KR102072075B1 - Composition for degrading PPARγ comprising TRIM25 - Google Patents

Abstract

The present invention relates to a PPARγ degradation composition and reagent composition containing TRIM25 (tripartite motif-containing 25) as an active ingredient, TRIM25 inhibits the differentiation of 3T3-L1 cells into adipocytes by inducing ubiquitination degradation of PPARγ. You can.

Description

Composition for degrading PPARγ containing TRIM25 as an active ingredient {Composition for degrading PPARγ comprising TRIM25}

The present invention relates to a composition for decomposing PPARγ containing TRIM25 (tripartite motif-containing 25) as an active ingredient, wherein the composition of the present invention can decompose PPARγ by inducing proteasome dependent degradation following ubiquitination of PPARγ. .

In recent years, as the consumption of high calorie and animal food increases due to diversification and westernization of the diet, the incidence of diseases due to abnormal metabolic functions such as stroke, arteriosclerosis, hyperlipidemia, diabetes and obesity is increasing. In addition, as income levels increase, the tendency to focus on leisure and healthy living is spreading, and the demand for medicines for treating symptoms that are not directly related to life but causes inconvenience to life is increasing rapidly.

Peroxysomes are one of the organelles that cause these metabolic disorders. They play an important role in the metabolism of oxygen, glucose, lipids and hormones. They also regulate cell proliferation and differentiation and control inflammatory mediators. Widespread In addition, peroxysomes play an important role in aging and tumorigenesis by affecting the formation of cell membranes and mast cells as well as insulin sensitivity through lipid metabolism and glucose metabolism.

Peroxisome proliferator-activated receptors (PPARs) are one of the nuclear receptors that regulate gene expression by ligand binding, in which several fatty acids are endogenous ligands. Works. Currently identified PPARs are three: peroxysome proliferator activated receptor alpha (PPARα), peroxysome proliferator activated receptor beta (PPARβδ and peroxysome proliferator activated receptor gamma (PPARγ).

As PPARs are known to play a very important role in the regulation of energy homeostasis and inflammatory responses, studies to develop various synthetic PPAR ligands have been activated. Recently, these receptors have been developed through preclinical studies with the development of synthetic PPAR-δ agonists. The function of the became clearer. In addition, the development and research of drugs (dual PPARα / γ agonist, pan-PPAR agonist) for activating a large number of PPAR isotypes is being actively made.

In particular, PPARγ is most frequently found in adipose tissue, and also in β cells of the vascular endothelium, macrophages, and pancreas. It is known to play a role in regulating the differentiation of fat cells and to play a crucial role in systemic lipid homeostasis. After forming dimers with proteins, they bind to peroxisome proliferator response elements (PPRE), which are present in promoters of various adipocyte genes. The interaction of PPARγ with C / EBP alpha is critical for differentiation into mature adipocytes, which regulate the expression of adipocyte-specific proteins and fat metabolizing enzymes, such as the fatty acid binding protein aP2. In addition, ADD1 / SREBPs play an important role in fat metabolism, but are also known to be involved in the differentiation process. Expression of ADD1 / SREBP1c in immature adipocytes is believed to contribute to the activation of PPAR gamma. Only the differentiated fat cells synthesize fatty acids and store neutral lipids.

Representative PPARγ agonists include Glitazone, Rosiglitazone and Pioglitazone, and these agents have the effect of improving insulin sensitivity by activating peroxysomes that oxidize fatty acids as a representative diabetes treatment. However, there are side effects such as weight gain due to adipocyte differentiation, fluid retention due to PPARγ activation, fracture increase, congestive heart failure, myocardial infarction, etc. In particular, administration to cardiovascular patients is contraindicated, and thus new efficacy can be solved. There is a need for development.

Against this background, the present inventors have completed the present invention by discovering that TRIM25 directly induces ubiquitination of PPARγ, a representative protein involved in inducing 3T3-L1 adipocyte differentiation.

The present invention is to solve the problems of the PPARγ agonist, the object of the present invention is to provide a composition for PPARγ degradation containing TRIM25 as an active ingredient.

It is also an object of the present invention to provide a reagent composition for in vitro PPARγ degradation containing TRIM25 as an active ingredient, and to provide an in vitro PPARγ degradation method comprising the step of treating TRIM25 in vitro. do.

