KR102040303B1 - A primer and a probe for detecting biological agents, a kit comprising the same, and a detection method using the same - Google Patents

Abstract

The present invention provides a primer and probe set for simultaneous detection of a biological agent, consisting of two or more selected from the group or a combination thereof, the group consisting of: a primer and probe for detecting Vibrio cholerae and Bacillus anthracis; a primer and probe for detecting Salmonella typhi; a primer and probe for detecting Yersinia pestis; a primer and probe for detecting Francisella tularensis; a primer and probe for detecting Rickettsia prowazekii; a primer and probe for detecting a variola virus; a primer and probe for detecting a yellow fever virus; a primer and probe for detecting Hantavirus; a primer and probe for detecting Brucella; and a primer and probe for detecting Shigella dysenteriae. The present invention also provides a kit comprising the primer and probe set and a detection method using the same.

Description

A primer and a probe for detecting biological agents, a kit comprising the same, and a detection method using the same}

The present invention is a primer for detecting Bacillus anthracis comprising a nucleotide sequence of SEQ ID NO: 1 to 12 in detecting a nucleic acid of a biological agent using a real time polymer chain reaction (RT-PCR) And probes; Primers and probes for detecting cholera bacteria (vibrio cholerae) comprising the nucleotide sequences of SEQ ID NOs: 13 to 21; Primers and probes for detecting typhoid bacteria (Salmonella typhi) comprising the nucleotide sequences of SEQ ID NOs: 22 to 27; Primers and probes for detecting Ysterinia pestis comprising the nucleotide sequences of SEQ ID NOs: 28 to 36; Primers and probes for detecting a bacterium (Francisella tularensis) comprising the nucleotide sequence of SEQ ID NO: 37 to 39; Primers and probes for detecting Rickettsia prowazekii comprising the nucleotide sequences of SEQ ID NOs: 40 to 42; Primers and probes for detecting smallpox virus (Variola virus) comprising the nucleotide sequences of SEQ ID NOs: 43 to 45; Primers and probes for detecting yellow fever virus comprising a nucleotide sequence of SEQ ID NOs: 46 to 48; Primers and probes for detecting Hantavirus comprising the nucleotide sequences of SEQ ID NOs: 49 to 51; Primers and probes for detecting Brucella, comprising the nucleotide sequence of SEQ ID NOs: 52 to 60; And primers and probes for detecting the Shigella dysenteriae comprising the nucleotide sequence of SEQ ID NO: 61 to 63; Regarding a primer and a probe set for simultaneous detection of biological agents comprising two or more selected from the group consisting of two or a combination thereof, more specifically, a detection kit comprising two or more primers and a probe set and a detection method using the same It is about.

Biological agents are microorganisms and toxins that are mobilized in military operations to cause disease or alter substances in humans, animals and plants. In other words, biological agents are agents that can use microorganisms such as bacteria, viruses, and fungi or toxins produced by these microorganisms to inactivate the physiological functions of surrounding organisms or to induce the deterioration of foods and to prevent the use of supplies. It is not only limited to the situation of war, but also can be used as a biological warfare in everyday life, such as anthrax terrorism that occurred in the United States in 2001. .

Above all, in the light of the situation of Korea, the world's only divided country, it is necessary to prepare for the national security. Even if we consider political changes such as North Korea's declaration of abandonment of nuclear weapons and the bombing of Punggye-ri Nuclear Test Center, it would be dangerous until the peace between the two Koreas reached a certain level of stability. It can be considered dangerous.

In addition, it is necessary to develop an NBC integrated battlefield management system that can promptly and accurately predict pollution and timely response to NBC, another asymmetric power other than North Korea's nuclear power. Just because North Korea gives up its nuclear weapons does not mean it gives up other killing weapons, such as biochemical weapons. Therefore, when the North uses biochemical weapons, astronomical casualties of the people are expected. Therefore, it is an urgent task to develop technologies for early detection or simultaneous detection.

There are 13 biological weapons known to be possessed by North Korea, including anthrax, typhoid fever, dysentery, cholera, plague, brucellella, yato, rash typhoid, smallpox, epidemic hemorrhagic fever, yellow fever, botulinum toxin, and hwangwoo toxin. It is said to have more than 5,000 tons of chemical weapons. The development of biological weapons in North Korea began in 1954 with a microbiological research institute established in Ganggye, Jagang Province. Today, the development of new bacteria through genetic mutations is under way. Assuming that these biological weapons are sprayed dozens of kilograms in Seoul, a large number of casualties will occur in the absence or lack of vaccines or therapeutics for biological weapons spread in Korea, especially if they include casualties from secondary infections. This would be impossible.

Therefore, in order to minimize human injury in case of emergency, it is urgent to develop a biological agent simultaneous detection technology for rapidly detecting a variety of dangerous pathogenic bacteria.

The present invention is a primer for detecting Bacillus anthracis comprising a nucleotide sequence of SEQ ID NO: 1 to 12 in detecting a nucleic acid of a biological agent using a real time polymer chain reaction (RT-PCR) And probes; Primers and probes for detecting cholera bacteria (vibrio cholerae) comprising the nucleotide sequences of SEQ ID NOs: 13 to 21; Primers and probes for detecting typhoid bacteria (Salmonella typhi) comprising the nucleotide sequences of SEQ ID NOs: 22 to 27; Primers and probes for detecting Ysterinia pestis comprising the nucleotide sequences of SEQ ID NOs: 28 to 36; Primers and probes for detecting a bacterium (Francisella tularensis) comprising the nucleotide sequence of SEQ ID NO: 37 to 39; Primers and probes for detecting Rickettsia prowazekii comprising the nucleotide sequences of SEQ ID NOs: 40 to 42; Primers and probes for detecting smallpox virus (Variola virus) comprising the nucleotide sequences of SEQ ID NOs: 43 to 45; Primers and probes for detecting yellow fever virus comprising a nucleotide sequence of SEQ ID NOs: 46 to 48; Primers and probes for detecting Hantavirus comprising the nucleotide sequences of SEQ ID NOs: 49 to 51; Primers and probes for detecting Brucella, comprising the nucleotide sequence of SEQ ID NOs: 52 to 60; And primers and probes for detecting the Shigella dysenteriae comprising the nucleotide sequence of SEQ ID NO: 61 to 63; Comprising two or more selected from the group consisting of, or a combination thereof, a primer and probe set for simultaneous detection of biological agents, a kit comprising the same and a detection method using the same.

