KR102090209B1 - A Composition for Preventing or Treating Stress-related Disorders Comprising Methyl Benzoate as an Active Ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition, a functional food composition and a cosmetic composition for preventing or treating stress-related diseases comprising methyl benzoate or derivatives thereof as an active ingredient. The composition according to the present invention can be applied as an efficient therapeutic agent for various stress-related diseases accompanied by an increase in cortisol secretion as well as stress-causing nervous diseases and skin diseases by remarkably improving behavioral indices of entities exposed to a stress environment, significantly reducing concentration of cortisol in blood, and remarkably suppressing cortisol concentration and stress-related gene expression in skin fibroblasts. Further, the composition according to the present invention can be useful as an efficient therapeutic agent composition for various stress-related diseases most of which are chronic diseases since the composition is less in side effects even during long-term administration by comprising as an active ingredient a nature-derived compound which has already been eaten as a food additive.

Description

A composition for preventing or treating stress-related disorders Comprising Methyl Benzoate as an active ingredient

The present invention relates to a composition for preventing or treating stressful diseases comprising methyl benzoate and derivatives thereof as an active ingredient.

The World Health Organization defined mental health as a “good-bye condition for individuals to recognize their abilities, cope with the daily stresses of life, work productively, and contribute to the community”. The stress here refers to changes in the organism caused by internal and external stimuli that break the balance of the living body. Selye, a pioneer in stress research, defined stress as a non-specific response of the living body to demand. The secretion of glucocorticoids was seen as an important factor in establishing a bio-stress response (Selye H., 1993, 1958, 1976)

Stimuli that cause stress are classified into physical, psychological, and physiological stimuli. Physical stimulation refers to temperature and ultraviolet rays present in the natural world, psychological stimulation refers to mental pain, anger, anxiety, and tension, and physiological stimulation refers to bacteria, viruses, and allergens. In particular, when symptoms such as depression, anxiety, insomnia, and loss of appetite due to psychological stimulation are repeated, diseases such as depression, anxiety, and sleep disorder are caused. Depression is a disease that causes various cognitive, mental, or physical symptoms with decreased motivation and depression, leading to deterioration of daily functions, and it is difficult for everyday life due to a decrease in overall functions such as thought process, motivation, motivation, behavior, and sleep. , Prevalence and suicide rate. Anxiety is a mental illness that usually causes persistent, unrecoverable neurosensitivity, tension, and anxiety over six months or more, and you experience extreme anxiety in every minor event without specific reason. Sleep disorders experience psychotic symptoms of self-dissolution, hallucinations, delusions, etc. As a result of sleep deprivation experiments on rats, symptoms such as systemic weakness, skin disease, weight loss, increased energy consumption, and decreased body temperature were observed. It has been reported to severely lead to death (Dugovic et al., 1999 J. Neurosci . 19 (19); 8656-8664).

When subjected to excessive mental stress, hormones are secreted into the blood through the circulatory system leading to the hypothalamic-pituitary-adrenal axis (HPA axis). In the hypothalamus of the brain, corticotropin releasing factor (CRF) is produced, which combines with the CRF receptor expressed in the pituitary gland to release the adrenocorticotropic hormon (ACTH). ACTH arrives at the adrenal glands through the blood and lymph nodes, thereby promoting the secretion of glucocorticoids such as cortisol, and the saccharides secreted into the blood are delivered to each body organ.

Cortisol is a stress hormone among steroid hormones that strains the muscles and makes the sensory organs sensitive, preparing the body to respond to mental stress. On the other hand, the continuous secretion of cortisol hormone due to repetitive mental stress increases its blood level, keeps the body constantly tense and interferes with sound sleep, leading to sleep disorders. This becomes the cause of mental stress again, and the vicious cycle that causes depressive symptoms continues. When the function of regulating cortisol secretion is lost due to extreme mental stress, cortisol secretion is excessively secreted, causing brain atrophy and damage throughout the nervous system, and as a result, severe depressive symptoms and suicide potential have been reported.

In the CRF gene overexpressed mouse, symptoms of increased anxiety and depression behavior and decreased exploratory behavior were observed. It is reported that it may be involved in emotional disorders and cause cushing syndrome. In addition, it shows physical changes such as excessive fat accumulation, muscle atrophy, thin skin and hair loss, and increases plasma levels of adrenal stimulating hormone (ACTH) and cortisol. It has been reported that these symptoms are alleviated by the administration of CRF antagonists (Stenzel-poore et al., 1994).

