KR102051737B1 - Markers for diagnosing gastric marginal zone lymphoma and uses thereof - Google Patents

Abstract

The present invention relates to a diagnostic marker for gastric marginal lymphoma and its use, and more particularly, to a diagnostic marker composition for gastric marginal lymphoma comprising a specific gene mutation capable of causing gastric marginal lymphoma, and an agent for detecting the genetic mutation. It relates to a diagnostic composition for gastric marginal lymphoma, and a diagnostic method using the same. It is expected that the mutant gene and the protein encoded by the present invention can be usefully used to diagnose the disease earlier and more quickly as a marker for diagnosing the disease.

Description

Markers for diagnosing gastric marginal zone lymphoma and uses approximately}

The present invention relates to a diagnostic marker for gastric marginal lymphoma and its use, and more particularly, to a diagnostic marker composition for gastric marginal lymphoma comprising a specific gene mutation capable of causing gastric marginal lymphoma, and an agent for detecting the genetic mutation. It relates to a diagnostic composition for gastric marginal lymphoma, and a diagnostic method using the same.

Extranodal marginal zone lymphoma (EMZL) is a heterogeneous disease of low grade mature B-cell lymphoma accompanied by various genetic mutations. Chronic microbial infections and / or autoimmune diseases are known to be closely related to the development of this type of tumor. In particular, infection of Helicobacter pylori is associated with gastric nodular marginal cell lymphoma (Gastric), a mucosal lymphoid lymphoma. Extranodal marginal zone lymphoma (GMZL) has been reported to be the leading cause (Gut 2011; 60: 747-758). Although most tumors are known to respond well to H. pylori eradication treatment, some lymphomas may be resistant to the antibacterial therapy, which may be associated with the induction of genetic variation.

A variety of common and unique gene mutations in EMZL have been reported to regulate NF-κB and NOTCH signaling pathways, which are known to be important for the development and function of extranodal marginal B cells. For example, t (1; 14) (p22; q32) / BCL10-IGH, t (14; 18) (q32; q21) / IGH-MALT1 and t (11; 18) (q21; q21) / BIRC3 (API2) Certain chromosomal translocations, including -MALT1, are major genetic modifications associated with GMZL, which can induce carcinogenicity by activating both canonical and noncanonical NF-κB pathways. Tumor necrosis factor alpha (TNFα) -inducible protein 3 (TNFIP3), also known as A20, is a target of the canonical NF-κB pathway expressed by activation of NF-κB, but inhibits activity at several stages of the NF-κB activation pathway. Has a negative feedback function. Methylation, deletion or inactivation mutations of TNFAIP3 are known to cause unregulated activation of the NF-κB pathway.

In contrast, the proliferation of GMZL without translocation is largely dependent on the immune response generated by H. pylori , which includes individual Toll-like receptors caused by pathogen-associated lipopolysaccharides and autoantigens. TLRs) and B cell receptors (BCRs). In addition, bystander T cells help through the CD40L and B cell activating factors (BAFF) of the TNF family. CD40 activation induces the recruitment of an adapter protein known as the TNF receptor (TNFR) -related factor (TRAF) to the cytoplasmic domain of CD408. The TRAF family consists of TRAF1 to TRAF6, and TRAF3 in B cells negatively regulates the canonical and noncanonical NF-κB pathways as well as the Jun N-terminal kinase signaling. Deletion and loss of function of TRAF3 include human B cell chronic lymphocytic leukemia (CLL), mantle cell lymphoma (MCL), splenic marginal zone lymphoma (SMZL), and multiple myeloma ( Multiple myeloma, Waldenstrom's macroglobulinemia, and Hodgkin lymphoma have been reported to occur frequently, but no TRAF3 mutations in GMZL have been reported.

In this study, we investigated the genetic variation of H. pylori- positive GMZL that was resistant to H. pylori eradication.

The present invention was devised to solve the above problems, and the present inventors performed target sequencing to investigate somatic mutations of genes induced in H. pylori- positive gastric marginal lymphoma resistant to H. pylori eradication. As a result, the markers for diagnosing the disease were identified, and thus the present invention was completed.

Accordingly, the present invention includes a marker composition for diagnosing gastric marginal zone lymphoma (GMZL), comprising a TRAF3 (TNF Receptor Associated Factor 3) or TNFAIP3 (TNF alpha induced protein 3) mutant gene, or a protein encoded therefrom. The purpose is to provide.

In addition, the present invention is a gastric marginal lymphoma (TNF Receptor Associated Factor 3) or TNFAIP3 (TNF alpha induced protein 3) mutant gene, or a gastric marginal lymphoma, comprising an agent capable of detecting the expression of a protein encoded from the gene ( Another object is to provide a diagnostic composition for gastric marginal zone lymphoma (GMZL) and a diagnostic kit for gastric marginal lymphoma comprising the composition.

The present invention also provides information for diagnosing gastric limbic lymphoma, the present invention comprising the step of detecting the mRNA of the TRAF3 or TNFAIP3 mutant gene, or a protein encoded from the gene from a biological sample derived from patients with gastric margin lymphoma. It is another object to provide a method.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

According to an aspect of the present invention as described above, the present invention TRAF3 (TNF Receptor Associated Factor 3) or TNFAIP3 (TNF alpha induced protein 3) mutant gene, or the upper peripheral lymphoma, including proteins encoded from the gene ( It provides a diagnostic marker composition for gastric marginal zone lymphoma (GMZL).

In one embodiment of the invention, the marker composition may further comprise a CARD11 (caspase recruitment domain family member 11) or NOTCH1 mutant gene, or a protein encoded from the gene.

