KR102039624B1 - A method of screening materials for inhibition of interaction between BAG2 and Cathepsin B - Google Patents

Abstract

The present invention includes contacting a test substance with a sample comprising a BAG2 polypeptide or a fragment thereof and a pro-cathepsin B polypeptide or a fragment thereof; Measuring the level of binding between said BAG2 and pro-cathepsin B polypeptide or fragment thereof; And selecting a sample which inhibits the binding between BAG2 and pro-cathepsin B, comprising screening a sample having a reduced degree of binding compared to a control sample, and binding of BAG2 and pro-cathepsin B for the method. The present invention relates to compositions and kits for screening inhibitory substances.

Description

A method of screening materials for inhibition of interaction between BAG2 and Cathepsin B}

A method for screening an antitumor agent that inhibits binding of BAG2 and pro-cathepsin B by contacting a test substance with a sample comprising a polypeptide of BAG2 protein or a fragment thereof and a polypeptide or fragment of pro-cathepsin B protein. .

The co-chaperone Bcl-2-associated athanogene (BAG) protein family mediates various physiological processes, including intracellular protein folding, stress response, neuronal differentiation, cell death, and cell proliferation and functionally binds to various cooperative proteins. (Takayama and Reed., 2001; Doong et al., 2002). BAG2, one of the members of the BAG domain family with anti-cell killing activity, is known as a negative regulator of the C-terminus of Hsc70-interacting protein (CHAP), a chaperone-related ubiquitin ligase (Arndt et al., 2005; Dai et al., 2005). The main role of BAG2 in the regulation of proteins through inhibition of CHIP activity is associated with neurodegenerative diseases and autosomal recessive disorders through the stabilization of chaperone-related proteins such as PINK1 and CFTR (Qu et al., 2015; Arndt et al. , 2005). However, the role of BAG2 in cancer is not well known, and its role in regulating tumor development is controversial. Among them, the expression of BAG2 increases proteasome inhibitor-induced apoptosis, and BAG2 knockdown partially inhibits cell death when thyroid carcinoma cells are exposed to proteasome inhibitor MG132, It has been suggested that BAG2 may have pro-apoptotic activity (Wang et al., 2008). On the other hand, in various mutant K-Ras-induced tumors, it has been suggested that overexpression of BAG2 may promote stabilization of STK33 protein, a potent tumor gene, to promote tumor development (Azoitei et al., 2012). However, despite these findings, the role of BAG2 in cancer progression and metastasis, particularly in breast cancer, has not been intensively studied and elucidated.

Cathepsin B (CTSB) is a lysomal cysteine protease with intrinsic and exogenous peptidase activity and is thought to play a protein circulating role (Mort and Buttle, 1997). CTSB is synthesized as an inactive / maturated pro-form enzyme (41/43 kDa), and is capable of active short-chain form (31 kDa) or duplex through proteolysis of N-terminal 62 amino acid pro-peptides. Chain form (heavy chain, 25/26 kDa; light chain, 5 kDa). Ideal expression / activity of CTSB has often been linked to malignant tumors (Joyce et al., 2004; Withans, 2012). However, mature CTSBs are generally recognized to exhibit the fragrant-apoptotic role of cytoplasmic CTSB by locating in lysosomes and functioning in protein circulation as inhibitor proteases during lysosomal-mediated autophagy / apoptosis (Stoka et al. , 2001; Foghsgaard et al., 2001; Bhoopathi et al., 2010). However, the modulator of this dual function of CTSB in cancer progression is not clear.

The inventors have found that BAG2 binds to CTSB and converts from its pre-form of CTSB to mature CTSB form and consequently regulates the dual function of CTSB.

One aspect includes contacting a subject with a sample comprising a BAG2 polypeptide or fragment thereof, and a pro-cathepsin B polypeptide or fragment thereof; Measuring the level of binding between said BAG2 and pro-cathepsin B polypeptide or fragment thereof; And selecting a sample having a reduced degree of binding compared to a control sample, and provides a method for screening a substance that inhibits binding between BAG2 and pro-cathepsin B.

Another aspect includes an antibody, polypeptide, or combination thereof that specifically binds a BAG2 polypeptide or fragment thereof; an antibody, polypeptide, or combination thereof that specifically binds to a pro-cathepsin B polypeptide or fragment thereof; Or a composition for screening a substance that inhibits the binding of BAG2 and pro-cathepsin B comprising a combination thereof.

Another aspect includes an antibody, polypeptide, or combination thereof that specifically binds a BAG2 polypeptide or fragment thereof; an antibody, polypeptide, or combination thereof that specifically binds to a pro-cathepsin B polypeptide or fragment thereof; Or a kit for screening a substance that inhibits the binding of BAG2 and pro-cathepsin B comprising a combination thereof.

One aspect includes contacting a subject with a sample comprising a BAG2 polypeptide or fragment thereof, and a pro-cathepsin B polypeptide or fragment thereof; Measuring the level of binding between said BAG2 polypeptide or fragment thereof and pro-cathepsin B polypeptide or fragment thereof; And it provides a method for screening a substance that inhibits the binding between BAG2 and pro-cathepsin B comprising the step of selecting a sample in which the degree of binding is reduced compared to the control sample.

According to the embodiment of the present invention, it was confirmed that the BAG2 protein binds to the pro-cathepsin B protein and inhibits the conversion to the mature form of the cathepsin B protein, which affects the regulation of apoptosis of tumor cells, and thus, BAG2 and pro-cathepsin Substances that inhibit binding between B may promote cell death and become candidates for use as anticancer agents.

Pro-cathepsin B herein may be used in the same sense as immature cathepsin B or immature CTSB. If there is no separate formula for the form of cathepsin B, it may be used in the same sense as pro-cathepsin B. In the present specification, the 'polypeptide' is used interchangeably with the 'protein'.

The control sample may refer to a sample which is not contacted with a test substance, and a sample which is contacted with a solvent used to dissolve the test substance. The control sample is known to be available as an anticancer agent, known to promote cell death in an existing anticancer agent, or similar screening in the art for the purpose of screening a substance having an effect superior to conventional anticancer agents. It may mean a sample in contact with all materials known to be used as a control in the method.