However, the problem to be solved by the present invention is not limited to the above-mentioned problem, another task that is not mentioned will be clearly understood by those skilled in the art from the following description.

According to one embodiment of the present invention, in detecting nucleic acid of a biological agent using a real time polymer chain reaction (RT-PCR), anthrax comprising the base sequence of SEQ ID NO: 1 to 12 ( Bacillus anthracis) primers and probes for detection; Primers and probes for detecting cholera bacteria (vibrio cholerae) comprising the nucleotide sequences of SEQ ID NOs: 13 to 21; Primers and probes for detecting typhoid bacteria (Salmonella typhi) comprising the nucleotide sequences of SEQ ID NOs: 22 to 27; Primers and probes for detecting Ysterinia pestis comprising the nucleotide sequences of SEQ ID NOs: 28 to 36; Primers and probes for detecting a bacterium (Francisella tularensis) comprising the nucleotide sequence of SEQ ID NO: 37 to 39; Primers and probes for detecting Rickettsia prowazekii comprising the nucleotide sequences of SEQ ID NOs: 40 to 42; Primers and probes for detecting smallpox virus (Variola virus) comprising the nucleotide sequences of SEQ ID NOs: 43 to 45; Primers and probes for detecting yellow fever virus comprising a nucleotide sequence of SEQ ID NOs: 46 to 48; Primers and probes for detecting Hantavirus comprising the nucleotide sequences of SEQ ID NOs: 49 to 51; Primers and probes for detecting Brucella, comprising the nucleotide sequence of SEQ ID NOs: 52 to 60; And primers and probes for detecting the Shigella dysenteriae comprising the nucleotide sequence of SEQ ID NO: 61 to 63; Provided is a primer and probe set for simultaneous detection of biological agents, consisting of two or more selected from the group consisting of or a combination thereof.

According to one side, the primers and probes for detecting anthrax (Bacillus anthracis) may be specific to the target genes PA, LF, PXO2 and Ba813F.

According to one side, the primers and probes for detecting cholera bacteria (vibrio cholerae), may be specific to the target genes CtxB, O1 and O139.

According to one side, the primers and probes for detecting Typhoid bacteria (Salmonella typhi), may be specific to the target genes ViaB and FliC.

According to one side, the primer and probe for detecting the pest (Yersinia pestis) may be specific to the target genes Caf1, Pla and yihN.

According to one side, the primers and probes for detecting the disease (Francisella tularensis), may be specific to the target gene FopA.

According to one side, the primers and probes for the detection of the rash Typhus (Rickettsia prowazekii) may be specific for the target gene 17kDa.

According to one side, the primer and probe for detecting the smallpox virus (Variola virus), may be specific to the target gene HA.

According to one side, the yellow fever virus detection primer and probe may be specific to the target gene polyprotein (Polyprotein), the primers and probe for detection of Hantavirus (Hantavirus), target gene Cap It may be specific to.

According to one side, the brucella (Brucella) detection primers and probes may be specific to the target genes AlkB, IS711 and BR0952.

According to one side, the primer and probe for detecting the Shigella dysenteriae may be specific to the target gene HP.

According to another embodiment of the present invention, in detecting a nucleic acid of a biological agent using a real time polymer chain reaction (RT-PCR), anthrax comprising the base sequence of SEQ ID NO: 1 to 12 Primers and probes for detecting Bacillus anthracis; Primers and probes for detecting cholera bacteria (vibrio cholerae) comprising the nucleotide sequences of SEQ ID NOs: 13 to 21; Primers and probes for detecting typhoid bacteria (Salmonella typhi) comprising the nucleotide sequences of SEQ ID NOs: 22 to 27; Primers and probes for detecting Ysterinia pestis comprising the nucleotide sequences of SEQ ID NOs: 28 to 36; Primers and probes for detecting a bacterium (Francisella tularensis) comprising the nucleotide sequence of SEQ ID NO: 37 to 39; Primers and probes for detecting Rickettsia prowazekii comprising the nucleotide sequences of SEQ ID NOs: 40 to 42; Primers and probes for detecting smallpox virus (Variola virus) comprising the nucleotide sequences of SEQ ID NOs: 43 to 45; Primers and probes for detecting yellow fever virus comprising a nucleotide sequence of SEQ ID NOs: 46 to 48; Primers and probes for detecting Hantavirus comprising the nucleotide sequences of SEQ ID NOs: 49 to 51; Primers and probes for detecting Brucella, comprising the nucleotide sequence of SEQ ID NOs: 52 to 60; And primers and probes for detecting the Shigella dysenteriae comprising the nucleotide sequence of SEQ ID NO: 61 to 63; It provides a kit for the simultaneous detection of biological agents comprising a primer and probe set for the simultaneous detection of biological agents, consisting of two or more selected from the group consisting of or a combination thereof.

According to one side, the kit further comprises a reverse transcriptase, DNA polymerase and a reaction buffer, the reverse transcription and polymerase chain reaction may be to proceed in one tube at the same time or sequentially.