The initial stress recovery dietary supplement market was John's wort (pepper sprouts: depression, anxiety disorder improvement) and Valerian (rats: sedation, sleep improvement) have been leading, but as the anti-stress market has recently expanded rapidly, new anti-stress materials have been developed. However, only a small number of counterparts such as GABA, Theanine and Phosphatdyl serine have been proposed, and new products are also being developed by combining one or more of the above five anti-stress substances.

As a drug for depression, it is a drug that induces a therapeutic effect through a temporary mood-changing effect by increasing serotonin concentration and activity in the blood by inhibiting re-absorption of serotonin secreted at the end of a nerve cell into junctional cells. Prozac or Celexa, which are sold with approval. However, in the case of such a serotonin reuptake inhibitor, only about half of the patients have improved symptoms and require a minimum of 4 months taking period, and depending on the patient, there is a problem in that it must be continuously taken for 2 to 3 years. In addition, in the case of the serotonin reuptake inhibitor, most symptoms were observed to recur within 6 to 12 months when the drug was discontinued, and the side effects were also known to be serious. Anti-anxiety drugs include benzodiazepine, such as diazepam, lorazepam, clonazepam, and alprazolam, which are mainly used, such as zolpidem. Drugs of the imidazopyridine system are also used to treat short-term insomnia due to anxiety. However, drugs used for anxiety disorders and mental disorders act directly on the GABA (gamma-aminobutyric acid) receptors of the central nervous system to suppress the central nervous system, resulting in excessive sedation, and central suppression such as depression, muscle relaxation, and hypnosis. This may appear strengthened. In addition, drugs used for anxiety disorders and mental disorders have a psychological and physical dependence, which implies the risk of drug abuse.

Methyl benzoate is an ester-based compound, also referred to as a benzoic acid methyl ester, whose molecular formula is C ₈ H ₈ O ₂ , its molecular weight is 136.15 g / mol, and its structural formula is same:

Methyl benzoate is a pale yellow transparent liquid with a melting point of -12 ° C and a boiling point of 199 ° C. It is a fat-soluble substance that is not soluble in water, but is known to be soluble in most organic solvents.

Methyl benzoate is a fragrance component contained in Allspice and various flower oils (banana, cherry, pimento berry, clove, Monstera deliciosa, etc.) , It is used as an ingredient such as air cleaners. It is also listed as a food additive in the FDA as a flavoring agent, and approved as a flavoring agent and food additive in the Flavor and Extract Manufacturers Association (FEMA) and Joint FAO / WHO Expert Committe on Food Additives (JECFA), respectively. However, there have been no reports of studies on the physiological activity of methyl benzoate other than the flavor function.

When chronically orally administered methyl benzoate to rats, the NOEL (No Observed Effect Level) value was reported to be relatively safe, above 500 mg / kg bw (Drug Research, 112 (5): 394-403, 1960).

Throughout this specification, a number of papers and patent documents are referenced and their citations are indicated. The disclosures of cited papers and patent documents are incorporated by reference into the present specification as a whole, and the level of the technical field to which the present invention pertains and the content of the present invention are more clearly described.

Patent Literature 1. U.S. Patent Publication No. 2019-0060263

The present inventors have excellent therapeutic activity against various stressful diseases including stressful neurological diseases and stressful skin diseases, but have little side effects even when administered for a long period of time. I tried. As a result, methyl benzoate and its derivatives significantly improve the behavioral indicators of experimental animals exposed to artificial stress environments, significantly reduce plasma corticosteroid concentrations, and cortisol concentration and stress in skin fibroblasts. By remarkably suppressing the expression of the gene, the present invention was completed by discovering that it can be used as an effective therapeutic composition for various diseases caused by stress, including neurological diseases and skin diseases.

Accordingly, an object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of stressful diseases.

Another object of the present invention is to provide a food composition and a cosmetic composition for improving or alleviating stress.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to an aspect of the present invention, the present invention provides a pharmaceutical composition for the prevention or treatment of a stressful disease comprising the compound of Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient:

Formula 1

In the above formula, R is C ₁ -C ₃ alkyl.

The present inventors have excellent therapeutic activity against various stressful diseases including stressful neurological diseases and stressful skin diseases, but have little side effects even when administered for a long period of time. I tried. As a result, methyl benzoate and its derivatives significantly improve the behavioral indicators of experimental animals exposed to artificial stress environments, significantly reduce plasma corticosteroid concentrations, and cortisol concentration and stress in skin fibroblasts. By significantly suppressing the expression of genes, it was found that it can be used as an effective therapeutic composition for various diseases caused by stress, including neurological and skin diseases.