The BAG2 and pro-cathepsin B may be proteins derived from human ( Homo sapiens ) or mouse ( Mus musculus ), respectively, or the same protein may be expressed in other mammals such as monkeys, cows, and horses. The polynucleotide sequence encoding the BAG2 is GenBank Accession No. NM_004282.3 and NM_145392.2, respectively, may include SEQ ID NO: 1 or 2, which is a part expressed by BAG2, and the polynucleotide sequence encoding the pro-cathepsin B is GenBank Accession No. SEQ ID NO: 3, which is the part of NM_001908.4, NM_147780.3, NM_147781.3, NM_147782.3, and NM_147783.3 expressed as cathepsin B, or GenBank Accession No. It may include the SEQ ID NO: 4 which is a part expressed by cathepsin B of NM_007798.3. The BAG2 protein may have an amino acid sequence including SEQ ID NO: 5 or 6. The pro-cathepsin B protein may have an amino acid sequence including SEQ ID NO: 7 or 8. The mRNAs of SEQ ID NOs: 1 to 4 may be translated into polypeptides of SEQ ID NOs: 5 to 8, respectively, but the polynucleotide sequences of the mRNAs of SEQ ID NOs: 1 to 4 and the amino acid sequences of SEQ ID NOs: 5 to 8 partially correspond to each other. If not, a polynucleotide sequence or amino acid sequence that has biologically equivalent activity can be considered a polynucleotide or mRNA encoding BAG2 or pro-cathepsin B, or a BAG2 or pro-cathepsin B polypeptide.

The polynucleotide encoding the BAG2 or pro-cathepsin B is at least 60%, for example at least 70%, at least 80%, at least 90%, any one of SEQ ID NO: 1 or 2, and SEQ ID NO: 3 or 4, respectively, It may have a base sequence having at least 95%, at least 99%, or 100% sequence identity. The polynucleotide encoding the BAG2 or pro-cathepsin B is one or more bases, two or more bases, three or more bases, four or more bases in any one of SEQ ID NO: 1 or 2, and SEQ ID NO: 3 or 4, respectively The at least base, at least 5 bases, at least 6 bases or at least 7 bases may be polynucleotides having different sequences.

The BAG2 or pro-cathepsin B polypeptide is at least 60%, for example at least 70%, at least 80%, at least 90%, at least 95%, any one of SEQ ID NO: 5 or 6, and SEQ ID NO: 7 or 8, respectively, It may comprise an amino acid sequence having at least 99%, or 100% sequence identity. In addition, the BAG2 or pro-cathepsin B polypeptide is at least one amino acid, at least two amino acids, at least three amino acids, at least four amino acids in the sequence of any one of SEQ ID NO: 5 or 6, and SEQ ID NO: 7 or 8, respectively, Five or more amino acids, six or more amino acids, or seven or more amino acid residues may be polypeptides having different sequences.

In one embodiment, the screening method may include selecting a complex formed by the BAG2 polypeptide or a fragment thereof and the pro-cathepsin B polypeptide or a fragment thereof in the sample to which the test substance is added. Detection of such complexes can be carried out appropriately using techniques known to those skilled in the art.

In one embodiment, the sample may be a cell culture, and the BAG2 and pro-cathepsin B polypeptides or fragments thereof may be present in cells in the sample. The cell may refer to a cell constituting the tissue of the individual, or may mean a cell separated from the individual. The cells may also be normal cells, but in other embodiments may be tumor cells or cancer cells. Thus, the term 'contacting' means that a specific substance is bound to the cell membrane or cell wall or injected into the cell, and the contacting step is, for example, added to the medium containing the cell, or It may be injected directly into the tissue containing the cells or, if applied to the subject, it may be injected into the blood to reach the desired cells.

In one embodiment, the BAG2 and pro-cathepsin B polypeptides or fragments thereof present in the cells may be endogenous, exogenous or a combination thereof.

In one embodiment, the exogenous BAG2 and pro-cathepsin B polypeptides or fragments thereof are expressed from a polynucleotide encoding the polypeptide or fragment thereof introduced into a cell, wherein the poly encoding the exogenous BAG2 polypeptide or fragment thereof The nucleotides may consist of a polynucleotide sequence comprising or part of SEQ ID NO: 1 or 2, wherein the polynucleotide encoding the pro-cathepsin B polypeptide or fragment thereof is a polynucleotide sequence comprising or part of SEQ ID NO: 3 or 4 It may be made. To express the exogenous BAG2 and pro-cathepsin B polypeptides or fragments thereof in cells, methods known in the art can be used and can be stably or transiently expressed in cells.

In one embodiment, the BAG2 and pro-cathepsin B polypeptide or fragment thereof may be present outside the cell. The BAG2 and pro-cathepsin B polypeptides or fragments thereof that exist outside the cells may be cells or E. coli It may be isolated from the lysate after overexpression in the interior, chemical synthesis of solid or liquid phase, or synthesized using a polymer peptide autosynthesizer, but is not limited thereto.

In one embodiment, the fragment of the pro-cathepsin B polypeptide may include an amino acid sequence of 1 to 80th from the N-terminus of SEQ ID NO: 7 or 8.

According to an embodiment of the present invention, it was confirmed that the BAG2 protein binds to the 1 to 80 th propeptide region from the N-terminus of the pro-cathepsin B protein and inhibits activation as a mature cathepsin B. Thus, the pro-cathepsin B protein Among them, a substance which inhibits the binding of the BAG2 protein to the propeptide region may be a candidate substance which can be used as an anticancer agent.

In one embodiment, the agent that inhibits the binding of the BAG2 and pro-cathepsin B may be an anticancer agent.

In one embodiment, the cancer of the anticancer agent may be selected from the group consisting of breast cancer, colon cancer, lung cancer, sarcoma, melanoma, head and neck cancer, cervical cancer, uterine cancer, liver cancer, kidney cancer, pancreatic cancer, and neuroblastoma.

