KR102080823B1 - Sequence-specific DNA detection method using a fluorescent nucleobase analogue-containing split G-quadruplex - Google Patents

Abstract

The present invention relates to a kit for detecting a target substance comprising two segments divided from G-quadroplex. The present invention also relates to a method for determining the presence of a target substance comprising the step of treating the kit with a sample. The present invention can easily and quickly detect a target substance by using fluorescence signal differences of fluorescent base analogs present in the divided G-quadroplex DNA, and can be utilized for detecting various biological materials and chemicals.

Description

Sequence-specific DNA detection method using a fluorescent nucleobase analogue-containing split G-quadruplex}

The present invention relates to a nucleic acid detection technique using a fluorescence signal change of a fluorescent nucleobase analogue present in split G-quadroplex DNA, and more particularly, when a target nucleic acid to be detected does not exist, The split G-quadroplex has an unstable structure, and the fluorescent base analog generates a low fluorescence signal by quenching by surrounding guanine base. On the other hand, when the target nucleic acid is present, a portion complementary to the target nucleic acid at both ends of the split G-quadroplex forms a stabilized G-quadroplex through binding to the target nucleic acid, and is caused by the surrounding guanine base. The quenching effect is reduced so that the fluorescent base analog produces a high fluorescence signal. This difference can be used to easily detect the target nucleic acid.

Nucleic acid detection technology plays an important role in various fields such as disease diagnosis, environmental monitoring, and criminal investigation, and new detection technology with excellent sensitivity and specificity and excellent price competitiveness is continuously being developed. Representative nucleic acid detection techniques are based on molecular beacons, DNA probes of hairpin structures labeled with fluorescent and quencher materials. This technique is accomplished by identifying the presence or absence of fluorescence signal generation due to the structural change of the molecular beacon due to the presence of the target nucleic acid (Tyagi et al., Nature biotechnology, 14: 303-308, 1996; Masuko et al., Nucleic Acids Research). , 26: 5409-5416, 1998). This technique is widely used because it is possible to analyze a target nucleic acid without additional separation process, and various types of molecular beacon-based nucleic acid analysis techniques have been developed (Song et al., Angewandte Chemie-International Edition, 48: 8670-). 8674, 2009; Wu et al., Biosensors & Bioelectronics, 26: 3870-3875, 2011; Yeh et al., Nano Letters, 10: 3870-3875, 2011). However, there is a problem in that a high cost occurs in the process of modifying the phosphor and quencher at both ends of the molecular beacon, respectively.

The matters described as the background art are only for the purpose of improving the understanding of the background of the present invention, and should not be taken as acknowledging that they correspond to the related arts already known to those skilled in the art.

The present inventors made diligent efforts to solve the problems of existing nucleic acid detection techniques, to develop a technology that is excellent in price competitiveness and accurately detects the presence or absence of a target nucleic acid. As a result, the G-quadroplex DNA was divided into two segments, and a fluorescent base analog was introduced into one of them, so that the fluorescent signal could be controlled by the target nucleic acid, and the split ratio was changed to optimize the target by the target nucleic acid. This invention was completed by finding the ratio which shows the signal rise of.

Accordingly, it is an object of the present invention to provide a kit for detecting a target substance comprising two divided segments capable of forming a G-quadruplex structure.

Another object of the present invention is to provide a biosensor comprising the kit for detecting the target substance.

Another object of the present invention to provide a method for determining the presence of a target material comprising the step of treating the target material detection kit to a sample.

Still another object of the present invention is to provide a method of manufacturing the kit for detecting the target substance.

Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

According to one aspect of the invention, the invention is a kit for detecting a target substance comprising a first sequence segment and a second sequence segment,

The first sequence segment is a G-rich sequence comprising a 'GxHyNz' sequence;

The second sequence segment is a G-rich sequence comprising a 'GxHy' sequence;

In the 'GxHyNz' sequence or 'GxHy' sequence, G is a guanine or guanine derivative, H is a non-guanine nucleic acid base, N is a fluorescent nucleobase analogue, and G, H, N are randomly arranged by permutations. X is an integer from 1 to 20, y is an integer from 0 to 10, z is an integer from 1 to 2, provided that the sum of x + y + z does not exceed 50;

One end of the first sequence segment and the second sequence segment is bound to a substance capable of binding to a target substance;

In the presence of a target substance, the first and second sequence segments form a G-quadruplex structure, and at the same time provide a kit for detecting a target substance.