According to a specific embodiment of the present invention, the stressful disease that can be prevented or treated with the composition of the present invention is selected from the group consisting of stressful neurological diseases, stressful skin diseases, stressful cardiovascular diseases and stressful infectious diseases.

The term “Stress-related Neurological Disorder” as used herein refers to any disease that causes dysfunction in the brain, spine, and nervous system that connects them by being exposed under stress. For example, depression , Sleep disorders, anxiety disorders, panic disorders, fatigue syndrome, headaches, neurodegenerative diseases, Alzheimer's, dietary disorders, anorexia nervosa, alcohol withdrawal syndrome and stressful mental illness. More specifically, the stressful neurological diseases that can be prevented or treated with the composition of the present invention include depressive disorder, sleep disturbance, anxiety disorder and panic disorder. Is selected from.

The term “Stress-related Skin Neurological Disorder” in this specification is a disease in which various damage to skin tissue is caused by exposure of an individual under stress, as well as when psychological factors are the main cause of skin tissue damage. As a secondary cause, it means to cover all pathological conditions that further exacerbate or promote progression of skin diseases caused by other causes. About 40% of all skin diseases are reported to be directly related to stress, and continuous stress also reduces the therapeutic effect, so suppression of the stress response in stressful skin diseases is key to the underlying treatment of chronic diseases. . Skin diseases that cause stress include, for example, psoriasis, acne, scaly, rash, stressful dermatitis, atopic dermatitis, lichen simplex chronicus, alopecia areata, prurigo, stressful skin aging, stress Sexual acne and acute vesiculobullous hand eczema.

 More specifically, stressful skin diseases that can be prevented or treated with the composition of the present invention include stressful dermatitis, atopic dermatitis, lichen simplex chronicus, alopecia areata, prurigo, stressful skin aging, It is selected from the group consisting of stressful acne and acute vesiculobullous hand eczema.

In addition, those who are easily stressed are reported to have a three-fold higher incidence of cardiovascular disease than those who are not, and those who do not have specific lesions on the cardiovascular system and who have normal blood lipid levels or inflammatory indicators are exposed to psychological stress for a long time. It can cause infarction, which is called 'stressful cardiomyopathy'. In addition, when cortisol, a stress hormone, reduces the number of lymphocytes produced in the thymus and lymph nodes and weakens the immune function, it is easily infected with various pathogens such as viruses and bacteria.

Therefore, the composition of the present invention, which significantly reduces cortisol in various tissues including plasma and skin, can be used as an effective therapeutic composition for cardiovascular and infectious diseases caused by stress.

The term "alkyl" used herein refers to a straight chain or pulverized saturated hydrocarbon group, and includes, for example, methyl, ethyl, propyl, isopropyl, and the like. C ₁ -C ₃ alkyl means an alkyl group having an alkyl unit having 1 to 3 carbon atoms, and when C ₁ -C ₃ alkyl is substituted, carbon number of the substituent is not included.

According to a specific embodiment of the present invention, R ₁ in Formula ₁ is C ₁ alkyl, that is, methyl. According to the invention, the compound of formula 1 wherein R ₁ is methyl is methyl benzoate. Methyl benzoic acid is a scent component contained in plants such as raw sputum ( Salvinia molesta ), pimento berry, clove, and Monstera delicios a, but is used as a food additive such as flavoring agent There is no known pharmacological effect on stressful diseases such as anxiety disorders and stressful dermatitis. The present invention has a low risk of side effects even when administered long-term as a pharmaceutical composition or long-term feeding as a food composition by using a compound derived from a natural product or a derivative thereof.

The term "pharmaceutically acceptable salt" as used herein includes salts derived from pharmaceutically acceptable inorganic, organic, or base. Examples of suitable acids are hydrochloric acid, bromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, trifluoroacetic acid, citric acid, methane And sulfonic acid, formic acid, benzoic acid, malonic acid, naphthalene-2-sulfonic acid, and benzenesulfonic acid. Salts derived from suitable bases may include alkali metals such as sodium, alkaline earth metals such as magnesium, and ammonium.

The term “prevention” in this specification has never been diagnosed as having a disease or condition, but means to inhibit the occurrence of the disease or condition in a subject who is likely to have the disease or condition.