However, the problem to be solved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

According to an embodiment of the present invention, a composition for PPARγ degradation, which contains TRIM25 (tripartite motif-containing 25) as an active ingredient, is provided.

According to another embodiment of the present invention, there is provided a reagent composition for in vitro PPARγ degradation containing TRIM25 (tripartite motif-containing 25) as an active ingredient.

According to another embodiment of the present invention, there is provided an in vitro PPARγ degradation method comprising the step of treating TRIM25 (tripartite motif-containing 25) in vitro.

PPARγ degradation composition containing TRIM25 of the present invention as an active ingredient can directly induce ubiquitination of PPARγ to degrade PPARγ, ultimately inhibiting the differentiation of 3T3-L1 cells into adipocytes through degradation of PPARγ. can do.

Therefore, the PPARγ-decomposing composition of the present invention can be usefully used for disease research induced by PPARγ and development of therapeutic agents.

It is to be understood that the effects of the present invention are not limited to the above effects, and include all effects deduced from the configuration of the invention described in the detailed description or claims of the present invention.

Figure 1 shows the interaction between TRIM25 and PPARγ, Figure 1a is a silver staining picture of PPARγ and related proteins, Figure 1b Western blotting picture of TRIM25 from cultured adipocytes, Figure 1c is a PPARγ DBD / of TRIM25 It is a photograph showing the interaction with the H domain, Figure 1d is a photograph identifying a specific region required for TRIM25 binds to PPARγ.
2a to 2c show PPARγ transcriptional activity and protein levels according to the increase or decrease of TRIM expression. 2d and 2e compare the degree of PPARγ degradation of TRIM25 ^WT and TRIM25 ^CS mutants, and FIG. 2f shows that PPARγ protein levels were decreased by TRIM25 overexpression after treatment with proteasome inhibitors.
FIG. 3a shows the comparison of PPARγ half-life of TRIM25 ^WT and TRIM25 ^CS , and FIG. 3b shows the stabilization of PPARγ using knockdown of TRIM25.
4A and 4B show the degree of ubiquitination of TRIM25 ^WT and TRIM25 ^CS mutants in cultured adipocytes and HEK 293 cells. FIGS. 4C and 4D show the results of in vitro ubiquitination analysis of TRIM25 ^WT and TRIM25 ^CS . .
5A and 5B compare the relative expression levels of TRIM25 and PPARγ, aP2, and adiponectin, and FIGS. 5C to 5E show correlations between TRIM25 and PPARγ expression in mice and humans.
Figure 6a ~ 6c is a comparison of the degree of triglyceride accumulation, the expression of adipocyte-selective protein and gene mRNA of TRIM25 ^WT and TRIM25 ^CS , Figure 6d ~ 6e is the differentiation of adipocytes using specific knockdown of TRIM25, adipocytes The expression level of the mRNA of the gene and the protein of the specific gene is compared.
7A to 7C compare the lipid accumulation and the degree of adipogenic marker expression of wild type (WT) and TRIM25 knockout (KO) MEFs.
8A and 8B ^measure PPARγ expression, relative protein expression (PPARγ / HSP90) and ubiquitination in HEK-293 cells transfected with PPARγ ^WT , PPARγ ^Y78F or PPARγ ^Y78E and TRIM25 ^WT .

Hereinafter, exemplary embodiments will be described in detail with reference to the accompanying drawings. However, various changes may be made to the embodiments so that the scope of the patent application is not limited or limited by these embodiments. It is to be understood that all changes, equivalents, and substitutes for the embodiments are included in the scope of rights.

The terminology used herein is for the purpose of description and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as "comprise" or "have" are intended to indicate that there is a feature, number, step, operation, component, part, or combination thereof described on the specification, and one or more other features. It is to be understood that the present invention does not exclude the possibility of the presence or the addition of numbers, steps, operations, components, components, or a combination thereof.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art. Terms such as those defined in the commonly used dictionaries should be construed as having meanings consistent with the meanings in the context of the related art, and shall not be construed in ideal or excessively formal meanings unless expressly defined in this application. Do not.

In addition, in the description with reference to the accompanying drawings, the same components will be given the same reference numerals regardless of the reference numerals and duplicate description thereof will be omitted. In the following description of the embodiment, if it is determined that the detailed description of the related known technology may unnecessarily obscure the gist of the embodiment, the detailed description thereof will be omitted.