According to another embodiment of the invention, the step of extracting a nucleic acid from a biological agent; And primers and probes for detecting Bacillus anthracis, including the nucleotide sequences of SEQ ID NOs: 1 to 12, in detecting nucleic acids of biological agents using Real time Polymer Chain Reaction (RT-PCR). ; Primers and probes for detecting cholera bacteria (vibrio cholerae) comprising the nucleotide sequences of SEQ ID NOs: 13 to 21; Primers and probes for detecting typhoid bacteria (Salmonella typhi) comprising the nucleotide sequences of SEQ ID NOs: 22 to 27; Primers and probes for detecting Ysterinia pestis comprising the nucleotide sequences of SEQ ID NOs: 28 to 36; Primers and probes for detecting a bacterium (Francisella tularensis) comprising the nucleotide sequence of SEQ ID NO: 37 to 39; Primers and probes for detecting Rickettsia prowazekii comprising the nucleotide sequences of SEQ ID NOs: 40 to 42; Primers and probes for detecting smallpox virus (Variola virus) comprising the nucleotide sequences of SEQ ID NOs: 43 to 45; Primers and probes for detecting yellow fever virus comprising a nucleotide sequence of SEQ ID NOs: 46 to 48; Primers and probes for detecting Hantavirus comprising the nucleotide sequences of SEQ ID NOs: 49 to 51; Primers and probes for detecting Brucella, comprising the nucleotide sequence of SEQ ID NOs: 52 to 60; And primers and probes for detecting the Shigella dysenteriae comprising the nucleotide sequence of SEQ ID NO: 61 to 63; Performing a real-time polymerase chain reaction using a primer and probe set for the simultaneous detection of biological agents consisting of two or more selected from the group consisting of, or a combination thereof; Including, if the extracted nucleic acid is RNA, Synthesizing template DNA through a reverse transcription reaction, wherein the reverse transcription reaction and the real time polymerase chain reaction proceed simultaneously or sequentially, and the presence of two or more biological agents through the real time polymerase chain reaction, or Provided is a method for simultaneous detection of a biological agent that simultaneously detects absence.

According to one side, the biological agent, Bacillus anthracis, cholera bacteria (vibrio cholerae), typhoid bacteria (Salmonella typhi), yeast bacteria (Yersinia pestis), fungi (Francisella tularensis), rash typus bacteria (Rickettsia prowazekii) , Smallpox virus (Variola virus), yellow fever virus (Yellow fever virus), Hantavirus (Hantavirus), Brucella (Brucella), can be any one or more selected from the group consisting of Shigella dysenteriae.

The primers and probes of the present invention specifically react only with 11 biological agents to efficiently detect the presence or absence of biological agents, so that infections caused by biological weapons can be detected quickly and coped quickly.

However, the effects of the present invention are not limited to the above-described effects, it should be understood to include all the effects deduced from the configuration of the invention described in the detailed description or claims of the present invention.

Figure 1 shows the results of real-time polymerase chain reaction using a primer and probe set specific to 11 pathogens according to an embodiment of the present invention.
Figure 2 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene Pa according to an embodiment of the present invention.
Figure 3 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene LF according to an embodiment of the present invention.
Figure 4 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene PXO2 according to an embodiment of the present invention.
Figure 5 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene Ba813 according to an embodiment of the present invention.
Figure 6 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene Caf1 according to an embodiment of the present invention.
Figure 7 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene Pla in accordance with an embodiment of the present invention.
Figure 8 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene yihN according to an embodiment of the present invention.
Figure 9 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene cxtB according to an embodiment of the present invention.
Figure 10 shows the result of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene O1 according to an embodiment of the present invention.
Figure 11 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene O139 according to an embodiment of the present invention.
Figure 12 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene FopA according to an embodiment of the present invention.
Figure 13 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene ViaB according to an embodiment of the present invention.
Figure 14 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene FliC according to an embodiment of the present invention.
Figure 15 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene 17kDa in accordance with an embodiment of the present invention.
Figure 16 shows the results of statistical analysis of the minimum detection limit of the target gene Ha after performing a real-time polymerase chain reaction according to an embodiment of the present invention.
Figure 17 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene Cap in accordance with an embodiment of the present invention.
Figure 18 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene polyprotein (Polyprotein) according to an embodiment of the present invention.
Figure 19 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene AlkB in accordance with an embodiment of the present invention.
Figure 20 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene IS711 according to an embodiment of the present invention.
Figure 21 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene BR0952 in accordance with an embodiment of the present invention.
Figure 22 shows the results of statistical analysis after performing the real-time polymerase chain reaction the minimum detection limit of the target gene HP according to an embodiment of the present invention.
Figure 23 shows the configuration of a reagent for the simultaneous detection of biological agents according to an embodiment of the present invention.

Hereinafter, exemplary embodiments will be described in detail with reference to the accompanying drawings. However, various changes may be made to the embodiments so that the scope of the patent application is not limited or limited by these embodiments. It is to be understood that all changes, equivalents, and substitutes for the embodiments are included in the scope of rights.

The terminology used herein is for the purpose of description and should not be construed as limiting. Singular expressions include plural expressions unless the context clearly indicates otherwise. In this specification, terms such as "comprise" or "have" are intended to indicate that there is a feature, number, step, action, component, part, or combination thereof described on the specification, and one or more other features. It is to be understood that the present disclosure does not exclude the possibility of the presence or the addition of numbers, steps, operations, components, components, or combinations thereof.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art. Terms such as those defined in the commonly used dictionaries should be construed as having meanings consistent with the meanings in the context of the related art, and shall not be construed in ideal or excessively formal meanings unless expressly defined in this application. Do not.

In addition, in the description with reference to the accompanying drawings, the same components regardless of reference numerals will be given the same reference numerals and duplicate description thereof will be omitted. In the following description of the embodiment, when it is determined that the detailed description of the related known technology may unnecessarily obscure the gist of the embodiment, the detailed description thereof will be omitted.

According to one embodiment of the present invention, in detecting nucleic acid of a biological agent using a real time polymer chain reaction (RT-PCR), anthrax comprising the base sequence of SEQ ID NO: 1 to 12 ( Bacillus anthracis) primers and probes for detection; Primers and probes for detecting cholera bacteria (vibrio cholerae) comprising the nucleotide sequences of SEQ ID NOs: 13 to 21; Primers and probes for detecting typhoid bacteria (Salmonella typhi) comprising the nucleotide sequences of SEQ ID NOs: 22 to 27; Primers and probes for detecting Ysterinia pestis comprising the nucleotide sequences of SEQ ID NOs: 28 to 36; Primers and probes for detecting a bacterium (Francisella tularensis) comprising the nucleotide sequence of SEQ ID NO: 37 to 39; Primers and probes for detecting Rickettsia prowazekii comprising the nucleotide sequences of SEQ ID NOs: 40 to 42; Primers and probes for detecting smallpox virus (Variola virus) comprising the nucleotide sequences of SEQ ID NOs: 43 to 45; Primers and probes for detecting yellow fever virus comprising a nucleotide sequence of SEQ ID NOs: 46 to 48; Primers and probes for detecting Hantavirus comprising the nucleotide sequences of SEQ ID NOs: 49 to 51; Primers and probes for detecting Brucella, comprising the nucleotide sequence of SEQ ID NOs: 52 to 60; And primers and probes for detecting the Shigella dysenteriae comprising the nucleotide sequence of SEQ ID NO: 61 to 63; Provided is a primer and probe set for simultaneous detection of biological agents, consisting of two or more selected from the group consisting of or a combination thereof. At this time, the real-time polymerase chain reaction may be to include a reverse transcription reaction.