In addition, the present invention is a gastric marginal lymphoma (TNF Receptor Associated Factor 3) or TNFAIP3 (TNF alpha induced protein 3) mutant gene, or a gastric marginal lymphoma, comprising an agent capable of detecting the expression of a protein encoded from the gene ( It provides a diagnostic composition for gastric marginal zone lymphoma (GMZL).

In addition, the present invention provides a diagnostic kit for gastric marginal lymphoma, comprising the diagnostic composition.

In one embodiment of the present invention, the diagnostic composition may further comprise an agent capable of detecting the expression of the mRNA of the CARD11 (caspase recruitment domain family member 11) or NOTCH1 mutant gene, or the protein encoded from the gene.

In another embodiment of the present invention, the TRAF3 mutant gene may have one or more mutations selected from Table A below.

TABLE A

In another embodiment of the present invention, the TNFAIP3 mutant gene may have one or more mutations selected from Table B below.

TABLE B

In another embodiment of the present invention, the CARD11 mutant gene may have one or more mutations selected from Table C below.

TABLE C

In another embodiment of the present invention, the NOTCH1 mutant gene may have one or more mutations selected from Table D below.

TABLE D

In another embodiment of the present invention, the gastric marginal lymphoma may be positive for Helicobacter pylori ( Helicobacter pylori -positive GMZL).

In another embodiment of the present invention, the agent capable of detecting the mRNA expression may be a sense and antisense primer, or probe that complementarily binds to the mRNA of the mutant gene.

In another embodiment of the invention, the agent capable of detecting the protein may be an antibody that specifically binds to the protein.

In addition, the present invention comprises the steps of a) measuring the expression of mRNA of the TRAF3 (TNF Receptor Associated Factor 3) or TNFAIP3 (TNF alpha induced protein 3) mutant gene or a protein encoded therefrom from a biological sample derived from patients with gastric marginal lymphoma ; And

b) diagnosing gastric marginal zone lymphoma (GMZL), comprising diagnosing gastric marginal lymphoma when expression of the mRNA of the mutant gene or the protein encoded by the gene is detected in the sample. It provides a method of providing information.

In one embodiment of the present invention, the step (a) may further comprise the step of measuring the expression of the mRNA of the CARD11 (caspase recruitment domain family member 11) or NOTCH1 mutant gene, or the protein encoded from the gene.

In another embodiment of the present invention, the expression of mRNA is polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (Real-time PCR), RNase protection assay (RNase protection) RPA), microarray, and northern blotting can be measured by one or more methods selected from the group consisting of.

In another embodiment of the present invention, the protein expression level is Western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme immunoassay (ELISA), immunoprecipitation (immunoprecipitation) ), Flow cytometry, immunofluorescence, ouchterlony, complement fixation assay, and protein chip. It can be measured through.

The present inventors have detected somatic mutations of various genes that affect the onset and progression of the disease through target sequencing using tissues derived from patients with gastric marginal lymphoma.These mutant genes and proteins encoded therefrom diagnose the disease. It is expected to be useful as a marker for diagnosing the disease earlier and more quickly and accurately.

Figure 1a is a picture showing the rearrangement of the MALT1 gene as a result of FISH analysis using tissue from 19 patients with gastric marginal lymphoma patients, Figure 1b is BIRC3- observed in some of the seven samples confirmed the rearrangement of the MALT1 gene The figure shows the MALT1 fusion (BIRC3-MALT1 fusion).
FIG. 2 shows the results of Sanger sequencing of some tumor tissues identified with somatic mutations of TRAF3 , TNFAIP3 , or CARD11 in the tissues derived from 19 patients with gastric marginal lymphoma and normal tissues matched thereto.
3 is a heat map showing the results of mutual exclusion analysis of MALT1 , TRAF3 , and TNFAIP3 modifications in the tissues derived from 19 patients with gastric marginal lymphoma, showing that the modifications of the genes are mutually exclusive.
4 shows tumor tissues in which NOTCH1 somatic mutations were identified in 19 tissues derived from gastric marginal lymphoma patients and matched results of Sanger sequencing of normal tissues.

The present inventors conducted target sequencing to investigate somatic mutations of genes induced in H. pylori- positive gastric marginal lymphoma resistant to H. pylori eradication. To identify the markers for diagnosing the bar, the present invention was completed based on this.

Accordingly, the present invention includes a marker composition for diagnosing gastric marginal zone lymphoma (GMZL), comprising a TRAF3 (TNF Receptor Associated Factor 3) or TNFAIP3 (TNF alpha induced protein 3) mutant gene, or a protein encoded therefrom. To provide.

In the present invention, the marker composition may further comprise a CARD11 (caspase recruitment domain family member 11) or NOTCH1 mutant gene, or a protein encoded from the gene.

In addition, the present invention is a gastric marginal lymphoma (TNF Receptor Associated Factor 3) or TNFAIP3 (TNF alpha induced protein 3) mutant gene, or a gastric marginal lymphoma, comprising an agent capable of detecting the expression of a protein encoded from the gene ( Provided are a gastric marginal zone lymphoma (GMZL) diagnostic composition and a kit for diagnosing gastric marginal lymphoma comprising the same.

In the present invention, the diagnostic composition may further include an agent capable of detecting the expression of a mRNA of a CARD11 (caspase recruitment domain family member 11) or NOTCH1 mutant gene, or a protein encoded from the gene.