According to another aspect of the present invention, the present invention provides a method for producing a target material detection kit comprising the steps of preparing a first sequence segment and a second sequence segment,

The first sequence segment is a G-rich sequence comprising a 'GxHyNz' sequence;

The second sequence segment is a G-rich sequence comprising a 'GxHy' sequence;

In the 'GxHyNz' sequence or 'GxHy' sequence, G is a guanine or guanine derivative, H is a non-guanine nucleic acid, N is a fluorescent nucleobase analogue, and G, H, and N are randomly arranged by permutation. x is an integer from 1 to 20, y is an integer from 0 to 10, z is an integer from 1 to 2, provided that the sum of x + y + z does not exceed 50;

One end of the first sequence segment and the second sequence segment is bound to a substance capable of binding to a target substance;

In the presence of a target substance, the first and second sequence segments form a G-quadruplex structure, and at the same time provide a method for preparing a kit for detecting a target substance, characterized in that it displays a fluorescent signal.

According to another aspect of the present invention, the present invention provides a biosensor comprising the kit for detecting the target substance.

The present invention is a nucleic acid detection technology using the fluorescence signal difference of fluorescent base analogs present in split G-quadroplex DNA, and compared to the existing molecular beacon-based nucleic acid detection technology, the cost is low, easy and quick analysis Can provide results. The present invention also provides a sensor technology that can be effectively applied to the detection of various biomarkers including target nucleic acids. In addition, by connecting an aptamer capable of binding to a target substance at both ends of the split G-quadruplex DNA, it can be applied to the detection of various biological materials and chemicals, and also to the detection of metal ions that affect the formation of G-quadruplex. Can be.

As used herein, the term “G-quadroplex” or “G-quardruplex” refers to guanine, guanosine, 2′-deoxyguanosine (2-), which are typically referred to as guanine (G). deoxy-guanosine), 2'-O-methyl-guanosine, 2'-F-guanosine, LNA (Locked Nucleic Acid) -guano One or two or more selected from shin, D-deoxyguanosine, and D-guanosine (G-rich), so in the case of a particular sequence, four guanines are located in one plane to form a hogsten form. Refers to an oligonucleotide that has a quadruple helix structure by hydrogen bonding, and is synthesized to introduce a fluorescent base analog that can fluoresce thereto.

The first sequence segment and the second sequence segment of the present invention form G-quadroplexes in the presence of the target substance. The target material is not limited and preferably includes nucleic acids, proteins, compounds, metals or metal ions.

If the target substance is a nucleic acid (target nucleic acid), the first sequence segment has a sequence complementary to a portion of the sequence of the target nucleic acid; The second sequence segment has a sequence complementary to another portion of the sequence of the target nucleic acid; In the presence of a target nucleic acid, the first and second sequence segments form a G-quadruplex structure and can simultaneously display a fluorescent signal.

Also, when the target substance is a nucleic acid (target nucleic acid), a sequence complementary to some of the sequences of the target nucleic acid bound to the first sequence segment versus another portion of the sequence of the target nucleic acid bound to the second sequence segment The ratio of sequences complementary to can be from 2: 1 to 1: 2.

The sum of some of the sequences of the target nucleic acid and some other sequences is not limited, but is preferably 10 to 50 mer, more preferably 10 to 30 mer.

According to a preferred embodiment of the present invention, a sequence complementary to a portion of the sequence of the target nucleic acid bound to the first sequence segment is bound to the 5 'region of the first sequence segment.

According to a preferred embodiment of the present invention, a sequence complementary to another part of the sequence of the target nucleic acid bound to the second sequence segment is bound to the 3 'region of the second sequence segment.

In the present invention, H in the GxHyNz 'sequence or' GxHy 'sequence is not particularly limited to nucleic acids other than guanine, and preferably, adenine (Adenine, A), thymine (T), cytosine (Cytosine, C) or Derivatives thereof, more preferably thymine.