In addition, according to another embodiment of the present invention, there is provided a kit for the simultaneous detection of a biological agent comprising a primer and a probe set for the simultaneous detection of the biological agent.

In order to detect 11 pathogens of biological agents, primers and probes specific for 21 genes of 11 pathogens were constructed. Target genotypes of 21 genes were detected, and each target transcription site was selected to identify the genotype, and primers of SEQ ID NOs: 1 to 63 were prepared using the base sequences of the selected sites. The aforementioned 11 pathogens and target genes of each pathogen are shown in Table 1 below.

Pathogen Target genes Anthrax (Bacillus anthracis) Protective antigen (PA) LF (Lethal factor) PXO2 (Capsid protein) Ba813F (Choromosome DNA) Cholera (vibrio cholerae) CtxB O1 O139 Typhoid typhoid (Salmonella typhi) Via b FliC
Yersinia pestis Caf1 Pla yihN (Chromosome DNA) Lactobacillus (Francisella tularensis) Fopa Rhesus typhoid (Rickettsia prowazekii) 17kDa Smallpox virus (Variola virus) HA Yellow fever virus Polyprotein Hantavirus Cap (Capsid Protein)
Brucella AlkB IS711 BR0952 Shigella dysenteriae HP

Of the 11 pathogens of Table 1, 9 species such as anthrax and yellow fever except anthrax are bacteria and DNA viruses, and are used to find stable target sites that can be used for detection in gene structure. Based on the nucleotide sequence published in the Scientific Information Center ( https://www.ncbi.nlm.nih.gov ), a highly homologous region was selected among each pathogen gene sequence, and a primer for detecting the selected region was prepared. .

Of the 11 pathogens in Table 1, two of Hanta and yellow fever are RNA viruses, which are also domestic epidemics and the US National Life Science Information Center to find a stable target site that can be used for detection in the gene structure. https://www.ncbi.nlm.nih.gov ) was selected as the region of high homology among each pathogen gene sequence based on the nucleotide sequence published in the public, and a diagnostic primer for the selected region was prepared. Primers were prepared with mixed nucleotide sequences according to genotype homology.

Primers and probes of the present invention produced by the above method is the same as SEQ ID NO: 1 to 63, each base sequence is shown in Table 2 below. The primers and probes of Table 2 specifically reacted with the target genes of Table 1 as primers and probes, and the respective target gene names were shown in parallel with the primers or probes, so that the corresponding relationships could be identified.