The subject disease to be diagnosed in the present invention, "gastric marginal zone lymphoma (GMZL)" is a gastric extra-nodal margin lymphoma, non-nodal marginal lymphoma may occur in any extra-nodal region, but about one third Is known to appear as primary gastric lymphoma. H. plyori infection is known to play an important role in the development of the lymphoma, and infection rates of about 90% or more have been reported. Therefore, H. plyori eradication treatment is performed for the treatment of lymphoma, but it is known that antifungal treatment alone is not expected in the case of advanced lesions and high malignant lymphoma. In addition, gastric marginal lymphoma is known to be difficult to diagnose due to its symptoms vary from the upper gastrointestinal discomfort, indigestion, heartburn to warning symptoms such as gastrointestinal bleeding or weight loss, and nonspecific. Therefore, early diagnosis is of paramount importance for the proper and rapid treatment of the lymphoma.

In the present invention, the gastric marginal lymphoma may be positive for H. plyori bacteria, and more preferably, it may be H. plyori bacteria positive gastric marginal lymphoma that is resistant to H. plyori eradication. It doesn't happen.

As used herein, the term “diagnosis” in the broad sense means to determine the actual condition of the patient's illness in all aspects. The contents of the judgment include the name of the disease, the etiology, the type of disease, the severity, the details of the condition, and the presence or absence of complications. Diagnosis in the present invention is to determine the onset and progression level of gastric marginal lymphoma.

The TRAF3 gene is composed of a sequence of NCBI accession number: NM_003300. In the present invention, the mutant gene thereof may have one or more mutations selected from Table A, but is not limited thereto.

TABLE A

The TNFAIP3 gene is composed of a sequence of NCBI accession number: NM_006290. In the present invention, the mutant gene thereof may have one or more mutations selected from Table B below, but is not limited thereto.

TABLE B

In the present invention, the CARD11 gene is composed of a sequence of NCBI accession number: NM_032415, and in the present invention, the mutant gene thereof may have one or more mutations selected from Table C below, but is not limited thereto. .

TABLE C

In the present invention, the NOTCH1 gene is composed of a sequence of NCBI accession number: NM_017617, and the mutant gene thereof in the present invention may have one or more mutations selected from Table D below, but is not limited thereto. .

TABLE D

Agents capable of detecting the mRNA expression may be, but are not limited to, sense and antisense primers or probes that complementarily bind to the mRNA of the mutant gene.

As used herein, the term "primer" refers to an oligonucleotide synthesized for use in diagnosis, DNA sequencing, and the like as a short gene sequence that is a starting point for DNA synthesis. The primers can be synthesized in a conventional length of 15 to 30 base pairs, but may vary depending on the purpose of use, and may be modified by methylation, capping, or the like by a known method.

As used herein, the term "probe" refers to a nucleic acid capable of specifically binding to mRNA of several to hundreds of bases in length, which has been produced through enzymatic chemical separation or purification. The presence of mRNA can be confirmed by labeling radioisotopes or enzymes, and can be designed and modified by known methods.

The agent capable of detecting the protein may be an antibody that specifically binds to the protein, but is not limited thereto.

As used herein, the term “antibody” includes immunoglobulin molecules that are immunologically reactive with specific antigens, and include both monoclonal and polyclonal antibodies. In addition, such antibodies include forms produced by genetic engineering such as chimeric antibodies (eg, humanized murine antibodies) and heterologous antibodies (eg, bispecific antibodies).

The diagnostic kit for gastric marginal lymphoma of the present invention consists of one or more other component compositions, solutions or devices suitable for analytical methods.

The present inventors detected somatic mutations of various genes in 19 gastric marginal lymphoma patient-derived tissues.

More specifically, in one embodiment of the present invention, FISH analysis confirmed the rearrangement of MALT1 in 7 of the 19 samples (36.8%) in accordance with the results of the conventional literature, through the target next generation sequencing It was confirmed that BIRC3-MALT1 fusion was detected in three of them (see Example 2).

In another embodiment of the present invention, as a result of performing target sequencing to detect somatic mutations in the 19 tissue samples, 4 (21.1%) of 19 samples detected somatic mutations of TRAF3 and 19 tissue samples. Three of them (15.8%) identified mutations in the TNFAIP3 gene, and one sample (5.3%) detected mutations in CARD11 . To verify this result, Sanger sequencing was performed using each tissue sample and its normal tissue (see Example 3).

In another embodiment of the invention, it was found that CoMEt mutual exclusivity subjected to tests MALT1 rearrangement at the 19 sample, TRAF3 variation, TNFAIP3 mutation is genetically modified takes place in a mutually exclusive through that does not appear together in the same sample (See Example 4).

In another embodiment of the present invention, it was detected that NOTCH1 gene mutations involved in the NOTCH signaling pathway occurred in three (15.8%) of 19 tissue samples, and this was also performed using DNA extracted from normal tissues for sequencing. Was performed to verify (see Example 5).

In another embodiment of the present invention, in addition to the above genes, mutations of genes involved in epigenetic genetic modification, immune regulation or avoidance, and DNA repair and integrity, and tumor suppressor genes were also detected (see Example 6).

Therefore, according to an embodiment of the present invention, it can be seen that the detection of TRAF3 and TNFAIP3 , in addition to CARD11 and NOTCH1 mutations, in which mutations are frequently induced in gastric marginal lymphoma, can be used as a genetic marker for diagnosing the disease.

Accordingly, in another embodiment of the present invention, the present invention provides a) coding for a mRNA of a TRAF3 (TNF Receptor Associated Factor 3) or TNFAIP3 (TNF alpha induced protein 3) mutant gene from a biological sample derived from patients with gastric marginal lymphoma, or the gene. Measuring the expression of the protein of interest; And

b) diagnosing gastric marginal zone lymphoma (GMZL), comprising diagnosing gastric marginal lymphoma when expression of the mRNA of the mutant gene or the protein encoded by the gene is detected in the sample. It provides a method of providing information.