The term "Peroxisome proliferator-activated receptor γ" as used herein refers to a ligand dependent transcription factor that regulates adipocyte differentiation and glucose homeostasis.

The term "tripartite motif-containing 25" as used herein refers to a protein encoded by the TRIM25 gene. TRIM25 belongs to the TRIM (Tripartite Motif) family and is defined as E3 ubiquitin ligase because it contains a ring-finger domain.

As used herein, the term “3T3-L1 cell” is a mouse embryonic fibroblast that is a cell line that is widely used for biological studies of adipose tissue. Treatment of hormones such as insulin with 3T3-L1 mouse embryonic fibroblasts activates the fat synthesis signaling pathway, increasing intracellular fat mass and altering the shape of the cells.

According to an embodiment of the present invention, a composition for PPARγ degradation, which contains TRIM25 (tripartite motif-containing 25) as an active ingredient, is provided. TRIM25 contained in the degradation composition of the present invention can degrade PPARγ through E3 ligase activity. More specifically, TRIM25 can induce ubiquitination of PPARγ to degrade PPARγ, and the present inventors have confirmed for the first time the effect of PPARγ degradation of TRIM25.

PPARγ decomposition composition of the present invention, by inhibiting the differentiation of PPARγ-induced 3T3-L1 cells into adipocytes, diabetes, hyperlipidemia, fatty liver, arteriosclerosis, hypertension, cardiovascular disease and metabolism in which these diseases occur simultaneously In addition to the syndrome, it can be used for the study of diseases such as cancer, Alzheimer's disease and the development of therapeutic agents for such diseases.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating Alzheimer's, containing TRIM25 (tripartite motif-containing 25) as an active ingredient.

On the other hand, TRIM25 and PPARγ is expressed in other cells and tissues, especially tumors in addition to adipocytes, and it has been found that PPARγ may act as a tumor suppressor because PPARγ plays a role in inflammation and glucose metabolism in cancer. That is, overexpression of PPARγ can suppress cancer survival by inhibiting cell proliferation and growth. In particular, TRIM25 is overexpressed in breast cancer, colon cancer and lung cancer, while downregulated in normal tissues.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating breast cancer, containing TRIM25 (tripartite motif-containing 25) as an active ingredient.

The present invention provides a pharmaceutical composition for the prevention or treatment of lung cancer, containing TRIM25 (tripartite motif-containing 25) as an active ingredient.

The present invention provides a pharmaceutical composition for preventing or treating colorectal cancer, containing TRIM25 (tripartite motif-containing 25) as an active ingredient.

The pharmaceutical compositions may be used as pharmaceutical compositions formulated in pharmaceutical unit dosage forms by adding pharmaceutically acceptable carriers, excipients or diluents to these active ingredients. "Pharmaceutically acceptable" refers to a composition which, when administered physiologically and is human, does not normally cause an allergic reaction such as gastrointestinal disorders, dizziness, or the like.

The carrier, excipient, and diluent may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, Microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, the pharmaceutical dosage forms can be used alone or in combination with other pharmaceutically active compounds or in suitable combinations.

The pharmaceutical composition may be administered orally or parenterally, and in the case of parenteral administration, the pharmaceutical composition may be applied by topical application. The pharmaceutical composition is administered in a pharmaceutically effective amount. As used herein, "pharmaceutically effective amount" means an amount sufficient to treat or prevent a disease at a reasonable benefit / risk ratio applicable to medical treatment or prevention, and an effective dose level refers to the type of disease and its severity, Activity, age, weight, health and sex of the patient, sensitivity to the drug of the patient, time of administration of the specific extract used, route of administration and rate of release, duration of treatment, method of combining the drug with the specific extract used or other It may be determined according to factors well known in the medical field.

According to another embodiment of the present invention, there is provided a reagent composition for in vitro PPARγ degradation containing TRIM25 (tripartite motif-containing 25) as an active ingredient.

According to another embodiment of the present invention, there is provided an in vitro PPARγ degradation method comprising the step of treating TRIM25 (tripartite motif-containing 25) in vitro.

Hereinafter, the present invention will be described in more detail with reference to Examples. The following examples are described for the purpose of illustrating the present invention, but the scope of the present invention is not limited thereto.