Another aspect includes an antibody, polypeptide, or combination thereof that specifically binds a BAG2 polypeptide or fragment thereof; an antibody, polypeptide, or combination thereof that specifically binds to a pro-cathepsin B polypeptide or fragment thereof; Or a composition for screening a substance that inhibits the binding between BAG2 and pro-cathepsin B comprising a combination thereof.

In one embodiment, the composition may further comprise BAG2 and pro-cathepsin B polypeptides, or fragments thereof.

Since the screening composition of the present invention can be used to measure the binding between BAG2 and pro-cathepsin B in cells as well as in cells, BAG2 and pro- further comprising the BAG2 and pro-cathepsin B polypeptides, or fragments thereof. Screening compositions of substances that inhibit the binding of cathepsin B may be more useful for measuring the binding between BAG2 and pro-cathepsin B extracellularly.

In one embodiment, the BAG2 polypeptide of the composition may have an amino acid sequence of SEQ ID NO: 5 or 6, the pro-cathepsin B polypeptide may have an amino acid sequence of SEQ ID NO: 7 or 8.

In one embodiment, the pro-cathepsin B polypeptide fragment of the composition may comprise an amino acid sequence of 1 to 80 of SEQ ID NO: 7 to 8 of the pro-cathepsin B polypeptide.

In one embodiment, the agent that inhibits the binding of BAG2 and pro-cathepsin B screened by the composition may be an anticancer agent.

In one embodiment, the cancer of the anticancer agent may be selected from breast cancer, colon cancer, lung cancer, sarcoma, melanoma, head and neck cancer, cervical cancer, uterine cancer, liver cancer, kidney cancer, pancreatic cancer, and neuroblastoma.

Another aspect includes an antibody, polypeptide, or combination thereof that specifically binds a BAG2 polypeptide or fragment thereof; an antibody, polypeptide, or combination thereof that specifically binds to a pro-cathepsin B polypeptide or fragment thereof; Or a kit for screening a substance that inhibits the binding of BAG2 and pro-cathepsin B comprising a combination thereof.

The term “antibody” means a specific immunoglobulin directed against the antigenic site. The antibody means a polypeptide or a combination of polypeptides that specifically binds to BAG2 and pro-cathepsin B, respectively, and the BAG2 or pro-cathepsin B gene is cloned into an expression vector to obtain a protein encoded by each gene. Or from the pro-cathepsin B protein, antibodies specific for each protein can be prepared according to methods conventional in the art. Forms of such antibodies include polyclonal antibodies or monoclonal antibodies, including all immunoglobulin antibodies. The antibody does not have the structure of a full form intact antibody with two light chains and two heavy chains, as well as a full form with two full length light chains and two full length heavy chains, but is directed against antigenic sites Also included are functional fragments of antibody molecules that possess specific antigen binding sites (binding domains) and retain antigen binding function.

In one embodiment, the kit may further comprise BAG2 and pro-cathepsin B polypeptides, or fragments thereof.

Screening kit of the present invention can be used to measure the binding between BAG2 and pro-cathepsin B in the extracellular, binding of BAG2 and pro-cathepsin B further comprising the BAG2 and pro-cathepsin B polypeptide, or fragments thereof Kits for the screening of inhibitors may be more useful for measuring binding between BAG2 and pro-cathepsin B extracellularly.

In one embodiment, the kit may further comprise BAG2 and pro-cathepsin B polypeptides, or fragments thereof, or polynucleotides encoding the same.

Since the screening kit of the present invention can be used to measure the binding between BAG2 and pro-cathepsin B in a cell, the screening further comprises the AG2 and pro-cathepsin B polypeptides, or fragments thereof, or polynucleotides encoding the same. Kits may be more useful for measuring binding between BAG2 and pro-cathepsin B intracellularly or in cells that do not express BAG2 or pro-cathepsin B or have low expression levels.

The screening kit of the present invention may comprise one or more other component compositions, solutions or devices required to determine the extent of binding. In one embodiment, labeled with a substrate, a suitable buffer, a chromogenic enzyme or a fluorophore for immunological detection of an antibody, polypeptide, or combination thereof that specifically binds to the BAG2 or pro-cathepsin B polypeptide or fragment thereof. Secondary antibodies, chromogenic substrates. The substrate may be a nitrocellulose membrane, a 96 well plate synthesized with a polyvinyl resin, a 96 well plate synthesized with a polystyrene resin, a glass slide glass, and the like. The chromophore may be a peroxidase, an alkaline phosphatase ( alkaline phosphatase) may be used, the fluorescent material may be FITC, RITC, etc., the chromogenic substrate is 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) or o- Phenylenediamine (OPD), tetramethyl benzidine (TMB) and the like can be used.

It is understood that any of the terms or elements mentioned in the compositions or kits as mentioned in the description of the claimed screening method is as mentioned in the description of the claimed screening method.

Contacting the subject with a sample comprising a BAG2 polypeptide or fragment thereof and a pro-cathepsin B polypeptide or fragment thereof; Measuring the level of binding between said BAG2 and pro-cathepsin B polypeptide or fragment thereof; And screening a substance that inhibits binding between BAG2 and pro-cathepsin B, comprising selecting a sample having a reduced degree of binding compared to a control sample. Substances can be efficiently identified and consequently contribute to the efficient development of promising anticancer candidates.

An antibody, polypeptide, or combination thereof that specifically binds a BAG2 polypeptide or fragment thereof according to another aspect; an antibody, polypeptide, or combination thereof that specifically binds to a pro-cathepsin B polypeptide or fragment thereof; Or by using a composition for screening a composition for inhibiting the binding of BAG2 and pro-cathepsin B including a combination thereof, it can be produced as a kit, the industry that develops anti-cancer drug candidates, etc. binding of BAG2 and pro-cathepsin B Make screening methods of materials that inhibits the use of readily available.