primer
And probe Sequence order
number Pa Forward primer 5 'AACAACTGCACGTATCATTTT 3' One Pa Reverse primer 5 'GGTTTAGTCGTTTCTAATGG 3' 2 Pa probe 5'FAM-TCTGGTAGAAAGGCGGATAGCG-Quencher 3 ' 3 LF Forward primer 5 'GCGTTTGAAATGGAGAATCC 3' 4 LF Reverse primer 5 'TCCTTTATTTCCAGACCGATG 3' 5 LF Probe 5'JOE-ATCACCAGATACTCGAGCAGGAT-Quencher 3 ' 6 PXO2 Forward primer 5 'GGATGGACAAGAACAAAAGA 3' 7 PXO2 Reverse primer 5 'ACTGGTAACTGGTTTTGGTG 3' 8 PXO2 Probe 5'FAM-TGCACTTGTGCAATATCATTTACGTG-Quencher 3 ' 9 Ba813 forward primer 5 'TAGCGAAGATCCAGTGCCGA 3' 10 Ba813 reverse primer 5 'CTGTGTTTGCTGTATTCCCTCCA 3' 11 Ba813 Probe 5'CY5-CCCAGGGGGACAAACGATAGCTCC-Quencher 3 ' 12 CtxB Forward primer 5 'TGGAAAAAGAGAGATGGCTA 3' 13 CtxB Reverse primer 5 'TATGCAATCCTCAGGGTATC 3' 14 CtxB Probe 5'FAM-TTTTAAGAATGGTGCAACTTTTCAAGTAG-Quencher 3 ' 15 O1 Forward primer 5 'AGGAAGCAAAAATGGCTGGC 3' 16 O1 Reverse primer 5 'GTCGATAAGGGTCAAGCTCC 3' 17 O1 Probe 5'FAM-CGCGCAAAAGCTGGTCGAGTACGC-Quencher 3 ' 18 O139 Forward primer 5 'GGATTTTAATGAAGCGAGTG 3' 19 O139 Reverse primer 5 'AATCGCTAGAGCATCTTCTG 3' 20 O139 Probe 5'CY5-CGTTGCAAAACACTTAGGAACGG-Quencher3 ' 21 ViaB Forward primer 5 'TGGAAGAGCTTCAGGATAG 3' 22 ViaB Reverse primer 5 'GTAACTGAATCCGGCAATA 3' 23 ViaB Probe 5'FAM-TACGTGAGCCGCGCTATCTG-Quencher 3 ' 24 FliC Forward primer 5 'GAAACTGCTGTAACCGTTG 3' 25 FliC Reverse primer 5 'TTGATATCAGCCCCAGTAAC 3' 26 FliC Probe 5'CY5-CAAACTGCAATTGGCGGTGGT-Quencher 3 ' 27 Caf1 Forward primer 5 'GTTGGTACGCTTACTCTTG 3' 28 Caf1 Reverse primer 5 'GTGGTTATTTCCATCCTGAG 3' 29 Caf1 Probe 5'FAM-AAAACAGGAACCACTAGCACATCTG-Quencher 3 ' 30 Pla Forward primer 5 'CTGGTTACTCCAGGATGAGA 3' 31 Pla Reverse primer 5 'TTCCGGTATAAGCTCCATTA 3' 32 Pla probe 5'JOE-TTGGACAGCTACAGGTGGTTCATAT-Quencher 3 ' 33 yihN Forward primer 5 'GCTTTACCTTCACCAAACTG 3' 34 yihN Reverse primer 5 'GAACCAAAGAAGAACAAGGA 3' 35 yihN Probe 5'JOE-ATAAGTACATCAATCACACCGCGAC-Quencher 3 ' 36 FopA Forward primer 5 'GGGTCCTCAAGATAGAACT 3' 37 FopA Reverse primer 5 'ACCGATTGTGAAGTTAGCA 3' 38 FopA Probe 5'FAM-TGCTAACGGTCTAGCTGGAACTCC-Quencher 3 ' 39 17kDa Forward primer 5 'CTCTTGCAGCTTCTATGTT 3' 40 17kDa Reverse primer 5 'CCGAATTGAGAACCAAGTAA 3' 41 17kDa Probe 5'FAM-TACACTTCTTGGTGGCGCAGGAG-Quencher 3 ' 42 Ha Forward primer 5 'CGATGATCTAGTTACAACTATTAC 3' 43 Ha Reverse primer 5 'CAACTCTGTAGAGTATTCTTCAT 3' 44 Ha probe 5'FAM-GCCGGTACTTATGTATGTGCATTCTTTA-Quencher 3 ' 45 Poly Forward primer 5 'AAAGCTCAGGGAAAAACC 3' 46 Poly Reverse primer 5 'TCTTGAAGGTCCAGGTCT 3' 47 Poly probe 5'JOE-CGACGAGGAGTTCGCTCCTTGTCAA-Quencher 3 ' 48 Cap Forward primer 5 'GTACATTTATGGGTGGGAAT 3' 49 Cap Reverse primer 5 'GATCAAATGAAATCTACATC 3' 50 Cap probe 5'JOE-AGGGTGGGTCAGTTAATCCGTTGTG-Quencher 3 ' 51 AlkB Forward primer 5 'GCGGCTTTTCTATCACGGTATTC 3' 52 AlkB Reverse primer 5 'TTCGGAAGGTCAGATTAAGCC 3' 53 AlkB Probe 5'FAM-CCATTGAAGTCTGGCGAGCATGAGCGG-Quencher 3 ' 54 IS711 Forward primer 5 'GTTGAATGCAGACACGCCCT 3' 55 IS711 Reverse primer 5 'CTGTTGCAAGTATGGCAGCG 3' 56 IS711 Probe 5'CY5-ACAGTGCTTCGTCACGCTAGAGCGC-Quencher 3 ' 57 BR0952 Forward primer 5 'TGATAAGCGGCCGTGTTGAG 3' 58 BR0952 Reverse primer 5 'TCCGTTTCTGGAAAGCGTCG 3' 59 BR0952 Probe 5'FAM-GGCGCAATTCCACGCATCGCGG-Quencher 3 ' 60 HP Forward primer 5 'CGCTTTGCATCACTAACATA 3' 61 HP Reverse primer 5 'AACAATTGAATACGGAGAGC 3' 62 HP Probe 5'FAM-CCCTTGCCCTTCTAATATTCCCC-Quencher 3 ' 63

In addition, primers and probes produced for each pathogen may be used in a kit for simultaneously detecting biological agents as a set of primers and probes in which two or more kinds are combined to simultaneously detect two or more pathogens. Simultaneous detection for biological agent kit comprising a may be produced using a vacuum drying method. Specifically, it is preferable to use a method of drying using a vacuum drying method, but is not limited thereto.

In addition, the kit for the simultaneous detection of biological agents of the present invention includes a reverse transcriptase, DNA polymerase and a reaction buffer, and the reverse transcriptase and polymerase chain reaction may be performed in one tube at the same time or sequentially.

According to another embodiment of the invention, the step of extracting a nucleic acid from a biological agent; And primers and probes for detecting Bacillus anthracis, including the nucleotide sequences of SEQ ID NOs: 1 to 12, in detecting nucleic acids of biological agents using Real time Polymer Chain Reaction (RT-PCR). ; Primers and probes for detecting cholera bacteria (vibrio cholerae) comprising the nucleotide sequences of SEQ ID NOs: 13 to 21; Primers and probes for detecting typhoid bacteria (Salmonella typhi) comprising the nucleotide sequences of SEQ ID NOs: 22 to 27; Primers and probes for detecting Ysterinia pestis comprising the nucleotide sequences of SEQ ID NOs: 28 to 36; Primers and probes for detecting a bacterium (Francisella tularensis) comprising the nucleotide sequence of SEQ ID NO: 37 to 39; Primers and probes for detecting Rickettsia prowazekii comprising the nucleotide sequences of SEQ ID NOs: 40 to 42; Primers and probes for detecting smallpox virus (Variola virus) comprising the nucleotide sequences of SEQ ID NOs: 43 to 45; Primers and probes for detecting yellow fever virus comprising a nucleotide sequence of SEQ ID NOs: 46 to 48; Primers and probes for detecting Hantavirus comprising the nucleotide sequences of SEQ ID NOs: 49 to 51; Primers and probes for detecting Brucella, comprising the nucleotide sequence of SEQ ID NOs: 52 to 60; And primers and probes for detecting the Shigella dysenteriae comprising the nucleotide sequence of SEQ ID NO: 61 to 63; Performing a real-time polymerase chain reaction using a primer and probe set for the simultaneous detection of biological agents consisting of two or more selected from the group consisting of or a combination thereof; Including, but if the extracted nucleic acid is RNA, further comprising the step of synthesizing the template DNA through a reverse transcription reaction, the reverse transcription and the real-time polymerase chain reaction proceeds simultaneously or sequentially, the real-time polymerase chain A method for simultaneously detecting a biological agent is provided, wherein the reaction simultaneously detects the presence or absence of two or more of the biological agents. At this time, the biological agents detected are Bacillus anthracis, Vibrio cholerae, Salmonella typhi, Yersinia pestis, Frantisella tularensis, Rickettsia prowazekii, Smallpox At least one of the pathogens of Table 1 selected from the group consisting of a virus (Variola virus), yellow fever virus (Yellow fever virus), Hantavirus (Hantavirus), Brucella (Brucella), Shigella dysenteriae. In this case, when a fluorescent probe having a unique wavelength value is used, it can also be detected using a method of measuring the amount of fluorescence change before and after the reaction. For example, when the fluorescence value is measured and recorded before the reaction, and the fluorescence value is measured and compared again after the reaction is completed, when the target exists in the sample, the fluorescence value appears to increase as compared to before the reaction. On the other hand, if the target is not present in the sample, the presence of a biological agent can be detected by indicating that the fluorescence value is the same as the value before the reaction.