Cell culture

3T3-L1, HCT116, HEK-293T and HEK-293 cells were obtained from ATCC (Manassas, VA) and fetal bovine serum (Gemini Bio-Products, West Sacramento, Calif.), At 37 ° C. under humidification of 5% CO ₂ , The cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 1% penicillin / streptomycin (Thermo Fisher Scientific, Waltham, Mass.). Adipocyte differentiation was induced by treatment of cells with DMEM medium containing 10% fetal bovine serum, 0.5 mM isobutylmethylxanthine, 1 μM dexamethasone and 850 nM insulin. Two days after induction, cells were transferred to preserved DMEM medium containing 10% FBS 850 nM insulin. Lipid accumulation in cells was detected by Oil Red O staining. All compounds for incubation were obtained from Millipore Sigma (St. Louis, Mo.).

Plasmid Structure and RNA Interference

SiRNAs for TRIM25 # 1 (5'-CCTCGACAAGGAAGATAAA-3 ') and # 2 (5'-GCATCTGCTACGGAAGCAT-3') were purchased from Shanghai GenePharma (Shanghai, China) and prepared. HCT116 cells were transfected with siRNA using Lipofectamine RNAi MAC (Thermo Fisher Scientific, Waltham, Mass.). The sequences used for the lentiviral shRNA expression vector (pLKO.1; Dharmacon, Lafayette, CO) targeting TRIM25 are # 1 (5'-TTCCTCAGTTTGTACTCCAGG-3 ') and # 2 (5'-ATGATCCAGATCTATCTTAGG-3'). For lentiviral production, HEK-293T cells were transfected with 10 μg lentiviral vector. After infecting the cells with the viral vector, 3T3-L1 cells were selected by incubating with 2 μg / ml of puromycin (Millipore Sigma, St. Louis, MO).

Binding Assay, Immunoprecipitation and Antibodies

Fixed GST-fusion proteins (PPARγ domain mutations and TRIM25 cleavage mutations) were incubated with glutathione-agarose with PPARγ or TRIM25 expressing cell lysates at 4 ° C. for 2 hours. Protein complexes were separated by centrifugation and washed four times with binding buffer. Precipitates were detected by immunoblotting using anti-PPARγ or TRIM25 antibodies. To analyze the interaction between PPARγ and TRIM25, HEK-293 cells expressing PPARγ, TRIM25 or a mutation thereof were lysed with binding buffer and total cell lysate was added to FLAG M2 agarose (Millipore Sigma, St. Louis) at 4 ° C. , MO) were incubated together. Immunoprecipitation agents or total cell lysates were analyzed with specific antibodies, the antibodies used were: α-TRIM25, α-PPARγ, α-GST, α-Ub, α-aP2 and α-adipsin (Santa Cruz Biotechnology (Dallas, TX)), α-HA, α-actin, α-HSP90 and α-adiponectin (from Cell Signaling Technology (Danvers, MA)).

PPARγ  Identification of Binding Complexes

PPARγ-null mouse embryonic fibroblasts (MEFs) 7 were incubated in DMEM and 10% fetal bovine serum. The nuclear extract was prepared by stably expressing PPARγ-null MEFs with FLAG-PPARγW, incubated with immobilized FLAG M2 agarose, washed with binding buffer, and eluted with FLAG peptide. Immunoprecipitation proteins were separated by SDS-PAGE and the specific bands were cut out and digested with trypsin. Reverse phase LC-MS / MS was then performed using a high resolution hybrid mass spectrometer (LTQ-Orbitrap (Thermo Scientific, Waltham, Mass.)). All MS / MS spectra were examined against the Uniprot protein sequence database via SequestHT.

Reporter Gene Analysis

HEK-293 cells were transfected with pDR-1 luciferase reporter plasmid, PPARγ, RXRα and pRL-Renillia using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, Mass.). After transfection overnight, cells were treated with rosiglitazone for 24 hours. Cells were harvested and reporter gene analysis was performed using the Dual-Luciferase kit (Promega, Madison, Wis.). Luciferase activity was normalized to Renillia activity.