An antibody, polypeptide, or combination thereof that specifically binds to a BAG2 polypeptide or fragment thereof according to another aspect; an antibody, polypeptide, or combination thereof that specifically binds to a pro-cathepsin B polypeptide or fragment thereof; Or a method for screening a substance that inhibits binding of BAG2 and pro-cathepsin B by an industry or the like that develops an anticancer drug candidate using a kit for screening a substance that inhibits binding of BAG2 and pro-cathepsin B including a combination thereof. Make it readily available.

Figure 1 shows the size distribution of CTSB (cathepsin B) by size exclusive chromatography. (Pro, pro-form: SC (single chain), short chain form; DC (double chain), double chain heavy chain)
Figure 2 shows the results of immunoprecipitation analysis to identify the interaction region between BAG2 and cathepsin B.
Figure 3 shows the results of immunoblot analysis of cytoplasm, cytosol, and lysosomal-rich fractions isolated from cells.
4A shows the size distribution of CTSB by size exclusion chromatography in control cells and BAG2 deletion cells, and FIG. 4B shows the activity of CTSB of each fraction eluted from the size exclusion chromatography.
Figure 5A shows the change in the shape of CTSB according to BAG2 recovery in BAG2 deletion cells, Figure 5B shows the change in activity of CTSB according to the change in shape of the CTSB.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example  One. Of CTSB  By form With BAG2  Confirm interaction

1-1. Of CTSB  Morphology analysis and With BAG2 Binding capacity  Confirm

CTSB antibodies recognize both pro-form and mature CTSBs (single chains and double chains (DCs)), so that CTSBs interact with BAG2 according to their CTSB form. Size exclusion chromatography was performed to allow for morphological analysis.

Specifically, cell lysates cultivated by culturing MDA-MB-231 cells, breast cancer cells, were fractionated using size exclusion chromatography (Bio-rad) according to the vendor's instructions. The cell lysate is mixed with a solution according to the seller's instructions, hemoglobin (65 kDa), and vitamin B ₁₂ (1.350 kDa), and then the chromatographic column containing microscopic porous beads is added to the lowered fractions of different sizes. Collected through. An equal volume of sample was then taken from each fraction to separate the eluted protein via SDS = polyacrylamide gel electrophoresis, transfer to PVDF membrane (Millipore), and immunoblot using anti-CTSB and anti-BAG2. Each protein was detected by doing so.

As a result, BAG2 and full-form CTSB were present in the same fraction (fractions 5 and 6), whereas the SC or DC form did not appear to be present together in the fraction in which BAG2 was present (FIG. 1). This means that BAG2 and pre-CTSB may form one complex and be present at the same time.

1-2. CTSB  Of specific bonding positions

In order to identify the position where BAG2 specifically binds in the CTSB, domains of the CTSB were separated in detail, and immunoprecipitation analysis was performed to determine whether BAG2 was bound to each polypeptide.

First, 293T cells were co-transfected using Lipofectamine 2000 (Invitrogen) with a GFP-linked deletion mutant vector expressing Myc-tag BAG expression vector and CTSB each region. Wash cells twice with cold PBS and include IP buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 2 mM EDTA, including phosphatase and protease inhibitor (Roche) And 10% glycerol). Whole-cell extracts were incubated overnight at 4 ° C. with anti-Myc antibodies, anti-β-actin antibodies, and anti-GFP antibodies. Protein bound antibody was precipitated using protein A / G beads according to the vendor's instructions. The beads were washed three times with lysis buffer and eluted with 2 × SDS sample loading buffer. The eluted protein was detected by immunoblotting using the antibody shown in FIG. 2 as in Example 1-1.

As a result, it was shown that BAG2 specifically binds to the propeptide region of pre-CTSB (FIG. 2). These results show that BAG2 can interact with the propeptide region involved in the cleavage process that controls the activity of pre-CTSB. Specifically, the propeptide region of pre-CTSB converts pre-CTSB to SC CTSB. This means that the BAG2 may affect the conversion from pre-CTSB to SC CTSB form, which is a mature CTSB form.

Example  2. Of CTSB  Confirmation of cell death activity by morphology

2-1. bracket Of CTSB  Cell division according to the region of morphology

Since the CTSB of lysosomes is known to induce apoptosis by secretion into cytosol as a result of proper lysosomal division, the present inventors have found that cytoplasm, cytosol isolated from BAG2-deleted cells by isotonic sucrose or different centrifugation. (cytosol), and lysosomal-high content fractions were used to assess the effect on CTSB migration and cell death by BAG2 interaction.

Specifically, BAG2-specific shRNAs were first purchased from Mission-shRNA (Sigma) to produce BAG2-deleted cell lines. For BAG2-specific shRNA lentivirus production, 293T cells were transfected with pLKO-BAG2 or scrambled control pLKO-pGL2 with packaging plasmid encoding Δ8.9 and VSV-G. (Target sequence of BAG2 shRNA used (5 ′ → 3 ′): GTACTAGGATCTAGCATATTT)

Viral supernatants were collected 36-48 hours after transfection and filtered through a 0.45 μm filter. MDA-MB-231 (ATCC) was seeded at 1 × 10 ⁵ cells / well in 6 well plates and infected with viral particles and polybrene (8 μg / ml). After infection, the medium containing the virus was replaced with normal vegetation and the cells were selected as puromycin (2 μg / ml).

Lysosomal isolation was performed according to the vendor's instructions using a lysosome enrichment kit (Thermo Scientific) for tissue and cultured cells. Control and BAG2-deleted MDA-MB-231 cells were harvested and centrifuged at 850 × g for 3 minutes. After removing the supernatant, the pellet was resuspended with lysosome enrichment reagent A and placed on ice for 2 minutes. The cells were disrupted with Dounce tissue grinder on ice and lysosome enrichment reagent B was added. The cells were then centrifuged at 500 × g for 10 minutes at 4 ° C. and the supernatant was overlayed on a density gradient for further ultra centrifugation at 145,000 × g for 4 hours at 4 ° C. After ultra centrifugation, the lysosomal band located above this concentration was carefully removed. The samples were diluted with three volumes of PBS and centrifuged at 18,000 × g for 1 hour at 4 ° C. The lysosomal pellets were left on ice until use. The lysosomal pellet was then boiled with SDS-PAGE sample buffer and analyzed by immunoblot using an antibody as shown in FIG. 3.