The term "information providing method for the diagnosis of gastric marginal lymphoma" used in the present invention is to provide objective basic information necessary for the diagnosis of gastric marginal lymphoma as a preliminary step for diagnosis and excludes the clinical judgment or findings of the doctor. do.

In step (a), the method may further include measuring expression of mRNA of a CARD11 (caspase recruitment domain family member 11) or NOTCH1 mutant gene, or a protein encoded from the gene.

Biological samples derived from the patient may include, but are not limited to, tissues, cells, whole blood, blood, saliva, sputum, cerebrospinal fluid and urine.

The expression level of the mRNA is polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (Real-time PCR), RNase protection assay (RNase) by conventional methods known in the art protection assay (RPA), microarray, or northern blotting, or one or more methods selected from the group consisting of, but is not limited thereto.

The protein expression level is Western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme immunoassay (ELISA), immunoprecipitation (immunoprecipitation) by conventional methods known in the art One or more methods selected from the group consisting of flow cytometry, immunofluorescence, ouchterlony, complement fixation assay, or protein chip. It may be measured through, but is not limited thereto.

As a further aspect of the invention there is provided for TRAF3 (TNF Receptor Associated Factor 3) or TNFAIP3 (TNF alpha induced protein 3) mutant gene, or Helicobacter pylori (Helicobacter pylori) comprising a protein encoded from the gene Provided are marker compositions for predicting antibacterial treatment response.

As a further aspect of the invention there is provided TRAF3 (TNF Receptor Associated Factor 3) or TNFAIP3 (TNF alpha induced protein 3) containing an agent capable of detecting the expression of proteins encoded from the mRNA, or the gene of the mutant gene to, Helicobacter pylori provides a Helicobacter pylori eradication therapy response prediction for kits for (Helicobacter pylori) comprising a sterilizing treatment response prediction for the composition and the composition for the (Helicobacter pylori).

Hereinafter, preferred examples are provided to aid in understanding the present invention. However, the following examples are merely provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

EXAMPLE

Example 1 Experiment Preparation and Experiment Method

1-1. Patient Recruitment and Sample Preparation

A total of 534 patients with gastric extranodal marginal zone lymphoma (GMZL) were reviewed from 2007 to 2015. As a result, 325 of the 534 patients were GMZL positive for Helicobacter pylori ( H. pylori ), and 205 H. pylori negative GMZL were treated by other hospitals. H. pylori infection was not available due to the lack of tissue slides needed for a medical review. H. pylori -positive GMZL showed resistance to H. pylori eradication in 29 patients (29/325, 9%). As a result, the tumor tissues of 19 patients showed formalin and paraffin-embedded tissues. Production was possible. Two pathologists then reconfirmed the diagnosis for GMZL according to the recent WHO classification criteria and reviewed the pathological findings in all cases, and each tissue after treatment with bacteriostatic treatment according to the Groupe d'Etude des Lymphomes de l 'Adulte (GELA) histological scoring system. The pathological grade of was determined. Post-treatment responses in each case were defined based on the European Gastro-Intestinal Lymphoma Study (EGILS) consensus report.

In addition, all 19 patients received written informed consent for the tissues used in the study, and this study was conducted after approval from Samsung Medical Center's Institutional Review Board (IRB File No 2013-12-076-005). In addition, all investigations were carried out in accordance with the principles set out in the Helsinki Declaration and current amendments. The clinicopathological characteristics of the 19 patients are shown in Table 1 below.

Factor No. of patients (n = 19) (%) Age (median / range) (years) 56 / 40-64 Follow up durationafter eradication (median / range) (months) 17 / 6-50 Gender Male 11 (57.9) Femle 8 (42.1) Clinical stage IE 17 (89.5) IIE 1 * (5.3) IVE 1 ** (5.3) Multipleorgan involvement Yes 2 † (10.5) No 17 (89.5) Response to H.Pylori eradication Initially not responded 12 (63.2) Initially responded butrecurrent (<3 mo) 7 (36.8) Treatment after eradication Radiotherapy ± Re-eradication 14 (73.7) Chemotherapy ± Re-eradication 2 (10.5) Re-eradication only 1 (5.3) F / U only 2 (10.5) Dose (Gy) of radiation therapy 24 1 (5.3) 30 12 (63.2) 36 1 (5.3) Not done 5 (26.3) Recurrence Yes 5 (26.3) No 14 (73.7) MALT1 rearrangement positive 7 (36.8) negative 12 (63.2) BCL10 rearrangement positive 0 (0) negative 19 (100)

* One patient case with perigastric lymph nodes and small intestine (plant) (case number 8).

** One patient case with lung parenchyme (case number 4)

† Cases with local lymph nodes in the lungs and small intestine, respectively

1-2. FISH analysis for MALT1 and BCL10

For all 19 patient cases described in Example 1-1, Vysis LSI MALT1 Dual Color Break Apart Rearrangement Probe (Abbott / Vysis, Des Plaines, IL, USA) and Empire genomics BCL10 DualColor Break Apart Rearrangement Probe (Empire Genomics using the Buffalo, NY, USA) and subjected to FISH (Interphase fluorescence in situ hybridization) analysis to detect the MALT1 rearrangement (rearrangement) and BCL10 rearrangement. At least 250 nuclei per sample were evaluated under a fluorescence microscope (Zeiss Axioskop, Oberkochen, Germany) using a filter set recommended by Vysis (DAPI / Spectrum Orange dual bandpass, DAPI / Spectrum Green dual bandpass), except for overlapping nuclei. It was. Two fused or coexisting hybridization signals of LSI MALT1 were observed in normal cells, while one fused red signal and one green signal were observed for MALT1 related translocation. The cut off value determined for rearrangement detection of MALT1 and BCL10 was 5%. In addition, after analyzing the FISH results, cases were classified into subgroups according to the MALT1 and BCL10 rearrangements.