Gene expression analysis

Total RNA was isolated from cells or tissue using TRIzol reagent (Thermo Fisher Scientific, Waltham, Mass.). RNA was reverse transcribed using the ABI Reverse Transcription Kit. Quantitative PCR reactions were performed on an ABI9300 PCR machine with SYBR green fluorescent die. Relative mRNA expression was determined by the ΔΔ-Ct method normalized to tata-binding protein (TBP) levels.

In vitro Ubiquitination  analysis

FLAG-TRIM25 was transiently expressed in HEK-293 cells, purified using an anti-FLAG M2 affinity gel, and dissolved by addition of 3X FLAG peptide. Recombinant GST-PPARγ protein was added to 200 ng E1 (UBE1, Boston Biochem, Cambridge) in the presence or absence of TRIM25WT or TRIM25CS mutations in 60 μl reaction buffer (40 mM Tris-HCl, pH 7.6, 50 mM NaCl and 1 mM DTT). , MA), 500 ng E2 (UbcH5c, Boston Biochem, Cambridge, Mass.), 10 μg Ubiquitin, 2 mM ATP at 37 ℃ for 1 hour. After incubation, the reaction was separated with glutathione agarose and washed four times with binding buffer, followed by western blotting using α-Ub or α-PPARγ antibody. The reaction mixture was directly western blotted with α-TRIM25 antibody to view TRIM25 self-ubiquitination as a control.

Correlation Analysis in Human Adipose Tissue

TPM-standardized RNA-sequencing data from 338 subcutaneous adipose tissue samples was obtained from the GTEx portal using sample labels downloaded from ArrayExpress31. The Pearson correlation coefficient between TRIM25 and PPARγ in the fat sample was then calculated after removal of one extreme sample whose expression in either gene was at least 5 standard deviations from the mean. The two genes showed a significant negative correlation of -0.248 (p value 4.14E-6).

animal

All animal experiments were performed according to a procedure approved by the Institutional Animal Care and Use Committee of the Ulsan Institute of Science and Technology. Five-week-old male C57BL / 6J mice (DBL, Chungbuk, Korea) were fed high fat diet (60% kcal fat, D12492, Research Diets Inc., New Brunswick, NJ) for 10 weeks. ob / ob mice were purchased from Jackson Laboratories (Bar Harbor, ME).

RT- qPCR  Used primer

The primers used for RT-qPCR in the following examples are as follows.

QPCR Primer Foward Reverse Mouse TRIM25 ATGGCTCAGGTAACAAGGGAG GGGAGCAACAGGGGTTTTCTT Human TRIM25 GTCTCTACCCAGAACAGTTTCC ATCCAACACAGGCTGATTCC Mouse PPARη GCATGGTGCCTTCGCTGA TGGCATCTCTGTGTCAACCATG Mouse PPARη TCTCTCCGTAATGGAAGACC GCATTATGAGACATCCCCAC Mouse ap2 AAGGTGAAGAGCATCATAACCCT TCACGCCTTTCATAACACATTCC Mouse adiponectin TGTTCCTCTTAATCCTGCCCA CCAACCTGCACAAGTTCCCTT Mouse CEBPα CAAGAACAGCAACGAGTACCG GTCACTGGTCAACTCCAGCAC Mouse GLUT4 GATTCTGCTGCCCTTCTG ATTGGACGCTCTCTCTCC Mouse LPL  AACAAGGTCAGAGCCAAGAG  CCATCCTCAGTCCCAGAAAAG

Example 1 Evaluation of Interaction between TRIM25 and PPARγ

To identify potential PTM modulators of PPARγ, proteomic analysis of binding complexes formed with PPARγ was performed. 1A corresponds to silver staining of PPARγ and its related proteins, and FLAG-labeled PPARγ was purified using FLAG-M2 agarose. As shown in FIG. 1A, several bands were observed and liquid chromatography was performed in combination with dual mass spectrometry.

To confirm the interaction between TRIM25 and PPARγ, PPARγ was immunoprecipitated from cultured adipocytes and TRIM25 was detected by immunoblotting (Western blotting). As shown in FIG. 1B, PPARγ interacts with endogenous TRIM25. Structural aspects of the interaction between TRIM25 and PPARγ are in vitro using recombinant PPARγ fragments comprising A / B regions (transcriptional regulatory regions), DNA binding domains / hinge regions (DBD / H) and ligand binding domains (LBD). Was further investigated. As shown in FIG. 1C, TRIM25 specifically interacts with the DBD / H domain of PPARγ. In addition, a small region of the chopped TRIM25 fragment was introduced into HEK-293 cells and coimmunoprecipitated with TRIM25 to determine the specific region required for TRIM25 to bind PPARγ. HA-tag deletion mutations of TRIM25 were generated and they were expressed with PPARγ in HEK-293 cells. As shown in Figure 1d, it was confirmed that amino acids 81-185 of TRIM25 is required for interaction with PPARγ.

