ile Ile Thr Ile Glu Asp Ala Ile 20 25 30 Lys Asn Asn Ser Phe Tyr Gly Ser Glu Leu Lys Ile Glu Lys Gly Asp 35 40 45 Leu Lys Lys Gly Phe Ser Glu Ala Asp Asn Val Val Ser Gly Glu Leu 50 55 60 Tyr Ile Gly Gly Gln Asp His Phe Tyr Leu Glu Thr His Cys Thr Ile 65 70 75 80 Ala Ile Pro Lys Gly Glu Glu Gly Glu Met Glu Leu Phe Val Ser Thr 85 90 95 Gln Asn Ala Met Lys Thr Gln Ser Phe Val Ala Lys Met Leu Gly Val 100 105 110 Pro Val Asn Arg Ile Leu Val Arg Val Lys Arg Met Gly Gly Gly Phe 115 120 125 Gly Gly Lys Glu Thr Arg Ser Thr Leu Val Ser Val Ala Val Ala Leu 130 135 140 Ala Ala Tyr Lys Thr Gly His Pro Val Arg Cys Met Leu Asp Arg Asn 145 150 155 160 Glu Asp Met Leu Ile Thr Gly Gly Arg His Pro Phe Leu Ala Arg Tyr 165 170 175 Lys Val Gly Phe Met Lys Thr Gly Thr Ile Val Ala Leu Glu Val Asp 180 185 190 His Tyr Ser Asn Ala Gly Asn Ser Arg Asp Leu Ser His Ser Ile Met 195 200 205 Glu Arg Ala Leu Phe His Met Asp Asn Cys Tyr Lys Ile Pro Asn Ile 210 215 220 Arg Gly Thr Gly Arg Leu Cys Lys Thr Asn Leu Ser Ser Asn Thr Ala 225 230 235 240 Phe Arg Gly Phe Gly Gly Pro Gln Ala Leu Phe Ile Ala Glu Asn Trp 245 250 255 Met Ser Glu Val Ala Val Thr Cys Gly Leu Pro Ala Glu Glu Val Arg 260 265 270 Trp Lys Asn Met Tyr Lys Glu Gly Asp Leu Thr His Phe Asn Gln Arg 275 280 285 Leu Glu Gly Phe Ser Val Pro Arg Cys Trp Asp Glu Cys Leu Lys Ser 290 295 300 Ser Gln Tyr Tyr Ala Arg Lys Ser Glu Val Asp Lys Phe Asn Lys Glu 305 310 315 320 Asn Cys Trp Lys Lys Arg Gly Leu Cys Ile Ile Pro Thr Lys Phe Gly 325 330 335 Ile Ser Phe Thr Val Pro Phe Leu Asn Gln Ala Gly Ala Leu Ile His 340 345 350 Val Tyr Thr Asp Gly Ser Val Leu Val Ser His Gly Gly Thr Glu Met 355 360 365 Gly Gln Gly Leu His Thr Lys Met Val Gln Val Ala Ser Lys Ala Leu 370 375 380 Lys Ile Pro Ile Ser Lys Ile Tyr Ile Ser Glu Thr Ser Thr Asn Thr 385 390 395 400 Val Pro Asn Ser Ser Pro Thr Ala Ala Ser Val Ser Thr Asp Ile Tyr 405 410 415 Gly Gln Ala Val Tyr Glu Ala Cys Gln Thr Ile Leu Lys Arg Leu Glu 420 425 430 Pro Phe Lys Lys Lys Asn Pro Asp Gly Ser Trp Glu Asp Trp Val Met 435 440 445 Ala Ala Tyr Gln Asp Arg Val Ser Leu Ser Thr Thr Gly Phe Tyr Arg 450 455 460 Thr Pro Asn Leu Gly Tyr Ser Phe Glu Thr Asn Ser Gly Asn Ala Phe 465 470 475 480 His Tyr Phe Thr Tyr Gly Val Ala Cys Ser Glu Val Glu Ile Asp Cys 485 490 495 Leu Thr Gly Asp His Lys Asn Leu Arg Thr Asp Ile Val Met Asp Val 500 505 510 Gly Ser Ser Leu Asn Pro Ala Ile Asp Ile Gly Gln Val Glu Gly Ala 515 520 525 Phe Val Gln Gly