Isolation of the cytosol was centrifuged at 160,000 × g for 1 hour and then the supernatant fractions were collected as cytosol fractions and immunoblots were performed as performed for the lysosomal pellets.

As a result, BAG2 deletion induced significant secretion of SC CTSB with caspase-3 activation from lysosomes to cytosol, thereby promoting apoptosis by mediating increased secretion of SC CTSB to cytosol (FIG. 3).

Example  3. Of BAG2 Of CTSB  Due to shape control CTSB  Check active regulation

3-1. BAG2  According to overexpression Of CTSB  Shape change analysis

In order to examine the effect of BAG2 on CTSB in more detail, we tried to evaluate the abundance of each type of CTSB and the change of CTSB activity according to each type according to the overexpression of BAG2. Since both mature SC and DC forms of CTSB are generally thought to have proteolytic activity, fractions obtained from size exclusion chromatography can be used to test the activity of CTSB in cells to determine the activity of mature CTSB in BAG2-deleted cells. An attempt was made to determine the active form.

Specifically, using the control shown in Example 2-1 and BAG2-deleted MDA-MB-231 cells in the same size exclusion chromatography as in Example 1-1, using the antibody shown in Figure 4A Immunoblot was performed.

3-2. Of CTSB  Protein by form Hydrolytic  Active evaluation

Since the proteolytic activity of the mature CTSB of the lysosomes plays an important role in the activity of caspase-3, the present inventors have found that the activity of SC CTSB is enhanced by using synthetic Arg-Arg, which is the substrate sequence of the mature CTSB, for each fraction obtained above. Tested.

Specifically, the fractions in Example 3-2 were incubated for 1 hour at 37 ° C. in the presence of fluorescent cathepsin B substrate (200 μM Ac-RR-AFC; Abcam) according to the vendor's instructions. Fluorescence measurements were performed on a multiplate detector Wallac 1440 Victor2 (PerkinElmer) and relative fluorescence units were measured at 460 nm using an excitation wavelength of 355 nm.

As a result, referring to Figures 4A and 4B, fractions 7 to 8 of the control cells showed lower CTSB activity than fractions 9 to 11 in which DC form was detected and SC form was observed. This means that the DC form of CTSB has less activity than the SC form. As a result of observing the fraction of the BAG2-deleted cells, it can be seen that the SC form of the CTSB expression in the fraction of the BAG2-deleted cells is much higher than that of the control group. It can be seen that it shows a significantly higher CTSB activity. This means that BAG2 can inhibit the intracellular activity of the mature SC form of CTSB which promotes caspase-3 mediated apoptosis.

3-3. BAG2  In deletion cells Of CTSB  Activity assessment and its recovery

To further clarify the role of BAG2 in regulating CTSB activity, we examined whether increased CTSB activity in BAG2-deleted cells decreased again due to recovery of BAG2.

Specifically, as in Example 2-1, control and BAG2-deleted MCF10CA1a cells were prepared by control shRNA or BAG2-specific shRNA, and BAG2 expression vector was transfected as in Example 1-2 to overexpress BAG2. Or BAG2 expression was restored to BAG2-deleted MCF10CA1a cells.

As a result, referring to FIGS. 5A and 5B, the BAG2-deficient MCF10CA1a cells were reintroduced into BAG2-deficient MCF10CA1a cells, resulting in the expression of active Caspase-3 and the expression of mature SC CTSB BAG2-overexpressing cells (BAG2 OV). Decreased to a degree. Increased CTSB activity due to BAG2 deletion has also been shown to be significantly weakened in BAG2-recovered cells. This means that BAG2 may be intended to maintain tumor cell survival by inhibiting CTSB activation to mature SC CTSB and sequentially caspase-3 mediated apoptosis.