In the present invention, N in the GxHyNz 'sequence or' GxHy 'sequence is not particularly limited to a fluorescent nucleobase analogue, preferably 2-AP (2-aminopurine), PyC (pyrrolocytosine), 8vdA (8) -vinyl-deoxyadenosine), 2PyG (8- (2-pyridyl) -2′-deoxyguanosine), 3-MI (3-methyl isoxanthopterin), C8-naphthalene substituted adenine ( ^cn A, ^dn A, etc.), pyrimidine analogs (tC, tC ^O, etc.), and more preferably 2-AP.

The sequence of the G-quadroplex formed by the first sequence segment and the second sequence segment of the present invention may use various sequences known in the art. For example, GGGGGGTGGGTGGG (T30695), GGGTGGGGGGTTGGG (PW17), GGGTGGG, GGTGGTGGTGGTTGTGGTGGTGGTGG, ACCTGGGGGAGTATTGGGGGGGAGAGT, TGGGGTAGGGAA The kit for detecting a target substance of the present invention can be prepared by inserting a fluorescent base analog into the first sequence segment.

According to a preferred embodiment of the present invention, the 'GxHyNz' sequence included in the first sequence segment and the 'GxHy' sequence included in the second sequence segment are an integer of 1 to 10, and an integer of 0 to 3. and z are integers of 1 except that the sum of x + y + z does not exceed 20.

According to a preferred embodiment of the present invention, the first sequence segment consists of a 'GxHyNz' sequence, and the 'GxHyNz' sequence is 5'-GGG (2-AP) -3 'or the 5'-GGG (2- AP)-3 'end of 3' G or H is a sequence arranged randomly by permutation.

According to an embodiment of the present invention, the first sequence segment is 5'-GGG (2-AP) -3 'or G'H at the 3' end of the 5'-GGG (2-AP) -3 '. For sequences randomly arranged by permutation (based on T30695), 5'-GGGT (2-AP) -3 'or G'H at the 3' end of 5'-GGGT (2-AP) -3 ' The fluorescence signal was more than twice as high as for the sequences randomly arranged by permutation (based on PW17) (FIG. 2).

According to a preferred embodiment of the present invention, the number of G (guanosine or guanosine derivative) included in the first sequence segment is equal to or greater than the number of G included in the second sequence segment.

According to one embodiment of the present invention, the target DNA was analyzed using a combination of segments containing different splitting ratios. As a result, the signal to background ratio (F-F0) / F0 was highly dependent on the splitting ratio, and the first sequence segment Placing more guanine bases in (S1) induced an increase in fluorescence signal by larger target DNA (FIG. 4).

According to a preferred embodiment of the present invention, the ratio of G (guanosine or guanosine derivative) included in the first sequence segment to G included in the second sequence segment is 1: 1 to 3: 1.

According to a preferred embodiment of the invention, the first sequence segment is selected from the group consisting of SEQ ID NO: 3, 5, and 9 sequences.

According to a preferred embodiment of the present invention, the second sequence segment is selected from the group consisting of SEQ ID NO: 4, 6, and 10.

According to another aspect of the invention, the present invention provides a method for identifying the presence of a target substance comprising the step of treating the target material detection kit to the sample to determine whether there is a target substance in the sample. .

As used herein, the term "sample" is a generic term for a sample (blood, plasma, urine, saliva, etc.) separated from a living body, such as a target substance itself or a substance that does not include the target substance, or a sample mixed naturally or artificially. In order to confirm whether or not the target substance is present in the sample, the target substance detection kit is processed on the sample to determine whether the G-quadroplex is formed or not. You can check it.

According to an embodiment of the present invention, the target DNA of Chlamydia trachomatis (CT) was detected using the kit for detecting a target substance of the present invention, and Mycoplasma was used as a control. genitalium (MG), Staphylococcus aureus (SA), Neisseria It was confirmed that a considerable increase in fluorescence intensity intensity was observed in comparison with the detectability of non-target DNA derived from gonorrheae (NG), Herpes Type 1 Virus (HSV1) and Klebsiella pneumonia (KP) (FIG. 8).

The features and advantages of the present invention are summarized as follows:

(Iii) The present invention provides a kit for detecting a target substance comprising two segments divided from G-quadroplex.

(Ii) The present invention also provides a method for determining the presence of a target substance comprising the step of treating the kit with a sample.