Example 2: E3 ligase activity of TRIM25 and stability of PPARγ protein

E3 ligase deficient TRIM25 mutations were used by mutating cysteine 50 and 53 with serine (C50S / C53S) (TRIM25CS) without E3 ubiquitin ligase activity to reveal the role of TRIM25 as E3 ligase.

First, luciferase assay was performed on HEK-293 cells expressing peroxisome proliferator response element (PPRE) -containing luciferase structure to investigate the effect of TRIM25 on PPARγ transcriptional activity. As shown in FIG. 2A, overexpression of TRIM25 ^WT decreased PPARγ transcriptional activity. In particular, TRIM25 ^CS could not inhibit PPARγ transcriptional activity, meaning that E3 ubiquitin ligase is important for regulating PPARγ transcriptional activity. As with these results, specific knockdown of TRIM25 using two different siRNAs # 1 and # 2 increased PPARγ transcriptional activity (see FIG. 2B). In addition, two other TRIM25 siRNAs increased PPARγ protein levels without altering mRNA levels (see FIG. 2C). In conclusion, these experimental results suggest that TRIM25 can regulate PPARγ protein levels according to E3 ligase activity.

Next, the effect of TRIM25 on PPARγ protein stability was investigated. Both TRIM25 ^WT and TRIM25 ^CS mutants interacted with PPARγ, while TRIM25 ^WT induced PPARγ degradation, while TRIM25 ^CS mutants did not (see FIG. 2D). In addition, increasing TRIM25 ^WT expression decreased PPARγ protein expression in a dose dependent manner, whereas TRIM25 ^CS mutants did not (see FIG. 2E). This means that the E3 ligase activity of TRIM25 is involved in PPARγ degradation.

Forced expression of TRIM25, on the other hand, significantly reduced the protein levels of PPARγ recovered by treatment with the specific proteasome inhibitor MG132 (see FIG. 2F). These results strongly suggest that PPARγ degradation is dependent on the proteasome pathway by TRIM25.

Finally, the half-life of PPARγ was measured by cycloheximide chase assay using overexpressed or down-regulated TRIM25. As shown in FIG. 3A, the half-life of PPARγ was significantly reduced by TRIM25 ^WT , while TRIM25 ^CS was not significantly reduced compared to the control. In addition, the results shown in Figure 3b, specific knockdown of TRIM25 can stabilize the PPARγ, it can be confirmed that TRIM25 is a major regulator of protein stability of PPARγ.

Example 3: Ubiquitinylation of PPARγ by TRIM25

A ubiquitination assay was performed to determine whether TRIM25 functions as an E3 ligase specific for PPARγ. Retroviral systems were used to prepare 3T3-L1 cell lines that stably overexpress TRIM25 ^WT or TRIM25 ^CS mutants. The cells, along with the control cell line transfected with the empty vector, completely differentiated into adipocytes. Endogenous PPARγ of cultured adipocytes was immunoprecipitated to detect ubiquitination of PPARγ via western blotting (FIG. 4A). Protein levels of PPARγ were reduced by TRIM25 ^WT , but TRIM25 ^WT increased PPARγ ubiquitination after pretreatment with MG132, while TRIM25 ^CS did not. Consistent with these results, transiently expressed TRIM25 ^WT enhanced PPARγ ubiquitination compared to TRIM25 ^CS mutant in human embryonic kidney (HEK) 293 cells (FIG. 4B).

In vitro ubiquitination assay using purified TRIM25 and PPARγ to confirm the direct effect of TRIM25 on ubiquitination of PPARγ showed that TRIM25 ^WT induces ubiquitination of recombinant PPARγ (FIG. 4C). ^CS was not (FIG. 4D). This suggests that PPARγ is a substrate of TRIM25.