However, the above-described detection method of the biological agent is only for understanding one embodiment of the present invention, and the type of probe and the detection method of the biological agent are not limited to the above description.

Hereinafter, the present invention will be described in more detail with reference to Examples. The following examples are described for the purpose of illustrating the present invention, but the scope of the present invention is not limited thereto.

Example

1. Real-Time PCR

1 μl of internal positive control (IPC) and 19 μl of sterile distilled DEPC (Diethyl pyrocarbonate) in a PCR tube containing a primer and probe set prepared by the above method, a composition for reverse transcription and a composition for PCR reaction 5 μl of RNA extracted from 11 pathogens was added, mixed, and centrifuged. At this time, IPC was used as a control of the amplification reaction appearing in each tube, the amplification reaction was carried out using a commercially available PCR instrument (Thermo Scientific's ABI 7500 Fast Real Time PCR System).

Under the above conditions, reverse transcription and real-time polymerase chain reaction were performed in one tube (one-step PCR). Reverse transcription was carried out at 45 ° C. for 30 minutes, and then the primary PCR reaction was performed at 95 ° C. for 5 minutes to denature the template DNA to single-stranded DNA. Thereafter, the process of amplifying the target gene was performed by repeating the process of maintaining 45 seconds for 15 seconds at 55 ° C and 30 seconds at 55 ° C.

2. Verification of specificity of primers for simultaneous detection of biological agents

The cross-reaction was confirmed to confirm that the primer and probe sets of the present invention exhibit specificity for the target gene to be detected. Cross-reaction was carried out by selecting a field infection pathogen that is expected to affect the detection reliability when detecting 11 biological agents of the present invention. The test was repeated three times on each of the nucleic acids of nine selected pathogenic pathogenic bacteria, and the types of pathogenic bacteria used in the experiment and the results of cross-reaction with them are shown in Table 3 below. In Table 3, the source refers to the catalog number of the ATCC, and the target gene represents the 21 genes of Table 1. In addition, IPC was used for analysis as a control to compare with the result of a target gene. Referring to the results of Table 3, the nucleic acids of the nine outdoor infectious pathogenic bacteria were all positive for IPC, but all were negative for the 21 genes of the present invention. Therefore, it was confirmed that there was no cross-reactivity between the 21 genes corresponding to the nucleotide sequences of the primers and probes of the present invention and the nine kinds of outdoor pathogenic pathogenic bacteria used in the test.

Figure 1 graphically shows the results of using the primer set for the simultaneous detection of the biological agent of the present invention to detect nine bacteria shown in Table 3. Referring to Figure 1, as shown in Table 3, it was shown that the target gene was not detected for nine bacteria except the internal positive control (IPC). That is, it was confirmed that the primer set of the present invention has high specificity in detecting 11 biological agents.

Serial number Outdoor infectious disease pathogenic bacteria sauce Analysis Target genes IPC One Anaplasma VR-1437 - + 2 Leptospira interrogans 23581 - + 3 Leptospira borgpetersenii 23481 - + 4 Leptospira santarosai 23477 - + 5 Leptospira noguchii 43288 - + 6 Leptospira kirschneri 23469 - + 7 Leptospira weilii 700521 - + 8 Leptospira genomospecies 43285 - + 9 Leptospira interrograns serovar copenhageni BAA-1198D-5 - +

3. Minimum detection limit of gene detection method for 11 biological agents

The limit of detection (LoD) was conducted with reference to the relevant guidelines (CLSI EP-17A: Protocols for Determination of Limits of Detection and Limits of Quantitation; Approved Guidelin). The target genes of each genome were prepared to have 9 concentrations of Copies / test diluted from 1000 to 2 times (3.90625), and were repeated 24 times for each concentration. The measured result was statistically analyzed through probit analysis, and the minimum concentration detectable for 95% or more was set to LoD. 2 to 22 are graphs showing the results of statistically analyzing the minimum detection limit for each dielectric target. At this time, the portions shown in dashed lines in each of the drawings of FIGS. 2 to 22 represent minimum concentrations that can be detected by 95% or more, and the portions shown by solid lines in each of the drawings mean respective minimum detection limits. At this time, the minimum detection limit for each genome was converted into the copy number (Copies / test) and shown in Table 4 below.

Serial number target gene Copy Count (Copies / test) One Anthrax
(Bacillus anthracis) PA 10.94 2 LF 8.51 3 PXO2 37.15 4 Ba813 60.25 5 Pest
(Yersinia pestis) Caf1 19.05 6 Pla 18.2 7 yihN 43.65 8 Cholera
(vibrio cholerae) ctxB 36.3 9 O1 64.65 10 O139 25.7 11 Yato germs
(Francisella tularensis) Fopa 7.08 12 Typhoid bacteria
(Salmonella typhi) ViaB 26.3 13 FliC 9.77 14 Rash typhoid
(Rickettsia prowazekii) 17kDa 46.77 15 Smallpox virus (Variola virus) Ha 7.41 16 Hantavirus Capsid protein 18.62 17 Yellow fever virus Polyprotein 46.77 18 Brucella
(Brucella) AlkB 41.69 19 IS711 32.36 20 BR0952 35.48 21 Dysentery
(Shigella dysenteriae) HP 43.65

4. Reagent Material Composition Design

The detection reagent used in the biological agent kit for simultaneous detection of the present invention was designed to be capable of multi-detection, in order to minimize the number of tubes used by designing a plate mixed with each target material. Verification reagents were designed to detect 11 pathogens simultaneously in a single reaction. At this time, the process of optimizing the reagent was the same as the reaction conditions of Example 1, Figure 23 shows the configuration of the detection reagent according to an embodiment configured in this design.