(Iii) By utilizing the target material detection kit of the present invention, it is possible to easily and quickly provide the target material detection result by using the difference in the fluorescent signal of the fluorescent base analogue present in the divided G-quadroplex DNA, and various biological materials. And detection of chemicals.

1 is a basic working principle of a novel DNA detection system using G-quadruplex (AG) containing 2-AP as a key detection agent. S1 and S2 are two separate G-rich segments linked to target specific overhang sequences, with only S1 containing 2-AP.
2 shows the effect of G-quadruplex sequences on increasing target DNA-induced fluorescence. The well-known G-quadruplex sequences (PW17 and T30695) were used to test. Final concentrations of S1, S2 and target DNA were 2 μM, 2 μM and 200 nM, respectively.
Figure 3 shows the effect of G-quadruplex cleavage ratio on the target DNA-induced fluorescence increase. (a) shows a schematic of a 2-AP containing split G-quadruplex structure with different split ratios (1: 1, 3: 1, 1: 3, 2: 1, and 1: 2) in the presence of target DNA. . (b) is for the signal-background ratio, (F-F0) / F0, where F and F0 are fluorescent signals in the absence and presence of target DNA, respectively. Final concentrations of S1, S2 and target DNA were 2 μΜ.
4 shows the effect of G-quadruplex cleavage ratio on increasing target DNA-induced fluorescence. (ae) is the fluorescence of 2-AP contained in a split G-quadruplex with a split ratio of (1: 1), (3: 1), (1: 3), (2: 1), (1: 2) Indicates strength. Final concentrations of S1, S2 and target DNA were 2 μΜ.
5 shows the detection efficiency of the novel sensor developed in the present invention. (a) is fluorescence intensity and (b) shows polyacrylamide gel electrophoresis images for samples under different conditions (1: target DNA, 2: S1, 3: S2, 4: S1 + S2, 5: target DNA + S1 + S2). Final concentrations of S1, S2 and target DNA were 2 μΜ.
6 shows target DNA detection results of different lengths (26, 36 and 46-mer). Inset represents the signal-to-background ratio (F-F0) / F0. Final concentrations of S1, S2 and target DNAs (26, 36 and 46-mer) were 2 μΜ.
Figure 7 shows the detection sensitivity of the novel sensor developed in the present invention. (a) shows the linear range of signal-background ratio and (b) plot of (F-F0) / F0 to target DNA concentration (0-1000 nM). Final concentrations of S1 and S2 were 2 μΜ.
8 shows the sensing selectivity of the new sensor developed in the present invention. Target DNA is Chlamydia trachomatis (CT) and non-target DNA is Mycoplasma genitalium (MG), Staphylococcus aureus (SA), Neisseria gonorrheae (NG), Herpes type 1 virus (HSV1), Klebsiella pneumoniae (KP). Final concentrations of S1, S2, target DNA and non-target DNA were 2 μΜ.

Hereinafter, the present invention will be described in more detail with reference to the following examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Experimental Materials and Methods

1. Experimental Materials

All DNA samples used in this study were synthesized by Bioneer (Daejeon, Korea) and purified through Bio-RP cartridge purification. The sequences of all DNA samples are listed in Table 1. Tris (hydroxymethyl) aminomethane (Tris), acetic acid (CH ₃ COOH), potassium acetate (CH ₃ CO ₂ K) and magnesium nitrate (Mg (NO ₃ ) ₂ ) were obtained from Sigma-Aldrich (St. Louis, Mo, USA). Purchased. All other chemicals met the analytical level and were used without further purification. DNase / RNase-free distilled water (DW) was purchased from Bioneer.