Leu Gly Leu Phe Thr Leu Glu Glu Leu His Tyr Ser 530 535 540 Pro Glu Gly Ser Leu His Thr Arg Gly Pro Ser Thr Tyr Lys Ile Pro 545 550 555 560 Ala Phe Gly Ser Ile Pro Thr Glu Phe Arg Val Ser Leu Leu Arg Asp 565 570 575 Cys Pro Asn Lys Lys Ala Ile Tyr Ala Ser Lys Ala Val Gly Glu Pro 580 585 590 Pro Leu Phe Leu Gly Ala Ser Val Phe Phe Ala Ile Lys Asp Ala Ile 595 600 605 Arg Ala Ala Arg Ala Gln His Thr Asn Asn Asn Thr Lys Glu Leu Phe 610 615 620 Arg Leu Asp Ser Pro Ala Thr Pro Glu Lys Ile Arg Asn Ala Cys Val 625 630 635 640 Asp Lys Phe Thr Thr 645 <110> CUBEBIO <120> The diagnosis method for tumor by purine metabolite concentration          analysis such as hypoxanthine and xanthine <130> DP18800 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 32 <212> RNA <213> Artificial Sequence <220> <223> Xanthine Oxidase primer <400> 1 gggaattcca tatggatacg gtcgggagac cg 32 <210> 2 <211> 35 <212> RNA <213> Artificial Sequence <220> <223> Xanthine Oxidase primer <400> 2 ccgctcgagc tacgtggtaa acttatccac gcaag 35 <210> 3 <211> 2235 <212> DNA <213> Artificial Sequence <220> <223> Xanthine Oxidase DNA Sequence <400> 3 gatacggtcg ggagaccgct gcctcacttg gctgcagcga tgcaggccag tggagaggct 60 gtatattgtg acgacatacc gcggtatgag aatgaattat ttttacgctt ggttacgtcc 120 acacgcgccc acgctaaaat taaaagcata gatgtctccg aagctcaaaa ggtacctggt 180 tttgtgtgtt ttttatcggc ggatgacata ccaggcagta atgaaacagg tcttttcaat 240 gacgagacag tcttcgcgaa agacactgtc acgtgtgtag ggcacataat tggtgccgtt 300 gtcgctgaca caccggagca tgctgagcgc gcggctcatg tagtgaaagt aacttatgag 360 gaccttccag caataatcac tatagaagac gcaattaaaa acaactcgtt ttatggctct 420 gagcttaaaa ttgaaaaagg tgaccttaaa aagggattct cagaagctga taacgtcgtc 480 tcgggcgaac tgtatatcgg aggtcaggat catttctatt tagaaaccca ctgcacgata 540 gccataccga aaggagagga aggggaaatg gagttatttg tctctacaca gaacgctatg 600 aaaacgcaat ctttcgtagc caaaatgtta ggcgtcccag taaatcgtat tttggtccgg 660 gttaagagaa tgggaggtgg attcgggggt aaggagactc gctctacttt agtttccgtc 720 gccgttgcgc tggcagcata caagacaggt catcctgtgc gctgcatgct ggaccggaac 780 gaagacatgc tgatcacggg tggccggcac cccttcttag cacgctataa ggtcggcttc 840 atgaagaccg gaacgatcgt tgcccttgag gtcgatcact atagcaacgc gggaaactca 900 cgtgatctgt cccattctat tatggaacgg gctttatttc acatggacaa ctgctataag 960 atcccaaaca ttcgtggcac aggtagactt tgtaaaacga atttaagctc gaatacagcg 1020 ttcagaggct ttggaggtcc gcaagctctt ttcatagcag agaactggat gagcgaggtt 1080 gctgtaacat gtggtttacc tgcagaagaa gtccgctgga