1-3. DNA Extraction from Paraffin-embedded Tumor Tissue Samples

QIAamp DNA Mini kit (Qiagen, Valencia, CA, USA) was used for all tissue slides capable of hematoxylin and eosin staining in GMZL-derived paraffin-embedded tissues resistant to H. pylori eradication. DNA was extracted from tumor cells. Extracted DNA quality and content were analyzed using a Nanodrop 8000 UV-Vis spectrometer (NanoDrop Technologies), Qubit 2.0 fluorescence photometer (Life Technologies), and a 2200 TapeStation Instrument (Agilent Technologies, Santa Clara, Calif., USA).

1-4. Detection of somatic mutations from target sequencing data

Target sequencing was performed using HemaSCAN, and the procedure was as follows. More specifically, a panel containing the entire exome of 425 genes associated with hematologic malignancies was used, and the mean value of the target range after deduplication was 703. Single nucleotide variants (SNV) have a variant allele frequency (VAF) of at least 1% (VAF ≥1%) using MuTect version 1.1.4, Lowfreq version 0.6.1 and VarDict version 1.06 software. Or variable supporting reads> 4. Sequencing errors were filtered using a machine learning algorithm with features extracted from the SAM file. In addition, Pindel version 0.2.5a4 was used to identify small insertions and deletions (indels) with mutant support reads greater than 9. In addition, the 1000 Genome Project Database (http://www.internationalgenome.org/), the Exome Aggregation Consortium (ExAC) database (http://exac.broadinstitute.org/), and the NHLBI Exome Sequencing Project (ESP) database (https) : //esp.gs.washington.edu/drupal/), Korean Standard Genome Database (KRGDB, http://152.99.75.168/KRGDB/), Korean Variant Archive (KOVA, https://kobic.re.kr/) kova /) or variants with minor allele frequencies of 1% or greater in 192 Korean personal databases were filtered out. We selected missense mutations that are expected to be functionally affected by the Mendelian Clinically Applicable Pathogenicity (M-CAP) score. Copy number variation and tumor purity were named using a custom built algorithm. Genes with a copy number greater than 6 were considered amplified and genes with a copy number less than 1.2 were considered deleted. Structural variations and many indels variations were made using a custom-built algorithm where the variation-supported readings exceeded 20.

1-5. Sanger sequencing analysis of TRAF3, NOTCH1, CARD11 and TNFAIP3 mutations in normal samples

We performed Sanger sequencing on normal tissues that matched each mutant tumor tissue to verify whether the TRAF3 , NOTCH1 , CARD11 or TNFAIP3 mutations found by target sequencing were somatic mutations. Bone marrow specimens or biopsy specimens of patients from other organs without histopathological changes were used as the normal samples. Polymerase chain reaction (PCR) for amplification was carried out in 25 μl final volume using 1 μl DNA extracted from paraffin embedded tissue using AmpliTaq Gold Master mix (Thermo Fisher Scientific). The sample was denatured at 95 ° C. for 10 minutes, followed by 35 cycles with conditions of 30 seconds at 95 ° C., 30 seconds at 56 ° C. or 59 ° C. and 1 minute at 72 ° C., and final elongation at 72 ° C. for 7 minutes. It was made. Primer sequences and annealing temperatures used in the above process are as shown in Table 2 below. For Sanger sequencing, the PCR product was purified and analyzed using an ABI3730XL DNA analyzer to confirm the presence of each mutation.

gene Alteration direction Sequence (5'-3 ') Tm (℃) SEQ ID NO: TRAF3 c.246-2A> G Forward CACTGTGCAGACCTGACCAT 59 One Reverse ACACGCTGTACATTTTGGACT 2 TRAF3 p.286_286del Forward TGAAAACCACTTTTGGTTACAT 56 3 Reverse TCTCAATTTCAATTTCAAAGCTACA 4 TRAF3 I323fs, D334E Forward GTGGTGCAGCATTTTCCGAGT 59 5 Reverse ATGCTGTCTGCTTCCTCCCAG 6 TRAF3 S472L Forward CCTTTACAGCCAGCCTTTCT 59 7 Reverse GGCATCATATTCTCCACGCA 8 TNFAIP3 p.134_134del Forward GCATGCCACTTCTCAGTACA 59 9 Reverse TTTGAGAGACTCCAGTTGCC 10 TNFAIP3 c.296-2A> G, N102S Forward TCTGAAAACCTTTGCTGGGTC 59 11 Reverse CAAGTCTGTGTCCTGAACGC 12 TNFAIP3 L335fs Forward ATCTTGTGTGTGATTTTGTGTA 56 13 Reverse GCCATTTCTTGTACTCATGCT 14 NOTCH1 D259E Forward CTCAGGGAAGAGGCTGACC 59 15 Reverse GTTGTAGGTGTTCACGCCG 16 NOTCH1 p.2514fs Forward CTCGCAGCACAGCTACTC 56 17 Reverse CAGTCGGAGACGTTGGAATG 18 NOTCH1 W1813S Forward CCCAGGCCCCTGAAGAAC 59 19 Reverse GGCAGCAGGTGCCCG 20 NOTCH1 K186N Forward CCTTCGAGGCCTCCTACATC 59 21 Reverse GGCAGACGCAGCGGTA 22 CARD11 X228delinsLQLX Forward CAACTACAACTTAGCCATGCG 59 23 Reverse AGAATTGAGCCCTGGTGACA 24 CARD11 p344_344del, S348R Forward CAGCTTTCAGTCCTGACCTATTG 59 25 Reverse ATGACCGTGTTCATGCGGTG 26

Example 2. MALT1 and BCL10 Rearrangement Detection

FISH was performed using the 19 patient-derived samples according to the method described in Example 1-2 to analyze the rearrangement of MALT1 and BCL10 .