<110> AICT (ADVANCED INSTITUTES OF CONVERGENCE TECHNOLOGY) <120> A method of screening materials for inhibition of interaction          between BAG2 and Cathepsin B <130> PN115802 <160> 8 <170> KopatentIn 2.0 <210> 1 <211> 636 <212> DNA <213> Homo sapiens <400> 1 atggctcagg cgaagatcaa cgctaaagcc aacgaggggc gcttctgccg ctcctcctcc 60 atggctgacc gctccagccg cctgctggag agcctggacc agctggagct cagggttgaa 120 gctttgagag aagcagcaac tgctgttgag caagagaaag aaatccttct ggaaatgatc 180 cacagtatcc aaaatagcca ggacatgagg cagatcagtg acggagaaag agaagaatta 240 aatctgactg caaaccgttt gatgggaaga actctcaccg ttgaagtgtc agtagaaaca 300 attagaaacc cccagcagca agaatcccta aagcatgcca caaggattat tgatgaggtg 360 gtcaataagt ttctggatga tttgggaaat gccaagagtc atttaatgtc gctctacagt 420 gcatgttcat ctgaggtgcc acatgggcca gttgatcaga agtttcaatc catagtaatt 480 ggctgtgctc ttgaagatca gaagaaaatt aagagaagat tagagactct gcttagaaat 540 attgaaaact ctgacaaggc catcaagcta ttagagcatt ctaaaggagc tggttccaaa 600 actctgcaac aaaatgctga aagcagattc aattag 636 <210> 2 <211> 633 <212> DNA <213> Mus musculus <400> 2 atggcccagg cgaagatcag cgccaaggcc cacgagggcc gcttctgccg ctcgtcttcc 60 atggccgacc gctccagccg cctgctggag agtctggacc agctggagct cagggtggaa 120 gctttgagag acgcagctac tgctgttgag caggagaaag aaatccttct ggagatgatc 180 cacagtatcc aaaacagcca ggacatgagg cagattagcg atggagaaag agaggaacta 240 aacctgactg ccaaccgtct gatgggccgg accctcacgg ttgaggtctc ggtggaaacg 300 atccgaaacc cccagcagga ggaatccttg aagcatgcca cgaggattat agacgaggtg 360 gtcagcaagt tcctagatga cctggggaat gccaagagcc acttaatgtc actttacagt 420 gcctgctcat cggaggtgcc gcctgggccg gtggaccaga agtttcaatc gatagtcatc 480 ggttgcgctc ttgaggatca gaagaaaatc aagaggcgat tggagactct gctgaggaac 540 attgacaact ccgacaaggc cattaaactc ctagagcatg ctaaaggagc tggttccaaa 600 agcctgcaga acactgacgg caaatttaat tag 633 <210> 3 <211> 1020 <212> DNA <213> Homo sapiens <400> 3 atgtggcagc tctgggcctc cctctgctgc ctgctggtgt tggccaatgc ccggagcagg 60 ccctctttcc atcccctgtc ggatgagctg gtcaactatg tcaacaaacg gaataccacg 120 tggcaggccg ggcacaactt ctacaacgtg gacatgagct acttgaagag gctatgtggt 180 accttcctgg gtgggcccaa gccaccccag agagttatgt ttaccgagga cctgaagctg 240 cctgcaagct tcgatgcacg ggaacaatgg ccacagtgtc ccaccatcaa agagatcaga 300 gaccagggct cctgtggctc ctgctgggcc ttcggggctg tggaagccat ctctgaccgg 360 atctgcatcc acaccaatgc gcacgtcagc gtggaggtgt cggcggagga cctgctcaca 420 tgctgtggca gcatgtgtgg ggacggctgt aatggtggct atcctgctga agcttggaac 480 ttctggacaa gaaaaggcct ggtttctggt ggcctctatg aatcccatgt agggtgcaga 540 ccgtactcca tccctccctg tgagcaccac gtcaacggct cccggccccc atgcacgggg 600 gagggagata cccccaagtg tagcaagatc tgtgagcctg gctacagccc gacctacaaa 660 caggacaagc actacggata caattcctac agcgtctcca atagcgagaa ggacatcatg 720 gccgagatct acaaaaacgg ccccgtggag ggagctttct ctgtgtattc ggacttcctg 780 ctctacaagt caggagtgta ccaacacgtc accggagaga tgatgggtgg ccatgccatc 840 cgcatcctgg gctggggagt ggagaatggc acaccctact ggctggttgc caactcctgg 900 aacactgact ggggtgacaa tggcttcttt aaaatactca gaggacagga tcactgtgga 960 atcgaatcag aagtggtggc tggaattcca cgcaccgatc agtactggga aaagatctaa 1020                                                                         1020 <210> 4 <211> 1020 <212> DNA <213> Mus musculus <400> 4 atgtggtggt ccttgatcct tctttcttgc ctgctggcac tgaccagtgc ccatgacaag 60 ccttccttcc acccgctgtc ggatgacctg attaactata tcaacaaaca gaatacaaca 120 tggcaggctg gacgcaactt ctacaatgtt gacataagct atctgaagaa gctgtgtggc 180 actgtcctgg gtggacccaa actgccagga agggttgcgt tcggtgagga catagatcta 240 cctgaaacct ttgatgcacg ggaacaatgg tccaactgcc cgaccattgg acagattaga 300 gaccagggct cctgcggctc ttgttgggca tttggggcag tggaagccat ttctgaccga 360 acctgcattc acaccaatgg ccgagtcaac gtggaggtgt ctgctgaaga cctgcttact 420 tgctgtggta tccagtgtgg ggacggctgt aatggtggct atccctctgg agcatggagc 480 ttctggacaa aaaaaggcct ggtttcaggt ggagtctaca attctcatgt aggctgctta 540 ccatacacca tccctccctg cgagcaccat gtcaatggct cccgtccccc atgcactgga 600 gaaggagata ctcccaggtg caacaagagc tgtgaagctg gctactcccc atcctacaaa 660 gaggataagc actttgggta cacttcctac agcgtgtcta acagtgtgaa ggagatcatg 720 gcagaaatct acaaaaatgg cccagtggag ggtgccttca ctgtgttttc tgacttcttg 780 acttacaaat caggagtata caagcatgaa gccggtgata tgatgggtgg ccacgccatc 840 cgcatcctgg gctggggagt agagaatgga gttccctact ggctggcagc caactcttgg 900 aaccttgact ggggtgataa tggcttcttt aaaatcctca gaggagagaa ccactgtggc 960 attgaatcag aaattgtggc tggaatccca cgcactgacc agtactgggg aagattctaa 1020                                                                         1020 <210> 5 <211> 211 <212> PRT <213> Homo sapiens <400> 5 Met Ala Gln Ala Lys Ile Asn Ala Lys Ala Asn Glu Gly Arg Phe Cys   1 5 10 15 Arg Ser Ser Ser Met Ala Asp Arg Ser Ser Arg Leu Leu Glu Ser Leu              20 25 30 Asp Gln Leu Glu Leu Arg Val Glu Ala Leu Arg Glu Ala Ala Thr Ala          35 40 45 Val Glu Gln Glu Lys Glu Ile Leu Leu Glu Met Ile His Ser Ile Gln      50 55 60 Asn Ser Gln Asp Met Arg Gln Ile Ser Asp Gly Glu Arg Glu Glu Leu  65 70 75 80 Asn Leu Thr Ala Asn Arg Leu Met Gly Arg Thr Leu Thr Val Glu Val                  85 90 95 Ser Val Glu Thr Ile Arg Asn Pro Gln Gln Gln Glu Ser Leu Lys His             100 105 110 Ala Thr Arg Ile Ile Asp Glu Val Val Asn Lys Phe Leu Asp Asp Leu         115 120 125 Gly Asn Ala Lys Ser His Leu Met Ser Leu Tyr Ser Ala Cys Ser