agaatatgta taaggaaggg 1140 gatttgacac atttcaatca gcgtttagaa ggattcagtg ttcccagatg ttgggatgaa 1200 tgcttgaaaa gttcgcaata ctatgcgcgt aagtcggagg tagacaagtt taataaggag 1260 aattgttgga aaaagagagg actgtgcatt attccaacaa aatttggtat atcgtttacc 1320 gtaccctttt taaatcaagc aggagccttg atccatgtgt atacagatgg ttccgttctg 1380 gtaagtcacg gcggaacaga gatggggcaa ggtttacaca ctaagatggt acaagttgct 1440 agtaaagctc tgaagattcc tatatccaag atttatataa gcgaaacatc taccaacacg 1500 gttcctaaca gttcgccgac agcggcgtcg gtgagtacag atatctacgg acaggcggtc 1560 tatgaggctt gtcaaacgat acttaagcgc ttggagccct ttaagaaaaa aaatccggac 1620 ggaagttggg aggattgggt catggcggca taccaagata gagtaagtct ttccacgacg 1680 ggattctatc gtaccccaaa cctgggatat tcctttgaaa ccaactcagg taatgctttt 1740 cattatttta catacggtgt ggcatgcagc gaggtggaaa ttgattgttt aaccggagac 1800 cacaagaacc tgcgcaccga cattgttatg gatgtgggtt cctccttaaa tcccgccata 1860 gatatcggcc aggtagaagg tgcatttgtc caaggtttag gtctgttcac actggaggag 1920 cttcattact ctccagaagg ctcccttcac acgcggggac cctcaacata taaaattccg 1980 gcattcggtt ctattccgac ggagtttaga gtttctttgt tgcgcgactg cccgaacaag 2040 aaggccatct atgcttctaa agcggtcggg gagcccccgt tgttcctggg tgcgagcgtg 2100 ttttttgcaa tcaaggacgc tatacgcgcg gctagagcgc agcatactaa taacaatacg 2160 aaggaactgt tccgcctgga tagcccggcc acgcccgaaa aaatccggaa tgcttgcgtg 2220 gataagttta ccacg 2235 <210> 4 <211> 645 <212> PRT <213> Artificial Sequence <220> <223> Xanthine Oxidase Protein Sequence <400> 4 Val Ala Asp Thr Pro Glu His Ala Glu Arg Ala Ala His Val Val Lys   1 5 10 15 Val Thr Tyr Glu Asp Leu Pro Ala Ile Ile Thr Ile Glu Asp Ala Ile              20 25 30 Lys Asn Asn Ser Phe Tyr Gly Ser Glu Leu Lys Ile Glu Lys Gly Asp          35 40 45 Leu Lys Lys Gly Phe Ser Glu Ala Asp Asn Val Val Ser Gly Glu Leu      50 55 60 Tyr Ile Gly Gly Gln Asp His Phe Tyr Leu Glu Thr His Cys Thr Ile  65 70 75 80 Ala Ile Pro Lys Gly Glu Glu Gly Glu Met Glu Leu Phe Val Ser Thr                  85 90 95 Gln Asn Ala Met Lys Thr Gln Ser Phe Val Ala Lys Met Leu Gly Val             100 105 110 Pro Val Asn Arg Ile Leu Val Arg Val Lys Arg Met Gly Gly Gly Phe         115 120 125 Gly Gly Lys Glu Thr Arg Ser Thr Leu Val Ser Val Ala Val Ala Leu     130 135 140 Ala Ala Tyr Lys Thr Gly His Pro Val Arg Cys Met Leu Asp Arg Asn 145 150 155 160 Glu Asp Met Leu Ile Thr Gly Gly Arg His Pro Phe Leu Ala Arg Tyr                 165 170 175 Lys Val Gly Phe Met Lys Thr Gly Thr Ile Val Ala Leu Glu Val Asp             