As a result, as shown in FIG. 1A, rearrangement of the MALT1 gene was confirmed in 7 out of the 19 samples (36.8%), which is consistent with the conventional literature. However, because the Break Apart probe was used, the partner gene rearranged to MALT1 could not be identified from the FISH results. As a result of performing targeted next-generation sequencing (NGS), BIRC3-MALT1 fusion was detected in three out of seven samples in which the rearrangement of the MALT1 gene was confirmed. Figure 1b is shown graphically. More specifically, the fusions include those in which BIRC3 Intron 6 and MALT1 Exon 6 are fused or those in which BIRC3 Intron 6 and MALT1 Intron 8 are fused. The three cases showed translocation of MALT1 in the FISH results, and the breakpoint of the fusion was located at or near the MALT1 exon. On the other hand, in the remaining four samples where MALT1 rearrangements were detected from the FISH results, no fusion was detected by target sequencing, presumably because the translocation site was not included in the target sequencing region.

In addition, no BCL10 rearrangement was observed in samples of all patients, which is reported to occur rarely in about 4% of GMZL patients.

Example 3. Confirmation of TRAF3 and TNFAIP3 Mutations

The present inventors attempted to analyze somatic single nucleotide variation (SNV) in the 19 patient-derived tissue samples. As a result, an average of 14 nonsilent substitutions per tumor sample (median 12, range, 0-26) was identified. Furthermore, in order to increase the selectivity to exclude mutations that are predicted to be low in normal population or low protein structural changes, we reselected SNVs with a MAF of 0.1% or greater from normal population data and had an M-CAP score greater than 0.025 (tumor samples). 14 non-silent substitutions per median, median, 5, range 0-18). In addition, traditional Sanger sequencing was performed to determine whether each mutation is a somatic cell mutation and analyzed for the presence of protein mutations detected in each tumor in normal tissues matching the tumor tissue.

As a result, frameshift deletion, nonsynonymous SNVs, splicing mutations, and frameshift insertion, respectively, in four of the 19 samples (21.1%), as shown in Table 3 below. Disruptive deformation in TRAF3 corresponding to (frameshift insertion) was detected. One of four samples with these TRAF3 mutations had both conjugation mutations and frameshift insertion. In addition, it was confirmed that three of the 19 samples (15.8%) had a mutation of the somatic TNFAIP3 gene corresponding to frameshift insertion, frameshift deletion and conjugation mutation, respectively. Inactivation of these genes is associated with the pathogenesis of B cell lymphoma through activation of the NF-κB signaling pathway.

Results of targeted sequencing using NGS platform Validation experiments Gene Case number Chr Exon Variant Classification AA change CDS change VAF (%) Sanger Sequencing ddPCR NF-κB
pathway TRAF3 Case 1 chr14 exon3 splicing c.246-2A> G 3.42% Not detected Detected chr14 exon10 frameshift insertion p.I323fs c.968_969
insA 2.10% Not detected NA Case 10 chr14 exon10 nonsynonymous SNV p.D334E c.1002C> A 1.36% Not detected NA Case 12 chr14 exon11 nonsynonymous SNV p.S472L c.1415C> T 25.41% Detected ND Case 15 chr14 exon9 frameshift deletion p.K286fs c.856_857delAA 13.15% Detected ND TNFAIP3 Case 6 chr6 exon7 frameshift insertion p.P336fs c.1004_1005
insA 9.62% Detected ND Case 7 chr6 exon3 frameshift deletion p.D134fs c.401_402
delAC 26.71% Detected ND Case 11 chr6 exon3 splicing c.296-2A> G 6.78% Not detected Detected CARD11 Case 6 chr7 exon8 nonframeshift deletion p.K344del c.1028_1030
delAGA 9.41% Detected ND chr7 exon5 nonframeshift insertion p.227_228insLQL c.681_682ins
CTCCAACTC 10.22% Not detected ND NOTCH
pathway NOTCH1 Case 7 chr9 exon34 frameshift deletion p.P2514fs c.7541_7542
delCT 9.26% Detected ND Case 10 chr9 exon5 nonsynonymous SNV p.D259E c.777C> A 1.02% Not detected Not detected Case 11 chr9 exon34 frameshift deletion p.P2514fs c.7541_
7542delCT 12.21% Detected ND

In addition, since we performed target sequencing using the NGS platform, we also detected subclone mutations with low VAF that may be excluded from conventional Sanger sequencing results. Reflecting these limitations, Sanger sequencing revealed one frameshift deletion and one nonsynonymous single base mutation of TRAF3 in the tumor sample as shown in FIG. 2, but showed very low VAF (<5%). Three other mutations indicated were not detected. In addition, no variation of TRAF3 was found in DNA extracted from matched normal tissues. For TNFAIP3 mutations, Sanger sequencing detected frameshift insertion and frameshift deletion in tumor samples, but no conjugation mutations representing 6.8% of VAF were identified.