As used herein, the term “treatment” means (a) inhibition of the development of a disease, disorder or symptom; (b) alleviation of a disease, illness or symptom; Or (c) eliminating a disease, illness or symptom. When the composition of the present invention is administered to a subject, it significantly improves behavioral indicators in a stressful environment, significantly reduces plasma corticosteroid concentrations, and decreases the expression of stress-related genes, thereby inhibiting or eliminating the development of symptoms of stressful diseases. Or serve to alleviate it. Therefore, the composition of the present invention may be a composition for the treatment of these diseases by itself, or it may be administered together with other pharmacological ingredients to be applied as a therapeutic aid for the disease. Thus, the term “treatment” or “therapeutic agent” in this specification includes the meaning of “therapeutic aid” or “therapeutic aid”.

The term “administration” or “administer” herein refers to the administration of a therapeutically effective amount of a composition of the present invention directly to a subject such that the same amount is formed in the subject's body.

In the present invention, the term "therapeutically effective amount" refers to the amount of the composition contained in a sufficient amount to provide a therapeutic or prophylactic effect of the pharmacological component in the composition to an individual who intends to administer the pharmaceutical composition of the present invention. Prophylactically effective amount ”.

The term “subject” herein includes, without limitation, humans, mice, rats, guinea pigs, dogs, cats, horses, cows, pigs, monkeys, chimpanzees, baboons, or rhesus monkeys. Specifically, the subject of the present invention is a human.

According to a specific embodiment of the present invention, the composition of the present invention reduces the concentration of Cortisol in the blood.

Cortisol is a glucocorticoid-based hormone secreted from the adrenal cortex, which is involved in the regulation of the individual's response to stressors and homeostasis, in the form of cortisol in primates including humans, and in the form of corticosterone in rodents. Secreted by Cortisol (or corticosterone) increases in concentration when exposed to stress, and its decrease means that the nerve damage to the individual due to the stress environment has been alleviated or eliminated.

According to the present invention, the composition of the present invention can be predicted to significantly reduce the cortisol, the same saccharide corticoid secretion form in humans, by significantly reducing the concentration of plasma corticosteroids in mice, which are experimental animals. It can be seen that it induces a stress response.

As used herein, the term “reduction of blood corticosteroid concentration” means that the concentration of cortisol in the blood is significantly increased to be measurably compared to a control group without administration of the composition of the present invention, specifically, a decrease of 10% or more. It means, and more specifically, means that it is reduced by 13% or more.

When the composition of the present invention is prepared as a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier included in the pharmaceutical composition of the present invention is commonly used in formulation, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, Calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, but is not limited thereto It does not work. The pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention may be administered orally or parenterally, and specifically, may be administered orally, intravenously, subcutaneously or intraperitoneally.

Suitable dosages of the pharmaceutical compositions of the present invention are variously prescribed by factors such as formulation method, administration method, patient's age, weight, sex, morbidity, food, administration time, route of administration, excretion rate, and response sensitivity. Can be. The preferred dosage of the pharmaceutical composition of the present invention is in the range of 0.001-100 mg / kg on an adult basis.

The pharmaceutical composition of the present invention is prepared in a unit dose form by formulating using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily carried out by those skilled in the art to which the present invention pertains. Or it can be manufactured by incorporating into a multi-dose container. At this time, the formulation may be in the form of a solution, suspension, syrup or emulsion in an oil or aqueous medium, or may be in the form of ex, powder, granule, tablet or capsule, and may further include a dispersant or stabilizer.

According to another aspect of the present invention, the present invention provides a food composition for improving or alleviating stress comprising the compound of Formula 1 or a food acceptable salt thereof as an active ingredient:

Formula 1

In the above formula, R is C ₁ -C ₃ alkyl.

Since the compound of Formula 1 used in the present invention and a stress state or a stressful disease that can be improved or relieved by using the above have already been described above, the description thereof is omitted to avoid excessive duplication.

As used herein, the term “food-acceptable salt” means a salt in a form that can be used in a food composition among salts in which cations and anions are coupled by electrostatic attraction, and specific examples thereof include “pharmaceutical Acceptable salts ”.