Name Sequence PW17 S1 (1: 1) ^a 5'- AAGCTGCAATCC GGGT (2-AP) GGG -3 '(SEQ ID NO: 1) S2 (1: 1) ^a 5'- GGGTTGGG CTTTTAAGATAACC -3 '(SEQ ID NO: 2) T30695 S1 (1: 1) ^a 5'- AAGCTGCAATCC GGG (2-AP) GGG -3 '(SEQ ID NO: 3) S2 (1: 1) ^a 5'- TGGGTGGG CTTTTAAGATAACC -3 '(SEQ ID NO: 4) S1 (3: 1) ^a 5'- AAGCTGCAATCC GGG (2-AP) GGGTGGG -3 '(SEQ ID NO: 5) S2 (3: 1) ^a 5'- TGGG CTTTTAAGATAACC -3 '(SEQ ID NO: 6) S1 (1: 3) ^a 5'- AAGCTGCAATCC GGG (2-AP) -3 '(SEQ ID NO: 7) S2 (1: 3) ^a 5'- GGGTGGGTGGG CTTTTAAGATAACC -3 '(SEQ ID NO: 8) S1 (2: 1) ^a 5'- AAGCTGCAATCC GGG (2-AP) GGGTGG -3 '(SEQ ID NO: 9) S2 (2: 1) ^a 5'- GTGGG CTTTTAAGATAACC -3 '(SEQ ID NO: 10) S1 (1: 2) ^a 5'- AAGCTGCAATCC GGG (2-AP) G -3 '(SEQ ID NO: 11) S2 (1: 2) ^a 5'- GGTGGGTGGG CTTTTAAGATAACC -3 '(SEQ ID NO: 12) CT (26 mer) ^b 5'- GGTTATCTTAAAAGGGATTGCAGCTT -3 '(SEQ ID NO: 13) CT (36 mer) ^b 5'-TGCGG GGTTATCTTAAAAGGGATTGCAGCTT GTAGT-3 '(SEQ ID NO: 14) CT (46 mer) ^b 5'-GCACGTGCGG GGTTATCTTAAAAGGGATTGCAGCTT GTAGTCCTGC-3 '(SEQ ID NO: 15) MG (26 mer) 5'-CTCAAGTATCTCAATGCTGTTGAGAA -3 '(SEQ ID NO: 16) SA (26 mer) 5'-TCAGACTATTATTGGTTGATACACCT -3 '(SEQ ID NO: 17) NG (26 mer) 5'-CTGCCGCCGATATACCTAGCAAGCTC -3 '(SEQ ID NO: 18) HSV-1 (26 mer) 5'-ATGCCTTCTTGGAGTACGTGGGTCAT -3 '(SEQ ID NO: 19) KP (26 mer) 5'-GCCGCCATTACCATGAGCGATAACAG -3 '(SEQ ID NO: 20)

SEQ ID NO: S1 and S2 each comprising a complementary sequence capable of binding to all or a portion of the target nucleic acid can be combined to form a G-quadruplex when the target nucleic acid is present. In the sequence (#: #) represents the split ratio of the nucleotides constituting the G-quadruplex, 2-AP represents the inserted 2-aminopurine, the nucleotide of the italics represents the complementary sequence of the target nucleic acid, the bold is G- Represents a fragment of a quadruplex.

SEQ ID NO: b, a target nucleic acid capable of binding to sequence a, wherein an underlined nucleotide in the sequence represents a site of the target nucleic acid capable of binding to sequence a.

2. Sequence Specific DNA Detection

10 mM Tris-acetate buffer (pH 7.0) containing 5 mM CH ₃ CO ₂ K and 10 mM Mg (NO ₃ ) ₂ contains 2 μM S1, 2 μM S2 (Table 1) and various concentrations of DNA The resulting solution (100 μL) was heated at 90 ° C. for 5 minutes, slowly cooled to 25 ° C. (0.1 ° C./s), and then incubated at 25 ° C. for 30 minutes. Finally, each solution was placed in a black 96-well plate and fluorescence intensity was measured at excitation and emission wavelengths of 305 nm and 375 nm using a microplate reader (Spectramax iD5 multi-mode microplate reader, Molecular Devices, USA). .

3. Polyacrylamide Gel Electrophoresis

The reaction product was analyzed on a 15% polyacrylamide gel for 130 minutes at a constant voltage of 130 V using IX TBE as the transfer buffer. After GelRed (Biotium) staining, the gel was scanned using a UV trans-illuminator.

4. Sequence Specific DNA Detection in Human Serum

To confirm the practical applicability of the developed sensor, various concentrations of target DNA were added to diluted human serum (1%) and the same procedure was followed for the sequence specific DNA detection described above.