Ser     130 135 140 Glu Val Pro His Gly Pro Val Asp Gln Lys Phe Gln Ser Ile Val Ile 145 150 155 160 Gly Cys Ala Leu Glu Asp Gln Lys Lys Ile Lys Arg Arg Leu Glu Thr                 165 170 175 Leu Leu Arg Asn Ile Glu Asn Ser Asp Lys Ala Ile Lys Leu Leu Glu             180 185 190 His Ser Lys Gly Ala Gly Ser Lys Thr Leu Gln Gln Asn Ala Glu Ser         195 200 205 Arg phe asn     210 <210> 6 <211> 210 <212> PRT <213> Mus musculus <400> 6 Met Ala Gln Ala Lys Ile Ser Ala Lys Ala His Glu Gly Arg Phe Cys   1 5 10 15 Arg Ser Ser Ser Met Ala Asp Arg Ser Ser Arg Leu Leu Glu Ser Leu              20 25 30 Asp Gln Leu Glu Leu Arg Val Glu Ala Leu Arg Asp Ala Ala Thr Ala          35 40 45 Val Glu Gln Glu Lys Glu Ile Leu Leu Glu Met Ile His Ser Ile Gln      50 55 60 Asn Ser Gln Asp Met Arg Gln Ile Ser Asp Gly Glu Arg Glu Glu Leu  65 70 75 80 Asn Leu Thr Ala Asn Arg Leu Met Gly Arg Thr Leu Thr Val Glu Val                  85 90 95 Ser Val Glu Thr Ile Arg Asn Pro Gln Gln Glu Glu Ser Leu Lys His             100 105 110 Ala Thr Arg Ile Ile Asp Glu Val Val Ser Lys Phe Leu Asp Asp Leu         115 120 125 Gly Asn Ala Lys Ser His Leu Met Ser Leu Tyr Ser Ala Cys Ser Ser     130 135 140 Glu Val Pro Pro Gly Pro Val Asp Gln Lys Phe Gln Ser Ile Val Ile 145 150 155 160 Gly Cys Ala Leu Glu Asp Gln Lys Lys Ile Lys Arg Arg Leu Glu Thr                 165 170 175 Leu Leu Arg Asn Ile Asp Asn Ser Asp Lys Ala Ile Lys Leu Leu Glu             180 185 190 His Ala Lys Gly Ala Gly Ser Lys Ser Leu Gln Asn Thr Asp Gly Lys         195 200 205 Phe asn     210 <210> 7 <211> 339 <212> PRT <213> Homo sapiens <400> 7 Met Trp Gln Leu Trp Ala Ser Leu Cys Cys Leu Leu Val Leu Ala Asn   1 5 10 15 Ala Arg Ser Arg Pro Ser Phe His Pro Leu Ser Asp Glu Leu Val Asn              20 25 30 Tyr Val Asn Lys Arg Asn Thr Thr Trp Gln Ala Gly His Asn Phe Tyr          35 40 45 Asn Val Asp Met Ser Tyr Leu Lys Arg Leu Cys Gly Thr Phe Leu Gly      50 55 60 Gly Pro Lys Pro Pro Gln Arg Val Met Phe Thr Glu Asp Leu Lys Leu  65 70 75 80 Pro Ala Ser Phe Asp Ala Arg Glu Gln Trp Pro Gln Cys Pro Thr Ile                  85 90 95 Lys Glu Ile Arg Asp Gln Gly Ser Cys Gly Ser Cys Trp Ala Phe Gly             100 105 110 Ala Val Glu Ala Ile Ser Asp Arg Ile Cys Ile His Thr Asn Ala His         115 120 125 Val Ser Val Glu Val Ser Ala Glu Asp Leu Leu Thr Cys Cys Gly Ser     130 135 140 Met Cys Gly Asp Gly Cys Asn Gly Gly Tyr Pro Ala Glu Ala Trp Asn 145 150 155 160 Phe Trp Thr Arg Lys Gly Leu Val Ser Gly Gly Leu Tyr Glu Ser His                 165 170 175 Val Gly Cys Arg Pro Tyr Ser Ile Pro Pro Cys Glu His His Val Asn             180 185 190 Gly Ser Arg Pro Pro Cys Thr Gly Glu Gly Asp Thr Pro Lys Cys Ser         195 200 205 Lys Ile Cys Glu Pro Gly Tyr Ser Pro Thr Tyr Lys Gln Asp Lys His     210 215 220 Tyr Gly Tyr Asn Ser Tyr Ser Val Ser Asn Ser Glu Lys Asp Ile Met 225 230 235 240 Ala Glu Ile Tyr Lys Asn Gly Pro Val Glu Gly Ala Phe Ser Val Tyr                 245 250 255 Ser Asp Phe Leu Leu Tyr Lys Ser Gly Val Tyr Gln His Val Thr Gly             260 265 270 Glu Met Met Gly Gly His Ala Ile Arg Ile Leu Gly Trp Gly Val Glu         275 280 285 Asn Gly Thr Pro Tyr Trp Leu Val Ala Asn Ser Trp Asn Thr Asp Trp     290 295 300 Gly Asp Asn Gly Phe Phe Lys Ile Leu Arg Gly Gln Asp His Cys Gly 305 310 315 320 Ile Glu Ser Glu Val Val Ala Gly Ile Pro Arg Thr Asp Gln Tyr Trp                 325 330 335 Glu lys ile             <210> 8 <211> 339 <212> PRT <213> Mus musculus <400> 8 Met Trp Trp Ser Leu Ile Leu Leu Ser Cys Leu Leu Ala Leu Thr Ser   1 5 10 15 Ala His Asp Lys Pro Ser Phe His Pro Leu Ser Asp Asp Leu Ile Asn              20 25 30 Tyr Ile Asn Lys Gln Asn Thr Thr Trp Gln Ala Gly Arg Asn Phe Tyr          35 40 45 Asn Val Asp Ile Ser Tyr Leu Lys Lys Leu Cys Gly Thr Val Leu Gly      50 55 60 Gly Pro Lys Leu Pro Gly Arg Val Ala Phe Gly Glu Asp Ile Asp Leu  65 70 75 80 Pro Glu Thr Phe Asp Ala Arg Glu Gln Trp Ser Asn Cys Pro Thr Ile                  85 90 95 Gly Gln Ile Arg Asp Gln Gly Ser Cys Gly Ser Cys Trp Ala Phe Gly             100 105 110 Ala Val Glu Ala Ile Ser Asp Arg Thr Cys Ile His Thr Asn Gly Arg         115 120 125 Val Asn Val Glu Val Ser Ala Glu Asp Leu Leu Thr Cys Cys Gly Ile     130 135 140 Gln Cys Gly Asp Gly Cys Asn Gly Gly Tyr Pro Ser Gly Ala Trp Ser 145 150 155 160 Phe Trp Thr Lys Lys Gly Leu Val Ser Gly Gly Val Tyr Asn Ser His                 165 170 175 Val Gly Cys Leu Pro Tyr Thr Ile Pro Pro Cys Glu His His Val Asn             180 185 190 Gly Ser Arg Pro Pro Cys Thr Gly Glu Gly Asp Thr Pro Arg Cys Asn         195 200 205 Lys Ser Cys Glu Ala Gly Tyr Ser Pro Ser Tyr Lys Glu Asp Lys His     210 215 220 Phe Gly Tyr Thr Ser Tyr Ser Val Ser Asn Ser Val Lys Glu Ile Met 225 230 235 240 Ala Glu Ile Tyr Lys Asn Gly Pro Val Glu Gly Ala Phe Thr Val Phe                 245 250 255 Ser Asp Phe Leu Thr Tyr Lys Ser Gly Val Tyr Lys His Glu Ala Gly             260 265 270 Asp Met Met Gly Gly His Ala Ile Arg Ile Leu Gly Trp Gly Val Glu         275 280 285 Asn Gly Val Pro Tyr Trp Leu Ala Ala Asn Ser Trp Asn Leu Asp Trp     290 295 300 Gly Asp Asn Gly Phe Phe Lys Ile Leu Arg Gly Glu Asn His Cys Gly 305 310 315 320 Ile Glu Ser Glu Ile Val Ala Gly Ile Pro Arg Thr Asp Gln Tyr Trp                 325 330 335 Gly arg phe            