When the composition of the present invention is prepared as a food composition, it may include not only the compound of the present invention as an active ingredient, but also carbohydrates, seasonings, and flavoring agents that are commonly added in food production. Examples of carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol, but are not limited thereto. As flavoring agents, natural flavoring agents such as taumatin and stevia extract (eg, rebaudioside A, glycyrrhizine, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be used. For example, when the food composition of the present invention is prepared as a drink agent, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, juice, worm extract, jujube extract, licorice extract, etc. are added in addition to the pine bark extract which is the active ingredient of the present invention. Can be included as

According to another aspect of the present invention, the present invention provides a cosmetic composition for improving or alleviating stress comprising a compound of Formula 1 or a cosmetically acceptable salt thereof as an active ingredient:

Formula 1

In the above formula, R is C ₁ -C ₃ alkyl.

Since the compound of Formula 1 used in the present invention and a stress state or a stressful disease that can be improved or relieved by using the above have already been described above, the description thereof is omitted to avoid excessive duplication.

According to a specific embodiment of the present invention, the stress state that can be improved or relieved by the composition of the present invention is a stressful neurological disease, a stressful skin injury or a stressful infectious disease. The term “improvement or alleviation of stressful skin damage” is used herein in the same sense as “improvement of stressful skin condition”. Therefore, the composition of the present invention can be expressed as a “composition for improving skin condition”.

As used herein, the term “cosmetically acceptable salt” refers to a salt in a form that can be used cosmetically among salts in which cations and anions are bound by electrostatic attraction, and specific examples of the types Examples of the above-mentioned “pharmaceutically acceptable salts” are included.

The ingredients included in the cosmetic composition of the present invention include ingredients commonly used in cosmetic compositions other than the above-mentioned Formula 1 compound or a hydrolysis product thereof as an active ingredient, for example, antioxidants, stabilizers, solubilizers, vitamins, pigments and fragrances And conventional adjuvants, and carriers.

The cosmetic composition of the present invention may be prepared in any formulation conventionally prepared in the art, for example, solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleaning , May be formulated as an oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, trakant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide, etc. may be used as a carrier component. You can.

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder can be used as a carrier component, and in the case of a spray, additionally chlorofluorohydrocarbon, propane / Propellant such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizing agent or emulsifying agent is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

When the formulation of the present invention is a suspension, liquid diluents such as water, ethanol or propylene glycol as carrier components, ethoxylated isostearyl alcohol, suspensions such as polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystals Sex cellulose, aluminum metahydroxide, bentonite, agar or trakant, etc. can be used.

When the formulation of the present invention is a surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivatives, methyltaurate, sarcosinate, fatty acid amide as a carrier component Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a pharmaceutical composition, a functional food composition and a cosmetic composition for the prevention or treatment of stressful diseases comprising methyl benzoate or a derivative thereof as an active ingredient.

(b) The composition of the present invention significantly reduces the cortisol concentration and stress-related gene expression in skin fibroblasts as well as significantly improves the behavioral indicators of individuals exposed to a stressed environment and significantly reduces blood cortisol concentrations. It can be applied as an effective treatment for a variety of stressful diseases involving neurological diseases and skin diseases as a cause, as well as increased cortisol secretion.

(c) The present invention is also useful as an effective therapeutic agent composition for various stressful diseases, most of which are chronic diseases, because it has little side effects even when administered for a long period of time, using natural derived compounds that have already been fed as food additives as active ingredients. Can be.

1 is a diagram showing the change in behavioral indicators of mice administered methyl benzoate, and shows the results of tail suspension experiments (FIG. 1A), forced swimming experiments (FIG. 1B), and open field experiments (FIG. 1C), respectively. Each value was expressed as mean ± standard error (n = 4), and marked with an asterisk (* P <0.05) when there was a significant difference between groups.
Figure 2 is a diagram showing the change in plasma corticosteroid indicators of mice administered methyl benzoate. Each value was expressed as mean ± standard error (n = 4), and marked with an asterisk (* P <0.05) when there was a significant difference between groups.
3 is a diagram showing the change in cortisol secretion in human skin fibroblasts treated with methyl benzoate. Each value was expressed as mean ± standard error (n = 4), and marked with an asterisk (* P <0.05) when there was a significant difference between groups.
Figure 4 is a picture showing the expression change of the stress indicator gene of human skin fibroblasts treated with methyl benzoate, and shows the expression patterns of GILZ (FIG. 4A), THBD (FIG. 4B) and SDPR (FIG. 4C), respectively. Each value was expressed as mean ± standard error (n = 4), and marked with an asterisk (* P <0.05) when there was a significant difference between groups.