Experiment result

The basic principle of operation of the new DNA detection system using G-quadruplex (AG) containing 2-AP as the core detection agent is shown in FIG. In the sensor, the AG is reasonably split so that in response to the target DNA, fluorescence increases to its maximum. Each G-rich segment of AG has a target specific overhang sequence (Li et al., 2018) in which one (S1) contains 2-AP and the other (S2) does not contain 2-AP. It is designed to contain (Table 1). As can be seen in Figure 1, the two split G-rich segments of AG form an active G-quadruplex structure only in the presence of the target DNA, resulting in blocking stacking interactions between 2-AP and nearby G bases. Promotes a dramatic rise in fluorescence intensity.

Next, the effect of the sequence of G-quadruplex on the target DNA induced fluorescence increase of split G-quadruplex (ASG) containing 2-AP was investigated. Each well known G-rich sequence such as PW17 and T30695 (see Table 1 for sequence information) was split into two segments with a split ratio of 1: 1 and then linked to target specific overhang sequences. As can be seen in FIG. 2, the split G-quadruplex derived from T30695 in the presence of target DNA showed higher signal enhancement than that of PW17 (Chen et al., 2015). Next, to determine the effect of the split ratio, T30695 was divided into five different ratios including 1: 1, 3: 1, 1: 3, 2: 1 and 1: 2 based on the number of guanine bases. (FIG. 3A). Analysis of target DNA using ASGs containing these different splitting ratios revealed that the signal-to-background ratio (F-F0) / F0, where F and F0 respectively represent fluorescent signals in the absence and presence of the target DNA It was highly dependent on the ratio (Figure 3b). Specifically, placing more guanine bases in S1 of ASG induces increased fluorescence signal by larger target DNA. Surprisingly, the split ratio of 3: 1 in the presence of target DNA resulted in the largest increase in fluorescence intensity, which was much greater than the value of the 1: 1 separation ratio that is often used (FIG. 4).

Next, to confirm that the new sensor, including the G-quadruplex derived from T30695 and the ASG probe optimized with 3: 1 split ratio, actually works well, the maximum of 2-AP, the fluorescence intensity (F ₃₇₅ ) at 375 nm The emission wavelength was measured (FIG. 5A). As expected, the weak fluorescence signal generated from the sensor in the absence of target DNA (FIG. 5A) increased significantly in the presence of target DNA (FIG. 5A). In addition, the target DNAs 26, 36 and 46-mers of different lengths all effectively promoted the increase in fluorescence intensity occurring in the probe (FIG. 6). This change in fluorescence intensity is the result of the probe and target DNA interactions, evidenced by the results of polyacrylamide gel electrophoresis analysis. As can be seen in FIG. 5b), the split G-rich segment in the presence of the target DNA creates a new electrophoretic band, which is consistent with the hybridization result of the split segment (S1 and S2) of the target DNA and ASG. . Overall, fluorescence and electrophoresis results confirmed that target DNA effectively binds to ASGs and induces the formation of active G-quadruplexes with concomitant increase in fluorescence intensity.

The sensitivity of the new sensor was determined by measuring the fluorescence intensity at 375 nm as a function of target DNA concentration (Lee et al., 2017). The results shown in the plot of FIG. 7 showed that the signal-to-background ratio increased with increasing target DNA concentration up to 2 μM and slightly decreased at concentrations above 2 μM (FIG. 7). In addition, a good linear relationship (R2 = 0.987) was shown between fluorescence increase levels and target DNA concentrations (0-1000 nM range). The sensor system has the advantage of simplicity of operation because it is a homogeneous analysis using a "mix and read" format without separation and / or cleaning steps.

Next, Chlamydia using the sensor Detection of Target DNA Derived from Trachomatis (CT) by Mycoplasma genitalium (MG), Staphylococcus aureus (SA), Neisseria It was compared with the detectability of non-target DNA derived from gonorrheae (NG), Herpes Type 1 Virus (HSV1) and Klebsiella pneumonia (KP). As can be seen in the graph of FIG. 8, the fluorescence intensity was significantly increased with the target CT DNA, but negligible with other non-target DNA. These results show that the sensor is highly selective for the target DNA, indicating that sequence specific DNA hybridization is very important for the formation of activated G-quadruplex structures.