180 185 190 His Tyr Ser Asn Ala Gly Asn Ser Arg Asp Leu Ser His Ser Ile Met         195 200 205 Glu Arg Ala Leu Phe His Met Asp Asn Cys Tyr Lys Ile Pro Asn Ile     210 215 220 Arg Gly Thr Gly Arg Leu Cys Lys Thr Asn Leu Ser Ser Asn Thr Ala 225 230 235 240 Phe Arg Gly Phe Gly Gly Pro Gln Ala Leu Phe Ile Ala Glu Asn Trp                 245 250 255 Met Ser Glu Val Ala Val Thr Cys Gly Leu Pro Ala Glu Glu Val Arg             260 265 270 Trp Lys Asn Met Tyr Lys Glu Gly Asp Leu Thr His Phe Asn Gln Arg         275 280 285 Leu Glu Gly Phe Ser Val Pro Arg Cys Trp Asp Glu Cys Leu Lys Ser     290 295 300 Ser Gln Tyr Tyr Ala Arg Lys Ser Glu Val Asp Lys Phe Asn Lys Glu 305 310 315 320 Asn Cys Trp Lys Lys Arg Gly Leu Cys Ile Ile Pro Thr Lys Phe Gly                 325 330 335 Ile Ser Phe Thr Val Pro Phe Leu Asn Gln Ala Gly Ala Leu Ile His             340 345 350 Val Tyr Thr Asp Gly Ser Val Leu Val Ser His Gly Gly Thr Glu Met         355 360 365 Gly Gln Gly Leu His Thr Lys Met Val Gln Val Ala Ser Lys Ala Leu     370 375 380 Lys Ile Pro Ile Ser Lys Ile Tyr Ile Ser Glu Thr Ser Thr Asn Thr 385 390 395 400 Val Pro Asn Ser Ser Pro Thr Ala Ala Ser Val Ser Thr Asp Ile Tyr                 405 410 415 Gly Gln Ala Val Tyr Glu Ala Cys Gln Thr Ile Leu Lys Arg Leu Glu             420 425 430 Pro Phe Lys Lys Lys Asn Pro Asp Gly Ser Trp Glu Asp Trp Val Met         435 440 445 Ala Ala Tyr Gln Asp Arg Val Ser Leu Ser Thr Thr Gly Phe Tyr Arg     450 455 460 Thr Pro Asn Leu Gly Tyr Ser Phe Glu Thr Asn Ser Gly Asn Ala Phe 465 470 475 480 His Tyr Phe Thr Tyr Gly Val Ala Cys Ser Glu Val Glu Ile Asp Cys                 485 490 495 Leu Thr Gly Asp His Lys Asn Leu Arg Thr Asp Ile Val Met Asp Val             500 505 510 Gly Ser Ser Leu Asn Pro Ala Ile Asp Ile Gly Gln Val Glu Gly Ala         515 520 525 Phe Val Gln Gly Leu Gly Leu Phe Thr Leu Glu Glu Leu His Tyr Ser     530 535 540 Pro Glu Gly Ser Leu His Thr Arg Gly Pro Ser Thr Tyr Lys Ile Pro 545 550 555 560 Ala Phe Gly Ser Ile Pro Thr Glu Phe Arg Val Ser Leu Leu Arg Asp                 565 570 575 Cys Pro Asn Lys Lys Ala Ile Tyr Ala Ser Lys Ala Val Gly Glu Pro             580 585 590 Pro Leu Phe Leu Gly Ala Ser Val Phe Phe Ala Ile Lys Asp Ala Ile         595 600 605 Arg Ala Ala Arg Ala Gln His Thr Asn Asn Asn Thr Lys Glu Leu Phe     610 615 620 Arg Leu Asp Ser Pro Ala Thr Pro Glu Lys Ile Arg Asn Ala Cys Val 625 630 635 640 Asp Lys Phe Thr Thr                 645