Hereinafter, the present invention will be described in more detail through examples. These examples are only intended to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Experiment method

Experimental animals and experimental diet

The 8-week-old male C57BL / 6 mouse used as a test animal was supplied and used by Orient Bio Co., Ltd. (143-1, Sangdaewon-dong, Jungwon-gu, Seongnam-si, Gyeonggi-do, Korea). The experimental animals were divided into a control group (CON, n = 4) and a methyl benzoate administration group (Methyl benzoate, n = 4) after a one-week adaptation period in a breeding room. The control group was dissolved in olive oil and the methyl benzoate group in methyl benzoate (50 mg / kg body weight) in olive oil. The olive oil and methyl benzoate used were purchased from Sigma-Aldrich (Missouri, USA). The experimental animals were kept in a space maintained at a constant temperature of 23 ± 1 ℃, humidity of 50 ± 10%, and a 12-hour light and dark cycle, and freely ingested Chow (Orient Bio) and negative water.

Measurement of anti-stress, anti-depression and anti-anxiety effects by administration of methyl benzoate

1. Tail suspension test (TST)

The tail suspension experiment was performed using the method of Steru et al. (1985). After attaching a fixing device to the end of the tail of the mouse for experiment, hang it at a height of 50 cm from the ground, and measure the immobility time of the experimental animal using a video tracking system (smart v.2.5.21). Did. When the mouse was completely stopped without any movement in the suspended state, it was regarded as a floating state, and after a 2 minute adaptation time, the state for 4 minutes was measured. In general, when the mouse is under stress, anxiety increases and depression increases, so the amount of activity decreases. Therefore, it was determined that the shorter the mouse immobility time, the better the anti-stress, anti-depressive, and anti-anxiety effects.

2. Forced swimming test (FST)

For the forced swimming experiment, the method of Porsolt et al. (1997) was used. After filling a water tank with a height of 40 cm and a diameter of 20 cm with a temperature of 25 ± 1 ° C and 30 cm of water, each experimental mouse is placed in a water tank, and the animal is immobilized using a video tracking system (smart v.2.5.21). The immobility time was measured. When the mouse was standing on the surface of the water and stood upright and floating without moving, it was regarded as a floating state, and after a 2 minute adaptation time, it was measured through a state for 4 minutes. In general, when the mouse is under stress, anxiety increases and depression increases, so the amount of activity decreases. Therefore, it was determined that the shorter the mouse immobility time, the better the anti-stress, anti-depressive, and anti-anxiety effects.

3. Open field test (OFT)

For the open field experiment, the method of Noldus et al. (2001) was used. The mice subjected to stress through the forced swimming experiment were placed in a 50 × 50 × 50cm white acrylic box. After that, set the 30 × 30cm area in the center of the field as the central zone, and then use the video tracking system (smart v.2.5.21) for 2 minutes to keep the experimental animal in the center. After the adaptation time, it was measured for 8 minutes. In general, when the mouse is stressed, anxiety increases, so the activity time decreases in the central part of the open field and increases in the edge length, so the longer the mouse stays in the center, the more anti-stress, anti-depressive and anti-anxiety effect is. saw.

Measurement of plasma corticosterone concentration

After the stress behavior index experiment, blood was collected under anesthesia with avertin. Blood collected from the abdominal aorta was centrifuged at 2000 x g for 15 minutes to separate plasma. Plasma corticosterone concentration was measured using a commonly used EIA kit (Corticosterone EIA kit, Enzo Life Sciences, NY, USA). The basic experimental method was performed according to the manufacturer's instructions. Corticosterone secretion is a typical symptom of stress, so the lower the plasma corticosteroid concentration, the more anti-stress, anti-depressive, and anti-anxiety effects were considered.

Measurement of skin stress relieving efficacy

1. Cell culture and treatment materials

Human skin fibroblast HS68 was purchased from ATCC (Manassas, VA, USA) and used. The purchased cells were cultured in a 37 ° C, 5% CO ₂ incubator using DMEM (Dulbecco's Modified Eagle's Media) containing 10% fetal calf serum and used in the experiment.

2. Measurement of Cortisol concentration

In order to measure cortisol concentration in human dermal fibroblasts, cells were divided into 0.2 × 10 ⁶ cells / well in 12 well plates, followed by adrenal cortical stimulating hormone release factor (CRF) (Sigma-Aldrich, Missouri, USA). Methyl benzoate was added at concentrations of 100 nM and 5 μM, respectively, and cultured in a CO ₂ incubator for 24 hours. After incubation for 24 hours, the concentration of cortisol secreted into the medium was measured using a cortisol ELISA kit (ENZO, USA).