Example 4 Tyrosine Phosphorylation of PPARγ

In addition, HEK-293 cells were transfected with PPARγ ^WT , PPARγ ^Y78F or PPARγ ^Y78E and TRIM25 ^WT to determine whether the known phosphorylation sites of PPARγ could modulate ubiquitination and degradation of PPARγ ^mediated by TRIM25. Next, protein expression was measured (FIG. 8A), and cell lysates were incubated with α-FLAG antibody to confirm ubiquitination of PPARγ by western blotting (FIG. 8B). As a result, it was observed that phosphorylation at PPARγ Y78 markedly inhibits TRIM25 mediated PPARγ ubiquitination and PPARγ accumulation. Tyrosine phosphorylation of PPARγ at Y78 is induced by c-Abl or c-Src kinases, both of which are required for adipocyte differentiation. Thus, these results suggest that the regulation of PPARγ phosphorylation at Y78 may be an important regulatory mechanism for protein stability and adipocyte differentiation.

Example 5: Correlation between TRIM25 and PPARγ

Western blot analysis and real-time PCR analysis were performed to investigate the physiological relationship between TRIM 25 and PPARγ. As a result, it was confirmed that TRIM25 was expressed in pre-adipocytes, and its expression was significantly reduced during adipogenesis (FIGS. 5A and 5B). In addition, unlike the expression of TRIM25, genes of adipogenic markers including PPARγ, aP2, and adiponectin were significantly increased, and the expression of TRIM25 was negatively correlated with PPARγ.

Next, the expression of TRIM25 was measured in adipose tissue of high fat diet-induced obesity model mice (HFD) and genetically induced obesity model mice (ob / ob). As a result, as shown in FIGS. 5C and 5D, the expression of TRIM25 was significantly downregulated, whereas the expression of PPARγ was significantly upregulated in adipose tissue of HFD and ob / ob mice compared to control mice.

To determine if the correlation between TRIM25 and PPARγ expression in adipose tissue is relevant in humans, we used RNA sequencing data from 338 human adipose tissues from the Genotype-Tissue Expression (GTEx) project. The correlation between TRIM25 and PPARγ gene expression was analyzed. As a result, as shown in Figure 5e, the expression of TRIM25 showed a significant negative correlation with the expression of PPARγ.

Example 6 Inhibitory Effect of TRIM25 on Adipocyte Differentiation

Consistent with the results of down regulation of PPARγ stability by TRIM25 confirmed in the above examples, it was confirmed that triglyceride accumulation was inhibited when TRIM25 ^WT was expressed during differentiation of 3T3-L1 cells (FIG. 6A). Accumulation of triglycerides was confirmed by Oil-red O staining. In addition, it was confirmed that the expression of mRNA of adipose cell selective proteins and genes including aP2, C / EBP-α, adiponectin, adipsin, glucose transporter-4 (GLUT4) and LPL was reduced (FIGS. 6B and 6C). In contrast, TRIM25 ^CS The mutants did not change the expression of fat forming markers. In addition, specific knockdown of TRIM25 using a lentivirus expressing shRNA targeting TRIM25 increased adipocyte differentiation (FIG. 6D) and adipocyte-specific protein and gene expression (FIG. 6E and 6F). ).

Using wild-type (WT) and TRIM25 knockout (KO) MEFs to confirm the effect of TRIM25 on lipogenesis, KO MEF showed significantly improved lipid accumulation compared to WT MEF (FIG. 7A). In addition, the expression of adipogenic markers was significantly increased in KO MEF compared to WT MEF (FIGS. 7B and 7C).

These results suggest that TRIM25 plays an important role in the regulation of PPARγ dependent adiogenesis processes.

Although the embodiments have been described with reference to the accompanying drawings, those skilled in the art may apply various technical modifications and variations based on the above. For example, the described techniques may be performed in a different order than the described method, and / or the described components may be combined or combined in a different form than the described method, or replaced or substituted by other components or equivalents. Appropriate results can be achieved.

Therefore, other implementations, other embodiments, and equivalents to the claims are within the scope of the following claims.

Claims (3)

delete A reagent composition for in vitro PPARγ degradation containing TRIM25 (tripartite motif-containing 25) as an active ingredient.
An in vitro PPARγ degradation method comprising the step of treating TRIM25 (tripartite motif-containing 25) in vitro.

Images