KR102039460B1 - Elastin Fusion Proteins with Coiled-coil forming peptides, Their Stimuli-triggered Self-assembly, Methods of Preparation and Biomedical use Thereof - Google Patents

Abstract

The present invention provides a coiled-coil forming peptide (CCP) block; And an elastin-based polypeptide (EBP) block having stimulatory reactivity linked to the CCP block.

Description

Elastin Fusion Proteins with Coiled-Coil Forming Peptides, Self-Assembled Nanostructures and Hydrogels Following Their Stimulation, Elastin Fusion Proteins with Coiled-coil Forming Peptides, Their Stimuli-triggered Self-assembly, Methods of Preparation and Biomedical use Thereof}

The present invention provides a stimulatory reactive fusion polypeptide, self-assembled nanostructures, including elastin-based polypeptide (EBP) and coiled-coil forming peptide (CCP) The present invention relates to a hydrogel for applying to the biomedical field.

Protein-based biomaterials have been studied as tools applicable to the biomedical field because they can be designed by manipulating desired properties at the molecular level as biomaterials. Recently, there has been a great interest in injectable hydrogels which are capable of injection of irritant reactivity. It is important to design smart hydrogels with sufficient strength and biocompatibility. The amino acid sequence of the artificial protein can be sequenced in advance, allowing careful determination of molecular weight, composition and function to make biomaterials.

Elastin-based polypeptides (EBPs) are thermally reactive biopolymers derived from elastomeric domains. Elastin is a major protein component of the extracellular matrix (ECM). EBPs have been modified to have thermal sensitivity based on elastomeric domains, and Val-Pro- (Gly or Ala) -X, a repeating unit of pentapeptide, a peptide consisting of five amino acids _aa -Gly [VP (G or A) XG]. In the present invention, EBPs are heat-sensitive polypeptides, and their transition temperatures can be easily controlled to form block copolymer structure-based self-assembled nanostructures. X _aa is a guest residue and may be any amino acid except proline.

EBPs have a lower critical solution temperature (LCST), i.e., transition temperature (T _t ), exhibiting a reversible phase transition with temperature. It is water-soluble below the transition temperature, and becomes insoluble when the temperature increases above the transition temperature.

Coiled-coil forming peptide (s) (CCP (s)) is a good module for protein-based biomaterials. CCP self-assembles to create a stable structure, which is a very good material to use as a physical cross-linker for biomaterials.

Inspired by the self-assembly of CCP, the inventors have completed the present invention by developing a fusion polypeptide having unique properties by combining CCP and heat reactive EBP.

Biomacromolecules 2015, 16, 3389-3398

It is an object of the present invention to provide new forms of fusion polypeptides.

Another object of the present invention is to provide a self-assembled nanostructure of the fusion polypeptide.

Another object of the present invention is to provide a reversible hydrogel using the fusion polypeptide.

Another object of the present invention is to provide the hydrogel for biomedical use.

The present invention provides a stimulatory responsive fusion polypeptide fused with EBP having a stimulatory response (eg, thermal reactivity) and a CCP capable of self-assembling, the fusion polypeptide making a self-assembled structure. Stimulating reactive fusion polypeptides of the invention include double blocks (CCP-EBP) and triple blocks (CCP-EBP-CCP). It demonstrates concretely below.

The present invention provides a stimulatory reactive fusion polypeptide consisting of a double block peptide as follows:

Coiled-coil forming peptide (CCP) blocks; And

An elastin-based polypeptide (EBP) block having stimulus reactivity linked to the CCP block.

The stimulus may be heat, which may also be expressed in temperature.

The CCP block may comprise an amino acid consisting of one of the amino acid sequences set forth in SEQ ID NOs: 45 to 48. Specifically, an amino acid sequence composed of one of the amino acid sequences described in SEQ ID NOs: 45 to 48 is a basic unit, and this basic unit may be repeated n times (n is an integer of 1 or more).

The EBP block is,

It may consist of the amino acid sequence represented by the following formula 1 or formula 2:

[Equation 1]

[SEQ ID NO: 1] n; or

[Equation 2]

[SEQ ID NO 2] n,

In Formula 1 or Formula 2,

SEQ ID NO: 1 consists of [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG];

SEQ ID NO: 2 consists of [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG];

N is an integer of 1 or more and is the number of repetitions of SEQ ID NO: 1 or SEQ ID NO: 2; And

X is an amino acid other than proline and is selected from any natural or artificial amino acid when the pentapeptide VPGXG or VPAXG is repeated.

The EBP block is,

In the pentapeptide VPGXG or VPAXG, the V (valine) may be substituted with I (isoleucine).

The stimulatory reactive fusion polypeptide of the double block may be composed of one of the amino acid sequences set forth in SEQ ID NOs: 51 to 67.

In the stimulus-reactive fusion polypeptide, a CCP block forms a core structure below the transition temperature of the stimulus-reactive EBP to form a self-assembled nanostructure of micelle structure (FIG. 2A).