In addition, another somatic mutation that activates the NF-κB pathway was detected in one sample (5.3%) of non-frameshift deletion of CARD11 , which is known to act as a positive regulator of the NF-κB pathway. CARD11 variant of the modification of the other hand, BIRC3 and TRAF3 to enhance the activation of the canonical NF-κB pathway can increase the NF-κB signaling noncanonical path. In total, eight of the 19 samples (42.1%) had somatic monobasic mutations or frameshift indels including activation of the NF-κB pathway.

Example 4 Mutual Exclusion Analysis Between MALT1 Rearrangements and Genetic Variations Including TRAF3 and TNFAIP3 Mutations

Mutual exclusivity analysis was performed to determine whether the seven MALT1 rearrangements, four TRAF3 mutations and three TNFAIP3 somatic mutations identified in Examples 2 and 3 occurred together in the same patient-derived tissue.

As a result, as shown in Figure 3, it was confirmed that the modification of the genes are mutually exclusive in the 19 samples of refractory mucosal associated lymphoid lymphoma (MALT lymphoma). In other words, no modifications of the three genes were found in the same sample, and these results were confirmed through the significant results in the CoMEt mutual exclusion test (p = 0.004).

Example 5 Confirmation of NOTCH1 Variation

The genes involved in the NOTCH signaling pathway consisted of a second group of genes that cause mutations. As a result of analyzing the genetic variation related to the NOTCH signaling pathway in the 19 tissue samples, non-synonymous single base variation (n = 1) and frame shift in 3 (15.8%) of the tumor tissue samples as shown in Table 3 above. Somatic mutation corresponding to deletion (n = 2) was detected. In contrast, NOTCH2 mutations were not detected in all samples. In addition, as shown in FIG. 4, the detected NOTCH1 mutations were verified by DNA extracted from matched normal tissues using conventional Sanger sequencing.

Example 6. Other Gene Mutation Analysis

In addition to the genes, we tried to detect the mutation of other genes involved in epigenetic gene modification, immune regulation and avoidance, DNA repair and integrity.

First, chromatin modification, and then such and enterprise controlled analysis of the variations whether genes that are involved in sexual genetic variation, is essential for transcriptional repression eye peripheral lymphoma; TBL1XR1 known that frequent mutations are induced in (ocular marginal zone lymphoma OMZL) Mutations occurred in three of these 19 samples (n = 3, 15.8%). In addition, mutations in the HIST1H2AC (n = 1), HIST1H3B (n = 1), ARID1A (n = 1), EP300 (n = 1), and CUX1 (n = 1) genes included in the group were also confirmed. It was. Mutations in the genes in this group were detected in 7 out of 19 samples (36.8%), suggesting that mutations in epigenetic modification factors may contribute to the mutant nature of GMZL.

In addition, non- synonymous single base mutations of CIITA involved in immune regulation or evasion were identified in three samples, and non- synonymous single base mutations of CD36 were identified in three samples. All of these mutations were predicted as nontruncating mutations.

In addition, frameshift deletion (n = 1) of TP53 , a gene related to DNA repair and integrity, and non-synonymous single base mutation (n = 1) of ATM were identified. Although only one sample (Sample 15) had a mutation in TP53 , it shows the persistence of refractory GMZL without modification to diffuse large B-cell lymphoma.

Mutations in tumor suppressor genes were also observed: NF1 (n = 3), MSH3 (n = 2), APC (n = 2), BRCA1 (n = 2), BRCA2 (n = 2) and MLH1 (n = 2). Overall, mutations in tumor suppressor genes were identified in 47.4% of samples. More specific research is needed on the specific effects of some of these mutations on the development of lymphoma.

The description of the present invention set forth above is for illustrative purposes, and one of ordinary skill in the art may understand that the present invention may be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. There will be. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive.

<110> SAMSUNG LIFE PUBLIC WELFARE FOUNDATION <120> Markers for diagnosing gastric marginal zone lymphoma and uses          about <130> PD17-152 <160> 26 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRAF3_c.246-2A> G_Forward <400> 1 cactgtgcag acctgaccat 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TRAF3_c.246-2A> G_Reverse <400> 2 acacgctgta cattttggac t 21 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TRAF3_p.286_286del_Forward <400> 3 tgaaaaccac ttttggttac at 22 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TRAF3_p.286_286del_Reverse <400> 4 tctcaatttc aatttcaaag ctaca 25 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TRAF3_I323fs, D334E_Forward <400> 5 gtggtgcagc attttccgag t 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TRAF3_I323fs, D334E_Reverse <400> 6 atgctgtctg cttcctccca g 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRAF3_S472L_Forward <400> 7 cctttacagc cagcctttct 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TRAF3_S472L_Reverse <400> 8 ggcatcatat tctccacgca 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFAIP3_p.134_134del_Forward <400> 9 gcatgccact tctcagtaca 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFAIP3_p.134_134del_Reverse <400> 10 tttgagagac tccagttgcc 20 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TNFAIP3_c.296-2A> G, N102S_Forward <400> 11 tctgaaaacc tttgctgggt c 21 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> TNFAIP3_c.296-2A> G, N102S_Reverse <400> 12 caagtctgtg tcctgaacgc 20 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> TNFAIP3_L335fs_Forward <400> 13 atcttgtgtg tgattttgtg ta 22 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TNFAIP3_L335fs_Reverse <400> 14 gccatttctt gtactcatgc t 21 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NOTCH1_D259E_Forward <400> 15 ctcagggaag aggctgacc 19 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> NOTCH1_D259E_Reverse <400> 16 gttgtaggtg ttcacgccg 19 <210> 17 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NOTCH1_p.2514fs_Forward <400> 17 ctcgcagcac agctactc 18 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NOTCH1_p.2514fs_Reverse <400> 18 cagtcggaga cgttggaatg 20 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> NOTCH1_W1813S_Forward <400> 19 cccaggcccc tgaagaac 18 <210> 20 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> NOTCH1_W1813S_Reverse <400> 20 ggcagcaggt gcccg 15 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> NOTCH1_K186N_Forward <400> 21 ccttcgaggc ctcctacatc 20 <210> 22 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> NOTCH1_K186N_Reverse <400> 22 ggcagacgca gcggta 16 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CARD11_X228delinsLQLX_Forward <400> 23 caactacaac ttagccatgc g 21 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CARD11_X228delinsLQLX_Reverse <400> 24 agaattgagc cctggtgaca 20 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CARD11_p344_344del, S348R_Forward <400> 25 cagctttcag tcctgaccta ttg 23 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CARD11_p344_344del, S348R_Reverse <400> 26 atgaccgtgt tcatgcggtg 20