Finally, the practical applicability of the sensor was demonstrated using it to determine target DNA in human serum. Cell-free DNA circulating in human serum is attracting attention as a new target marker for diagnosing non-invasive diseases. A mock clinical sample was prepared by placing different concentrations of target CT DNA in human serum, followed by the above ASG based assay procedure. As can be seen from the results of FIG. 8, the fluorescence intensity of human serum samples increased linearly with increasing target DNA concentration in the range of 0-1000 nM (R ² = 0.9937). In addition, the target DNA concentration was demonstrated to have excellent precision with an observed coefficient of variation (CV) of less than 10.3% and a recovery of 101% to 111% (Table 2). The results show that the present detection method has good reproducibility and accuracy and shows the potential for detecting target DNA in actual clinical samples.

Added ^a (nM) Measured ^b (nM) SD ^c CV ^d (%) Recovery ^e (%) 50 50.5 0.367 0.726 101 100 111 11.5 10.3 111 250 269 16.4 6.12 107

^a To measure the concentration of target DNA, a calibration curve was first created by using standards containing known concentrations of target DNA spiked in diluted human serum (1%). Based on the calibration curve, the F ₃₇₅ from the unknown samples was used to determine the concentration of target DNA present in human serum.

^b Mean of three measurements.

^c Standard deviation of three measurements.

^d Coefficient of variation = SD / mean × 100.

^e Measured value / added value × 100.

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that such a specific technology is only a preferred embodiment, and the scope of the present invention is not limited thereto. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

<110> KONKUK UNIVERSITY INDUSTRIAL COOPERATION CORP <120> Sequence-specific DNA detection method using a fluorescent          nucleobase analogue-containing split G-quadruplex <130> HP7971 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> PW17 S1 <220> <221> misc_feature <222> (5) 2-223 <400> 1 gggtnggg 8 <210> 2 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> PW17 S2 <400> 2 gggttggg 8 <210> 3 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> T30695 S1 (1: 1) <220> <221> misc_feature <222> (4) 2-223 <400> 3 gggnggg 7 <210> 4 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> T30695 S2 (1: 1) <400> 4 tgggtggg 8 <210> 5 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> T30695 S1 (3: 1) <220> <221> misc_feature <222> (4) 2-223 <400> 5 gggngggtgg g 11 <210> 6 <211> 4 <212> DNA <213> Artificial Sequence <220> <223> T30695 S2 (3: 1) <400> 6 tggg 4 <210> 7 <211> 4 <212> DNA <213> Artificial Sequence <220> <223> T30695 S1 (1: 3) <220> <221> misc_feature <222> (4) 2-223 <400> 7 gggn 4 <210> 8 <211> 11 <212> DNA <213> Artificial Sequence <220> <223> T30695 S2 (1: 3) <400> 8 gggtgggtgg g 11 <210> 9 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> T30695 S1 (2: 1) <220> <221> misc_feature <222> (4) 2-223 <400> 9 gggngggtgg 10 <210> 10 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> T30695 S2 (2: 1) <400> 10 gtggg 5 <210> 11 <211> 5 <212> DNA <213> Artificial Sequence <220> <223> T30695 S1 (1: 2) <220> <221> misc_feature <222> (4) 2-223 <400> 11 gggng 5 <210> 12 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> T30695 S2 (1: 2) <400> 12 ggtgggtggg 10 <210> 13 <211> 26 <212> DNA <213> Chlamydia trachomatis <400> 13 ggttatctta aaagggattg cagctt 26 <210> 14 <211> 36 <212> DNA <213> Chlamydia trachomatis <400> 14 tgcggggtta tcttaaaagg gattgcagct tgtagt 36 <210> 15 <211> 46 <212> DNA <213> Chlamydia trachomatis <400> 15 gcacgtgcgg ggttatctta aaagggattg cagcttgtag tcctgc 46 <210> 16 <211> 26 <212> DNA <213> Mycoplasma genitalium <400> 16 ctcaagtatc tcaatgctgt tgagaa 26 <210> 17 <211> 26 <212> DNA Staphylococcus aureus <400> 17 tcagactatt attggttgat acacct 26 <210> 18 <211> 26 <212> DNA <213> Neisseria gonorrhoeae <400> 18 ctgccgccga tatacctagc aagctc 26 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> HSV-1 <400> 19 atgccttctt ggagtacgtg ggtcat 26 <210> 20 <211> 26 <212> DNA <213> Klebsiella pneumoniae <400> 20 gccgccatta ccatgagcga taacag 26

Claims (18)