Claims (7)

검체가 투입되는 검체 투입부;
산화제 및 반응제를 포함하여 상기 검체 투입부로 투입된 상기 검체를 전달받아 상기 검체에 포함되어 있는 퓨린 대사체를 상기 산화제를 이용하여 산화시키는 과정에서 발생하는 수소이온과 상기 반응제가 반응하여 상기 반응제가 변색되는 종양검출부;를 포함하고,
상기 산화제 및 반응제는, 소변 내에 존재하는 퓨린 대사체(Purine metabolite) 하이포잔틴 (Hypoxanthine) 및 잔틴(Xanthine)의 농도를 검출하기 위한, 잔틴 산화효소 (Xanthine Oxidase), 1-메톡시 PMS (1-Methoxy-5-methylphenazinium methylsulfate, MePMS), WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium-monosodium salt) 및 포타슘포스페이트 완충용액을 포함하되,
상기 포타슘포스페이트 완충용액은 노닐 페녹시폴리에톡시에탄올-40(nonyl phenoxypolyethoxylethanol-40, NP-40)을 추가로 포함하는 종양 진단을 위한 퓨린 대사체의 농도 측정장치. A sample input unit into which a sample is input;
The reactant reacts with hydrogen ions generated in the process of receiving the sample input to the sample input unit, including an oxidizing agent and a reactant, and oxidizing the purine metabolite contained in the sample using the oxidizing agent, so that the reactant changes color Tumor detection unit to be; includes,
The oxidizing agent and the reactant, for detecting the concentration of Purine metabolite Hypoxanthine and Xanthine present in urine, Xanthine Oxidase, 1-methoxy PMS (1 -Methoxy-5-methylphenazinium methylsulfate, MePMS), WST-8 (2- (2-methoxy-4-nitrophenyl) -3- (4-nitrophenyl) -5- (2,4-disulfophenyl) -2H-tetrazolium-monosodium salt) and potassium phosphate buffer solution,
The potassium phosphate buffer solution is a nonyl phenoxypolyethoxyethanol-40 (nonyl phenoxypolyethoxylethanol-40, NP-40) additional concentration measuring device of the purine metabolite for tumor diagnosis. 제 1항에 있어서, 상기 퓨린 대사체는 하이포잔틴 및 잔틴 인 것을 특징으로 하는 종양 진단을 위한 퓨린 대사체의 농도 측정장치.The apparatus for measuring the concentration of purine metabolites for tumor diagnosis according to claim 1, wherein the purine metabolites are hypoxanthine and xanthine. 제 1항에 있어서, 상기 종양 진단을 위한 퓨린 대사체의 농도 측정장치는,
상기 반응제의 변색정도를 검출하여 사용자에게 안내하는 색상안내부;를 더 포함하는 종양 진단을 위한 퓨린 대사체의 농도 측정장치.According to claim 1, The concentration measurement device of the purine metabolite for tumor diagnosis,
Color guide unit for detecting the discoloration of the reactant to guide the user; a concentration measuring device for purine metabolites for tumor diagnosis further comprising. 제 1항에 있어서,
상기 종양검출부는 상기 산화제를 포함하는 산화부 및 상기 반응제를 포함하는 색상변화부를 포함하며 상기 산화부 및 색상변화부가 별도의 구역으로 구분되어 있는 것을 특징으로 하는 종양 진단을 위한 퓨린 대사체의 농도 측정장치.According to claim 1,
The tumor detection unit comprises an oxidizing unit containing the oxidizing agent and a color changing unit containing the reactant, and the concentration of the purine metabolite for tumor diagnosis, characterized in that the oxidizing unit and the color changing unit are divided into separate zones. Measuring device. 제 1항에 있어서, 상기 종양 진단을 위한 퓨린 대사체의 농도 측정장치는,
상기 종양검출부에서 발생하는 수소이온을 포집하기 위한 수소이온 포집부;를 더 포함하는 종양 진단을 위한 퓨린 대사체의 농도 측정장치.According to claim 1, The concentration measurement device of the purine metabolite for tumor diagnosis,
Hydrogen ion trapping unit for collecting the hydrogen ions generated in the tumor detection unit; Purine metabolite concentration measurement device further comprising a tumor diagnosis. 삭제delete 제 1항에 있어서, 상기 산화제 및 반응제를 포함하는 조성물이 소변과 반응시 나타나는 색상을 흡광도 측정함으로써 소변 내 퓨린 대사체의 농도를 산출하여 종양 발생 여부를 진단하는 종양 진단을 위한 퓨린 대사체의 농도 측정장치.The method of claim 1, wherein the composition containing the oxidizing agent and the reactant of the purine metabolite for tumor diagnosis to determine whether the tumor is generated by calculating the concentration of purine metabolites in the urine by measuring the absorbance of the color appearing when reacting with urine Concentration measuring device.
KR1020170184013A 2017-12-29 2017-12-29 Apparatus for analysing purine metabolite concentration such as hypoxanthine and xanthine for tumor diagnosis KR102094024B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020170184013A KR102094024B1 (en) 2017-12-29 2017-12-29 Apparatus for analysing purine metabolite concentration such as hypoxanthine and xanthine for tumor diagnosis