The detection reagent of Figure 23 consists of a total of 15 tubes to detect 11 kinds of pathogens, each tube can detect up to three genomes including the internal positive control (IPC) Configured. In addition, in order to distinguish between pathogens between different tubes, different tubes were used for each pathogen, and the numbers were assigned. In this case, anthrax, pest, cholera, and brucellella, which have at least two target genes, were detected using two tubes, and the remaining seven pathogens were combined with one tube for each pathogen. A set of detection reagents consisting of one set was prepared. Referring to FIG. 23, in the table shown upwards, target genes and detectable pathogens corresponding to number of tubes are shown correspondingly, and below, diagrams showing 1 to 15 tubes consisting of one set are shown. have.

Using the detection reagent set of FIG. 23 prepared in this manner, up to 11 biological agents can be detected simultaneously, and when detecting in a 96 well plate, up to 6 reagents in one plate The set can be placed, so that it is possible to simultaneously check whether six biological agents are infected. At this time, the configuration of the reagent may be different depending on the type of pathogen to be detected and the detection situation, but for the simultaneous detection of the biological agent, it is preferable that one reagent set is composed of at least two tubes. In order to implement the effect, it is more preferable that it is configured as shown in FIG.

Although the embodiments have been described with reference to the accompanying drawings, those skilled in the art may apply various technical modifications and variations based on the above. For example, the techniques described may be performed in a different order than the described method, and / or the components described may be combined or combined in a different form than the described method, or replaced or substituted by other components or equivalents. Appropriate results can be achieved.

Therefore, other implementations, other embodiments, and equivalents to the claims are within the scope of the following claims.

<110> Agency for Defense Development <120> A primer and a probe for detecting biological agents, a kit          comprising the same, and a detection method using the same <130> APC-2018-0258 <160> 63 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Pa Forward primer <400> 1 aacaactgca cgtatcattt t 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Pa reverse primer <400> 2 ggtttagtcg tttctaatgg 20 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Pa probe <400> 3 tctggtagaa aggcggatag cg 22 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> LF forward primer <400> 4 gcgtttgaaa tggagaatcc 20 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> LF reverse primer <400> 5 tcctttattt ccagaccgat g 21 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> 223 LF probe <400> 6 atcaccagat actcgagcag gat 23 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PXO2 Forward primer <400> 7 ggatggacaa gaacaaaaga 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> PXO2 reverse primer <400> 8 actggtaact ggttttggtg 20 <210> 9 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> PXO2 probe <400> 9 tgcacttgtg caatatcatt tacgtg 26 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Ba813 forward primer <400> 10 tagcgaagat ccagtgccga 20 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Ba813 reverse primer <400> 11 ctgtgtttgc tgtattccct cca 23 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Ba813 probe <400> 12 cccaggggga caaacgatag ctcc 24 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CtxB forward primer <400> 13 tggaaaaaga gagatggcta 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> CtxB reverse primer <400> 14 tatgcaatcc tcagggtatc 20 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> CtxB probe <400> 15 ttttaagaat ggtgcaactt ttcaagtag 29 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> O1 forward primer <400> 16 aggaagcaaa aatggctggc 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> O1 reverse primer <400> 17 gtcgataagg gtcaagctcc 20 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> O1 probe <400> 18 cgcgcaaaag ctggtcgagt acgc 24 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> O139 forward primer <400> 19 ggattttaat gaagcgagtg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> O139 reverse primer <400> 20 aatcgctaga gcatcttctg 20 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> O139 probe <400> 21 cgttgcaaaa cacttaggaa cgg 23 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ViaB forward primer <400> 22 tggaagagct tcaggatag 19 <210> 23 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> ViaB reverse primer <400> 23 gtaactgaat ccggcaata 19 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> ViaB probe <400> 24 tacgtgagcc gcgctatctg 20 <210> 25 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> FliC forward primer <400> 25 gaaactgctg taaccgttg 19 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FliC reverse primer <400> 26 ttgatatcag ccccagtaac 20 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> FliC probe <400> 27 caaactgcaa ttggcggtgg t 21 <210> 28 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Caf1 forward primer <400> 28 gttggtacgc ttactcttg 19 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Caf1 reverse primer <400> 29 gtggttattt ccatcctgag 20 <210> 30 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Caf1 probe <400> 30 aaaacaggaa ccactagcac atctg 25 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Pla forward primer <400> 31 ctggttactc caggatgaga 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Pla reverse primer <400> 32 ttccggtata agctccatta 20 <210> 33 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Pla probe <400> 33 ttggacagct acaggtggtt catat 25 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> yihN forward primer <400> 34 gctttacctt caccaaactg 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> yihN reverse primer <400> 35 gaaccaaaga agaacaagga 20 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> yihN probe <400> 36 ataagtacat caatcacacc gcgac 25 <210> 37 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> FopA forward primer <400> 37 gggtcctcaa gatagaact 19 <210> 38 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> FopA reverse primer <400> 38 accgattgtg aagttagca 19 <210> 39 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> FopA probe <400> 39 tgctaacggt ctagctggaa ctcc 24 <210> 40 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 17 kDa forward primer <400> 40 ctcttgcagc ttctatgtt 19 <210> 41 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 17 kDa reverse primer <400> 41 ccgaattgag aaccaagtaa 20 <210> 42 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> 17 kDa probe <400> 42 tacacttctt ggtggcgcag gag 23 <210> 43 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HA forward primer <400> 43 cgatgatcta gttacaacta ttac 24 <210> 44 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HA reverse primer <400> 44 caactctgta gagtattctt cat 23 <210> 45 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> HA probe <400> 45 gccggtactt atgtatgtgc attcttta 28 <210> 46 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Poly forward primer <400> 46 aaagctcagg gaaaaacc 18 <210> 47 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Poly reverse primer <400> 47 tcttgaaggt ccaggtct 18 <210> 48 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Poly probe <400> 48 cgacgaggag ttcgctcctt gtcaa 25 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cap forward primer <400> 49 gtacatttat gggtgggaat 20 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Cap reverse primer <400> 50 gatcaaatga aatctacatc 20 <210> 51 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Cap probe <400> 51 agggtgggtc agttaatccg ttgtg 25 <210> 52 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> AlkB forward primer <400> 52 gcggcttttc tatcacggta ttc 23 <210> 53 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> AlkB reverse primer <400> 53 ttcggaaggt cagattaagc c 21 <210> 54 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> AlkB probe <400> 54 ccattgaagt ctggcgagca tgagcgg 27 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IS711 forward primer <400> 55 gttgaatgca gacacgccct 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> IS711 reverse primer <400> 56 ctgttgcaag tatggcagcg 20 <210> 57 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IS711 probe <400> 57 acagtgcttc gtcacgctag agcgc 25 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BR0952 forward primer <400> 58 tgataagcgg ccgtgttgag 20 <210> 59 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BR0952 reverse primer <400> 59 tccgtttctg gaaagcgtcg 20 <210> 60 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BR0952 probe <400> 60 ggcgcaattc cacgcatcgc gg 22 <210> 61 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HP forward primer <400> 61 cgctttgcat cactaacata 20 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HP reverse primer <400> 62 aacaattgaa tacggagagc 20 <210> 63 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> HP probe <400> 63 cccttgccct tctaatattc ccc 23