Claims (18)

Contacting the subject with a sample comprising a BAG2 polypeptide or fragment thereof, and a pro-cathepsin B polypeptide or fragment thereof;
Measuring the level of binding between said BAG2 and pro-cathepsin B polypeptide or fragment thereof; And
Selecting a sample having a reduced degree of binding compared to a control sample;
A method of screening a substance that inhibits binding between BAG2 and pro-cathepsin B. The method of claim 1, wherein the sample is a cell culture, wherein the BAG2 and pro-cathepsin B polypeptides or fragments thereof are present in a cell. The method of claim 2, wherein the BAG2 and pro-cathepsin B polypeptides or fragments thereof present in the cell are endogenous, foreign, or a combination thereof. The method of claim 3, wherein the exogenous BAG2 and pro-cathepsin B polypeptides or fragments thereof are expressed from a polynucleotide encoding the polypeptide or fragments thereof, wherein the polynucleotide encoding the exogenous BAG2 polypeptide is SEQ ID NO: 1 or 2 And wherein the polynucleotide encoding the pro-cathepsin B polypeptide comprises SEQ ID NO: 3 or 4. The method of claim 1, wherein the BAG2 and pro-cathepsin B polypeptides or fragments thereof are extracellular. The method of claim 1, wherein the BAG2 polypeptide has an amino acid sequence of SEQ ID NO: 5 or 6, and the pro-cathepsin B polypeptide has an amino acid sequence of SEQ ID NO: 7 or 8. 8. The method of claim 1, wherein the fragment of the pro-cathepsin B polypeptide comprises an amino acid sequence 1-80th from the N-terminus of SEQ ID NO: 7 or 8. 8. The method of claim 1, wherein the agent that inhibits the binding between BAG2 and pro-cathepsin B is an anticancer agent. The method of claim 8, wherein the cancer of the anticancer agent is selected from breast cancer, colon cancer, lung cancer, sarcoma, melanoma, head and neck cancer, cervical cancer, uterine cancer, liver cancer, kidney cancer, pancreatic cancer, and neuroblastoma. An antibody, polypeptide, or combination thereof that specifically binds a BAG2 polypeptide or fragment thereof;
an antibody, polypeptide, or combination thereof that specifically binds to a pro-cathepsin B polypeptide or fragment thereof; or
A composition for screening a substance that inhibits binding between BAG2 and pro-cathepsin B comprising a combination thereof. The composition of claim 10, wherein the composition further comprises a BAG2 and pro-cathepsin B polypeptide, or a fragment thereof. The composition of claim 10, wherein the BAG2 polypeptide has an amino acid sequence of SEQ ID NO: 5 or 6, and the pro-cathepsin B polypeptide has an amino acid sequence of SEQ ID NO: 7 or 8. 12. The composition of claim 12, wherein the pro-cathepsin B polypeptide fragment comprises the amino acid sequence of 1 to 80 of SEQ ID NO: 7 or 8 of the pro-cathepsin B protein. The composition of claim 10, wherein the substance that inhibits the binding of BAG2 and pro-cathepsin B is an anticancer agent. The composition of claim 14, wherein the cancer of the anticancer agent is selected from breast cancer, colon cancer, lung cancer, sarcoma, melanoma, head and neck cancer, cervical cancer, uterine cancer, liver cancer, kidney cancer, pancreatic cancer, and neuroblastoma. An antibody, polypeptide, or combination thereof that specifically binds a BAG2 polypeptide or fragment thereof;
an antibody, polypeptide, or combination thereof that specifically binds to a pro-cathepsin B polypeptide or fragment thereof; or
A kit for screening a substance that inhibits binding between BAG2 and pro-cathepsin B comprising a combination thereof. The kit of claim 16 further comprising BAG2 and pro-cathepsin B polypeptides, or fragments thereof. The kit of claim 16, further comprising a cell comprising a BAG2 and pro-cathepsin B polypeptide, or a fragment thereof, or a polynucleotide sequence encoding the same.

Images