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020170184013A KR102094024B1 (en) 2017-12-29 2017-12-29 Apparatus for analysing purine metabolite concentration such as hypoxanthine and xanthine for tumor diagnosis

Publications (2)

Publication Number Publication Date
KR20190081458A KR20190081458A (en) 2019-07-09
KR102094024B1 true KR102094024B1 (en) 2020-03-26

Family

ID=67261163

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020170184013A KR102094024B1 (en) 2017-12-29 2017-12-29 Apparatus for analysing purine metabolite concentration such as hypoxanthine and xanthine for tumor diagnosis

Country Status (1)

Country Link
KR (1) KR102094024B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997039352A1 (en) * 1996-04-15 1997-10-23 Fox Chase Cancer Center Assays for detection of purine metabolites

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020035101A (en) * 1999-07-16 2002-05-09 야마모토 카즈모토 Method for Measuring Substance and Measurement Reagent to be used in the Method
KR20120066714A (en) * 2010-10-27 2012-06-25 경북대학교 산학협력단 Detection method of inosine and hypoxanthine in serum of hemodialysis patient to represent oxidative stress and hypoxia
CN113509541A (en) 2014-06-26 2021-10-19 埃克西金炎症有限公司 Novel use of cell-penetrating peptide inhibitors of the JNK signal transduction pathway for the treatment of various diseases
KR20160117688A (en) * 2015-03-30 2016-10-11 한국전자통신연구원 A method for detecting biomaterials

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997039352A1 (en) * 1996-04-15 1997-10-23 Fox Chase Cancer Center Assays for detection of purine metabolites

Also Published As

Publication number Publication date
KR20190081458A (en) 2019-07-09

Similar Documents

Publication Publication Date Title
Li et al. A signature of saliva-derived exosomal small RNAs as predicting biomarker for esophageal carcinoma: a multicenter prospective study
Bohunicky et al. Biosensors: the new wave in cancer diagnosis
Tiwari Science behind human saliva
JP4571499B2 (en) Biosensor
Yaroshenko et al. Determination of urine ionic composition with potentiometric multisensor system
CN102304581B (en) Kit and method for detecting KRAS genetic mutation
TWI630385B (en) Devices and methods for enhanced detection and identification of diseases
KR20060034712A (en) Biomaker panel for colorectal cancer
KR20150090246A (en) Molecular diagnostic test for cancer
Liu et al. Novel molecularly imprinted polymer (MIP) multiple sensors for endogenous redox couples determination and their applications in lung cancer diagnosis
Liu et al. Smartphone assisted portable biochip for non-invasive simultaneous monitoring of glucose and insulin towards precise diagnosis of prediabetes/diabetes
EP3152560B1 (en) Non-invasive gene mutation detection in lung cancer patients
Yi et al. Glucose detection based on the photothermal effect of OxTMB using a thermometer
Lim et al. Salivary epigenetic biomarkers in head and neck squamous cell carcinomas
CN107779505A (en) The fecal bacteria mark of colorectal cancer
Hernández‐Cedillo et al. Determination of sialic acid levels by using surface‐enhanced Raman spectroscopy in periodontitis and gingivitis
Xu et al. Urinary Cell-Free DNA IQGAP3/BMP4 Ratio as a Prognostic Marker for Non–Muscle-Invasive Bladder Cancer
Starbird et al. Structural and biochemical analyses reveal insights into covalent flavinylation of the Escherichia coli complex II homolog quinol: fumarate reductase
CN102089443A (en) Method and apparatus for determining a probability of colorectal cancer in a subject
Salvi et al. Urinary cell-free DNA: potential and applications
Pierce et al. Understanding proteomics
KR102094024B1 (en) Apparatus for analysing purine metabolite concentration such as hypoxanthine and xanthine for tumor diagnosis
Raut et al. Whole-blood DNA methylation markers for risk stratification in colorectal cancer screening: a systematic review
KR101899426B1 (en) Enzyme Composition for analysing purine metabolite concentration such as hypoxanthine and xanthine for tumor diagnosis
Doménech-Carbó et al. Electrochemical detection and screening of bladder cancer recurrence using direct electrochemical analysis of urine: a non-invasive tool for diagnosis

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right