Claims (15)

In detecting nucleic acid of a biological agent by using real time polymer chain reaction (RT-PCR),
Primers and probes for detecting Bacillus anthracis comprising the nucleotide sequences of SEQ ID NOs: 1 to 12; Primers and probes for detecting cholera bacteria (vibrio cholerae) comprising the nucleotide sequences of SEQ ID NOs: 13 to 21; Primers and probes for detecting typhoid bacteria (Salmonella typhi) comprising the nucleotide sequences of SEQ ID NOs: 22 to 27; Primers and probes for detecting Ysterinia pestis comprising the nucleotide sequences of SEQ ID NOs: 28 to 36; Primers and probes for detecting a bacterium (Francisella tularensis) comprising the nucleotide sequence of SEQ ID NO: 37 to 39; Primers and probes for detecting Rickettsia prowazekii comprising the nucleotide sequences of SEQ ID NOs: 40 to 42; Primers and probes for detecting smallpox virus (Variola virus) comprising the nucleotide sequences of SEQ ID NOs: 43 to 45; Primers and probes for detecting yellow fever virus comprising a nucleotide sequence of SEQ ID NOs: 46 to 48; Primers and probes for detecting Hantavirus comprising the nucleotide sequences of SEQ ID NOs: 49 to 51; Primers and probes for detecting Brucella, comprising the nucleotide sequence of SEQ ID NOs: 52 to 60; And primers and probe sets for detecting biological agents simultaneously, comprising primers and probes for detecting Shigella dysenteriae comprising the nucleotide sequences of SEQ ID NOs: 61 to 63;
Reverse transcriptase;
DNA polymerase; And
Reaction buffer solution;
Including,
The reverse transcription reaction and the polymerase chain reaction is carried out in one tube at the same time or sequentially, the biological agent kit for simultaneous detection. The method of claim 1,
The primers and probes for detecting anthrax (Bacillus anthracis) are specific to target genes PA, LF, PXO2 and Ba813F, kits for the simultaneous detection of biological agents. The method of claim 1,
The primers and probes for detecting cholera bacteria (vibrio cholerae) are specific to the target genes CtxB, O1 and O139, kits for the simultaneous detection of biological agents.
The method of claim 1,
The primers and probes for detecting Salmonella typhi are specific for target genes ViaB and FliC, the kit for simultaneous detection of biological agents. The method of claim 1,
The primer and probe for detecting the pest (Yersinia pestis) is specific to the target genes Caf1, Pla and yihN, kit for the simultaneous detection of biological agents. The method of claim 1,
The primers and probes for detecting the yakto bacillus (Francisella tularensis) are specific to the target gene FopA, the kit for simultaneous detection of biological agents. The method of claim 1,
The primers and probes for detecting the R. tychetis (Rickettsia prowazekii) are specific to the target gene 17kDa, kits for the simultaneous detection of biological agents. The method of claim 1,
The primer and probe for detecting the smallpox virus (Variola virus), which is specific to the target gene HA, kit for the simultaneous detection of biological agents. The method of claim 1,
The yellow fever virus detection primers and probes are specific to the target gene Polyprotein,
The primer and probe for detecting Hantavirus is specific to the target gene Cap,
Kit for simultaneous detection of biological agents. The method of claim 1,
The Brucella detection primers and probes are specific to target genes AlkB, IS711 and BR0952, kits for the simultaneous detection of biological agents. The method of claim 1,
The primers and probes for detecting Shigella dysenteriae are specific to the target gene HP, the kit for simultaneous detection of biological agents. delete delete Extracting the nucleic acid from the biological agent; And
Performing a real-time polymerase chain reaction using the primer and probe set of claim 1;
Including,
If the extracted nucleic acid is RNA, further comprising the step of synthesizing the template DNA through a reverse transcription reaction,
The reverse transcription reaction and the real time polymerase chain reaction proceed simultaneously or sequentially,
Simultaneously detecting the presence or absence of two or more biological agents through the real-time polymerase chain reaction,
Simultaneous detection of biological agents using the biological agent simultaneous detection kit of claim 1. The method of claim 14,
The biological agents include Bacillus anthracis, Vibrio cholerae, Salmonella typhi, Yersinia pestis, Francisella tularensis, Rickettsia prowazekii, Smallpox virus (Variola) virus, Yellow fever virus, Hantavirus, Brucella, Shigella dysenteriae, at least one selected from the group consisting of
Simultaneous detection of biological agents using the biological agent simultaneous detection kit of claim 1.

Images