A kit for detecting a target substance comprising a first sequence segment and a second sequence segment,
Said first sequence segment is a G-rich sequence comprising the 'GxHyNz'sequence;
Said second sequence segment is a G-rich sequence comprising a 'GxHy'sequence;
In the 'GxHyNz' sequence or 'GxHy' sequence, G is a guanine or guanine derivative, H is a non-guanine nucleic acid, N is a fluorescent nucleobase analogue, and G, H, and N are randomly arranged by permutation. x is an integer of 1 to 10, y is an integer of 0 to 3, z is an integer of 1, provided that the sum of x + y + z does not exceed 20;
One end of the first sequence segment and the second sequence segment is bound to a substance capable of binding to a target substance;
In the presence of a target substance, the first and second sequence segments form a G-quadruplex structure and simultaneously display a fluorescent signal, wherein the fluorescent base analog is 2 -AP (2-aminopurine), wherein the ratio of G (guanine or guanine derivative) included in the first sequence segment to G included in the second sequence segment is 1: 1 to 3: 1 Target material detection kit.
The method of claim 1, wherein the target substance is a nucleic acid; The first sequence segment has a sequence complementary to a portion of the sequence of the target nucleic acid; The second sequence segment has a sequence complementary to another portion of the sequence of the target nucleic acid; In the presence of a target nucleic acid, the first and second sequence segments form a G-quadruplex structure, and at the same time a target material detection kit, characterized in that the fluorescent signal.
The kit of claim 2, wherein a sequence complementary to a portion of the sequence of the target nucleic acid bound to the first sequence segment is coupled to a 5 ′ portion of the first sequence segment.
The kit of claim 2, wherein a sequence complementary to another portion of the sequence of the target nucleic acid bound to the second sequence segment is coupled to a 3 ′ portion of the second sequence segment.
[Claim 2] The kit for detecting a target substance according to claim 1, wherein the H is thymine (T).
delete delete The method of claim 1, wherein the first sequence segment consists of a 'GxHyNz' sequence, and the 'GxHyNz' sequence is 5'-GGG (2-AP) -3 'or 5'-GGG (2-AP)- A kit for detecting a target substance, characterized in that the G or H at the 3 'end of the 3' is a sequence arranged randomly by permutation.
delete delete The kit of claim 1, wherein the first sequence segment is selected from the group consisting of SEQ ID NO: 3, 5, and 9.
The kit of claim 1, wherein the second sequence segment is selected from the group consisting of SEQ ID NO: 4, 6, and 10.
The ratio of one of the sequences of the target nucleic acid bound to the first sequence segment to a sequence complementary to another portion of the sequence of the target nucleic acid bound to the second sequence segment is 2. Kit for detecting a target substance, characterized in that: 1: 1 to 1: 2.
The kit for detecting a target substance according to claim 2, wherein the sum of some of the sequences of the target nucleic acid and some other sequences is 10 to 50 mer.
15. The kit of claim 14, wherein the sum of some of the sequences of the target nucleic acid and some other sequences is 10 to 30 mer.
Biosensor comprising a kit for detecting a target substance of claim 1.
In order to confirm whether a target substance is present in the sample, the method of claim 1 comprising the step of treating the target material detection kit of claim 1 to the sample.
A method of manufacturing a kit for detecting a target substance, comprising the steps of preparing a first sequence segment and a second sequence segment,
Said first sequence segment is a G-rich sequence comprising the 'GxHyNz'sequence;
Said second sequence segment is a G-rich sequence comprising a 'GxHy'sequence;
In the 'GxHyNz' sequence or 'GxHy' sequence, G is a guanine or guanine derivative, H is a non-guanine nucleic acid, N is a fluorescent nucleobase analogue, and G, H, and N are randomly arranged by permutation. x is an integer of 1 to 10, y is an integer of 0 to 3, z is an integer of 1, provided that the sum of x + y + z does not exceed 20;
The fluorescent base analog is 2-AP (2-aminopurine), and the ratio of G (guanine or guanine derivative) included in the first sequence segment to G included in the second sequence segment is 1: 1 to 3: 1;
One end of the first sequence segment and the second sequence segment is bound to a substance capable of binding to a target substance;
In the presence of a target substance, the first and second sequence segments form a G-quadruplex structure, and simultaneously show a fluorescent signal.

Images