Claims (26)

A marker composition for diagnosing gastric marginal zone lymphoma (GMZL), comprising a TRAF3 (TNF Receptor Associated Factor 3) or TNFAIP3 (TNF alpha induced protein 3) mutant gene, or a protein encoded therefrom.
Wherein said TRAF3 mutant gene has one or more mutations selected from Table A below,
TABLE A

The TNFAIP3 mutant gene is characterized in that it has one or more mutations selected from Table B, marker composition.
TABLE B

The method of claim 1,
The marker composition, characterized in that further comprising a CARD11 (caspase recruitment domain family member 11) or NOTCH1 mutant gene, or a protein encoded from the gene,
Wherein the CARD11 mutant gene has one or more mutations selected from Table C below,
TABLE C

The NOTCH1 mutant gene is characterized in that it has one or more mutations selected from Table D below.
TABLE D

delete delete delete delete The method of claim 1,
The gastric marginal lymphoma is characterized in that the Helicobacter pylori- positive bacteria ( Helicobacter pylori -positive GMZL), marker composition.
TRAF3 (TNF Receptor Associated Factor 3) or TNFAIP3 (TNF alpha induced protein 3) containing the mRNA, or agents capable of detecting the expression of proteins encoded from the gene of the mutant gene, upper marginal lymphoma (gastric marginal zone lymphoma; GMZL) diagnostic composition,
Wherein said TRAF3 mutant gene has one or more mutations selected from Table A below,
TABLE A

The TNFAIP3 mutant gene is characterized in that it has one or more mutations selected from Table B, diagnostic composition.
TABLE B

The method of claim 8,
The diagnostic composition is a diagnostic composition, characterized in that it further comprises an agent capable of detecting the mRNA of the CARD11 (caspase recruitment domain family member 11) or NOTCH1 mutant gene, or the expression of a protein encoded from the gene,
Wherein the CARD11 mutant gene has one or more mutations selected from Table C below,
TABLE C

The NOTCH1 mutant gene is characterized in that it has one or more mutations selected from Table D, diagnostic composition.
TABLE D

delete delete delete delete The method of claim 8,
The gastric marginal lymphoma is positive for Helicobacter pylori ( Helicobacter pylori -positive GMZL), characterized in that the diagnostic composition.
The method according to claim 8 or 9,
The agent capable of detecting mRNA expression is characterized in that the sense and antisense primers or probes that complementarily bind to the mRNA of the mutant gene, diagnostic composition.
The method of claim 8 or 9,
The agent capable of detecting the protein is characterized in that the antibody that specifically binds to the protein, diagnostic composition.
10. A kit for diagnosing gastric marginal zone lymphoma (GMZL), comprising the composition of claim 8.
a) measuring the expression of mRNA of a TRAF3 (TNF Receptor Associated Factor 3) or TNF alpha induced protein 3 ( TNFAIP3 ) mutant gene, or a protein encoded from the gene, from a biological sample from a gastric margin lymphoma patient; And
b) diagnosing gastric marginal zone lymphoma (GMZL), comprising diagnosing gastric marginal lymphoma when expression of the mRNA of the mutant gene or the protein encoded by the gene is detected in the sample. As an information providing method for
Wherein said TRAF3 mutant gene has one or more mutations selected from Table A below,
TABLE A

The TNFAIP3 mutant gene is characterized in that it has one or more mutations selected from Table B, information providing method.
TABLE B

The method of claim 18,
In the step (a) further comprising the step of measuring the expression of mRNA of the CARD11 (caspase recruitment domain family member 11) or NOTCH1 mutant gene, or the protein encoded from the gene, information providing method,
Wherein the CARD11 mutant gene has one or more mutations selected from Table C below,
TABLE C

The NOTCH1 mutant gene is characterized in that it has one or more mutations selected from Table D below, information providing method.
TABLE D

delete delete delete delete The method of claim 18,
Said gastric marginal lymphoma is Helicobacter pylori -positive GMZL, characterized in that the information providing method.
The method of claim 18 or 19,
Expression of the mRNA is polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (Real-time PCR), RNase protection assay (RNase protection assay; RPA), microarray ( microarray), and northern blotting. The method of claim 1, wherein the method is measured by at least one method selected from the group consisting of:
The method of claim 18 or 19,
The protein expression level is Western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme immunoassay (ELISA), immunoprecipitation, flow cytometry, Characterized in that it is measured by one or more methods selected from the group consisting of immunofluorescence, ouchterlony, complement fixation assay, and protein chip, How to Provide Information.

Images