3. PCR analysis

In order to confirm that methyl benzoate relieves gene expression patterns expressed by stress hormones, human fibroblasts are divided into 2.5 × 10 ⁶ cells / well in a 90 mm dish, and CRF and methyl benzoate are respectively 100 nM and 5 μM. It was added to the concentration of and incubated in a CO ₂ incubator for 24 hours. After incubation for 24 hours, 500 μl of Trizol solution per 1 x 10 ⁷ human fibroblasts was added and harvested, followed by centrifugation at 4 ° C. and 12,000 xg for 10 minutes. After transferring the supernatant to a new tube, 100 µl of chloroform was added and vortexed. The supernatant was transferred to a new tube again, and isopropanol was added so that the ratio of the supernatant and isopropanol was 1: 1. After shaking ten times vigorously, it is left at room temperature for 15 minutes, centrifuged at 12,000 × g for 4 minutes, and then the supernatant is removed. After adding 1 ml of 70% ethanol to the remaining precipitate, 7,500 × g, Centrifuge at 4 ° C. for 5 minutes. After removing the ethanol, the tube containing the RNA precipitate was dried for 15 minutes at room temperature, and the RNA pellet was dissolved using nuclease free water. The concentration of the RNA sample extracted at wavelengths of 260 nm and 280 nm is measured using a UV / VIS spectrophotometer (Beckman coulter, DU730), and the integrity of the RNA sample is performed by agarose gel electrophoresis. (integrity) was confirmed. The RNA sample extracted from human fibroblasts is subjected to reverse transcription using a oligo dT primer and a superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA) to synthesize cDNA. Did. The synthesized cDNA is used as a template and the 5 'and 3' flanking sequences of the gene cDNA to be amplified are used as primers, iQ SYBR green supermix (Bio-Rad) and CFX Connect ™ Real-Time PCR Quantitative PCR was performed using a Detection System (Bio-Rad). The primer sequences used at this time are shown in Table 1 below.

gene primer Sequence (5 '→ 3') Annealing temperature (℃) Glucocorticoid-induced leucine zipper (GILZ) Forward GCTGTGAGAGAGGAGGTGGA 55 Reverse CTTCAGGGCTCAGACAGGAC Thrombomodulin (THBD) Forward GACCTTCCTCAATGCCAGT 55 Reverse CCGTTCAGTAGCAAGGAAATG Serum deprivation-response protein (SDPR) Forward AGTCACGGTGCTCACGCTCC 55 Reverse GTTGCTGGTGGAGGCCTGGT Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) Forward ggagattgttgccatcaacg 55 Reverse tgacaagcttcccattctcg

Statistics processing

Statistical analysis of all data was performed using the SPSS (statistical package for the social sciences, version 21.0, IBM, Armonk, NY, USA) PC package, and the analysis values were expressed as mean ± standard error. Significant differences between groups were verified by conducting an independent sample T- test (* P <0.05).

Experiment result

Anti-stress, anti-depression and anti-anxiety effects by administration of methyl benzoate

1.Tail Suspension Test (TST)

It was observed that the immobility time was significantly reduced (-22%) in the methyl benzoate treated group (-22%) compared to the control (CON), indicating that the administration of methyl benzoate showed anti-stress, anti-depressive and anti-anxiety effects. It was confirmed (Fig. 1a).

2. Forced Swimming Test (FST)

It was observed that the immobility time was significantly decreased (-17%) in the methyl benzoate-treated group compared to the control group, and it was confirmed that methyl benzoate administration exhibited anti-stress, anti-depressive and anti-anxiety effects (FIG. 1B).

3. Open field test (OFT)

In the methyl benzoate treated group, it was observed that the time of activity in the center increased significantly (+ 19%) compared to the control group, and through this, it was confirmed that administration of methyl benzoate showed anti-stress, anti-depressive and anti-anxiety effects ( Figure 1c).

Plasma corticosterone concentration

Compared to the control group, it was observed that the plasma corticosteroid concentration was significantly decreased (-14%) in the methyl benzoate-treated group, through which it was confirmed that the administration of methyl benzoate showed anti-stress, anti-depressive and anti-anxiety effects (FIG. 2). ).

Changes in Cortisol Concentration in Human Skin Fibroblasts

When in a stressful situation, skin cells secrete corticotropin releasing factor (CRF) to cause a stress response, so directly treating CRF on skin cells is a widely used method for building stress models (slominski et at, 2013). In human skin fibroblasts, it is known that the CRF receptor is expressed and can accommodate stress signals. When the CRF receptor receives the signal, it produces cortisol, a stress hormone through lower signaling, and adversely affects the skin, such as elasticity of the skin and reduction of skin barrier. (Cohen et al., 1977; Kao et al., 2003; Slominski et al., 2007).

As a result of investigating the direct effect of the stress control effect of methyl benzoate on the skin, in the control cells treated with CRF (+ CRF), cortisol secretion was significantly increased compared to normal cells (-CRF), and the group treated with CRF and benzoic acid In (Methyl benzoate), cortisol concentration was significantly decreased (-46%) compared to CRF-treated cells (+ CRF), and through this, methyl benzoate treatment showed anti-stress effect in human dermal fibroblasts. It was confirmed (Fig. 3).

Changes in stress-related gene expression in human skin fibroblasts

It is known that an increase in cortisol secretion in the skin binds to the cortisol receptor in the cytoplasm, enters the nucleus, acts as a transcription factor, and produces various stress-related genes. Among these cortisol target genes, GILZ (Glucocorticoid-induced leucine zipper), THBD (Thrombomodulin) and SDPR (Serum deprivation-response protein) are typically known, and thus the expression level change of these target genes is used as a reliable stress index (Wang et al., 2004, Oakley et al., 2014).

In CRF-only control cells (+ CRF), the expression of stress-related genes was significantly increased compared to normal cells (-CRF), and in the group treated with CRF and benzoic acid, stress-related genes were significantly reduced compared to + CRF cells. (GILZ: -38%; THBD: -22%; SDPR: -26%). Through this, it was variously confirmed that the treatment of methyl benzoate has a remarkable anti-stress effect in human dermal fibroblasts ( Figures 4a-4c).

Since the specific parts of the present invention have been described in detail above, it is clear that for those skilled in the art, these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Industry-Academic Cooperation Foundation Yonsei University <120> A Composition for Preventing or Treating Stress-related Disorders          Comprising Methyl Benzoate as an Active Ingredient <130> HPC-8603 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GILZ F primer <400> 1 gctgtgagag aggaggtgga 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GILZ R primer <400> 2 cttcagggct cagacaggac 20 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> THBD F primer <400> 3 gaccttcctc aatgccagt 19 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> THBD R primer <400> 4 ccgttcagta gcaaggaaat g 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SDPR F primer <400> 5 agtcacggtg ctcacgctcc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SDPR R primer <400> 6 gttgctggtg gaggcctggt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH F primer <400> 7 ggagattgtt gccatcaacg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH R primer <400> 8 tgacaagctt cccattctcg 20

Claims (12)

Depressive disorder, sleep disturbance, anxiety disorder, panic disorder, stress dermatitis, atopic dermatitis, chronic, including the compound of formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient Pharmaceutical compositions for the prevention or treatment of stressful diseases selected from the group consisting of lichen simplex chronicus, alopecia areata, prurigo and acute vesiculobullous hand eczema:
Formula 1

In the above formula, R is C ₁ -C ₃ alkyl.
The composition of claim 1, wherein R ₁ in Formula ₁ is C ₁ alkyl.
delete delete delete The composition of claim 1, wherein the composition decreases the concentration of Cortisol in the blood.
A food composition for improving or alleviating stress comprising a compound of Formula 1 or a food acceptable salt thereof as an active ingredient:
Formula 1

In the above formula, R is C ₁ -C ₃ alkyl.
The composition according to claim 7, wherein R ₁ in Formula ₁ is C ₁ alkyl.
The composition of claim 7, wherein the composition has an improvement or alleviation effect on stressful neurological diseases, stressful skin diseases, stressful cardiovascular diseases or stressful infectious diseases.
A cosmetic composition for improving or alleviating stress comprising a compound of Formula 1 or a cosmetically acceptable salt thereof as an active ingredient:
Formula 1

In the above formula, R is C ₁ -C ₃ alkyl.
The composition of claim 10, wherein R ₁ in Formula ₁ is C ₁ alkyl.
The composition of claim 10, wherein the composition has an effect of improving or alleviating stressful neurological diseases, stressful skin damage, or stressful infectious diseases.

Images