The stimulus-reactive fusion polypeptide is formed by the aggregation of the EBP block through the phase transition behavior of the EBP by thermal stimulation above the transition temperature of the stimulus-reactive EBP, and the amphipathic CCP block forms the shell structure, It is possible to form self-assembled nanostructures of the core-shell micelle structure (FIG. 2B).

In another aspect, the invention provides a hydrogel prepared by a process comprising the following steps:

Heat-stimulating the above-mentioned stimulus-reactive fusion polypeptide of the double block to prepare self-assembled nanostructures of the core-shell type micelle structure; And

Aggregating the prepared self-assembled nanostructures.

The hydrogel may be a reversible hydrogel in which CCP in the self-assembled nanostructures acts as a physical crosslinking agent.

In another aspect, the present invention provides a stimulatory reactive fusion polypeptide consisting of a triple block peptide as follows:

Coiled-coil forming peptide (CCP) blocks;

An elastin-based polypeptide (EBP) block having stimulatory reactivity linked to the CCP block; And

A coiled-coil forming peptide (CCP) block linked to the EBP block.

The stimulus is heat and can be expressed in temperature.

The description of the CCP block and the EBP block is as described above.

The triple block stimulatory reactive fusion polypeptide may be comprised of one of the amino acid sequences set forth in SEQ ID NOs: 68-85.

The stimulatory reactive fusion polypeptide of the triple block is in a viscoelastic liquid state below the transition temperature of the stimulatory reactive EBP; It may be a hydrogel above the transition temperature of the stimulus-reactive EBP.

The hydrogel may be a physically crosslinked hydrogel.

In another aspect, the invention provides a reversible hydrogel prepared by a process comprising the following steps using a triple block fusion polypeptide:

Applying thermal stimulation to the aforementioned stimulatory reactive fusion polypeptide of the triple block;

The thermal stimulation causes the EBP block in the stimuli reactive fusion polypeptide to thermally aggregate and the CCP block to act as a physical crosslinker to form a hydrogel.

As used herein, the term "coiled-coil forming peptide (s): CCP (s)" literally means a peptide that forms a coil-coil structure. It is a peptide known in the art. Coiled-coils have structural motifs that are common to native proteins, with two or more α-helix coils next to each other, forming dimers, trimers, or pentamers, and hydrophobic and ionic interactions between amino acid residues. Stabilized by The primary structure of the coiled-coil is characterized by a heptad sequence in which seven amino acid sequences are repeated. _N in (abcdefg) _n , which is the haptad sequence, refers to the number of repetitions. a and d are located hydrophobic amino acid residues and form a hydrophobic core. The e and g positions are charged residue (s) and contain ionic interactions. The helix structure is stabilized by this hydrophobic and ionic interaction (coil-coil interaction) (Non Patent Literature 1). Self-assembly of the coiled-coil domains allows for internal and crosslinking between them and forms a network, which can be switched on / off in coil formation while controlling external factors such as the pH and temperature of the solution.

The term "elastin-based polypeptide (EBP)" is also called "ealstin-like polypeptieds (ELP)". It is a term widely used in the technical field of the present invention.

In general, the physicochemical properties of EBPs are mostly controlled using a combination of pentapeptide repeat units Val-Pro- (Gly or Ala) -X _aa -Gly. In the present invention, a combination of Ile-Pro- (Gly or Ala) -X _aa -Gly was also used by substituting Val as the first amino acid. Physicochemical properties of EBP are mainly controlled by the combination of pentapeptide repeat units (Val or Ile) -Pro- (Gly or Ala) -X _aa -Gly.

In this specification, Xaa is referred to as a "guest residue". Various kinds of EB may be introduced to prepare various kinds of EBPs according to the present invention.

The EBP undergoes a reversible phase transition at lower critical solution temperature (LCST), also referred to as transition temperature (T _t ). These have large water solubility below T _t , but become insoluble when the temperature exceeds T _t .

Specifically, the third amino acid of that repeat unit determines the relative mechanical properties. For example, in the present invention, Gly, the third amino acid, determines elasticity, or Ala, determines plasticity. Specifically, Val-Pro-Gly-X _aa -Gly, the third amino acid is Gly, is an elastin-based polypeptide with elasticity (EBPE), and Val-Pro-Ala-, the third amino acid is Ala. X _aa -Gly is an elastin-based polypeptide with plasticity (EBPP). The elasticity or plasticity is a property that appears after the transition. In particular, EBPP consisting of Ile-Pro-Ala-X _aa -Gly replaced with Ile instead of Val in the pentapeptide repeat sequence of EBPP is defined as EBPPI (EBPP with Ile) with increased hydrophobicity.

On the other hand, both the hydrophobicity of the guest residue X _aa and the multimerization of the pentapeptide repeating unit, which are the fourth amino acids, affect T _t .

The unique combination of repeat pentapeptides, various EBPs and T _t and their block polypeptides with unique physicochemical properties can be prepared and stimulated to make micelles or hydrogels.

The EBP according to the present invention may be a polypeptide in which a pentapeptide is repeated, and the repeated polypeptide may form a polypeptide block (EBP block). Specifically, hydrophilic EBP blocks or hydrophobic EBP blocks can be formed. The hydrophilic or hydrophobic nature of the EBP block of the present invention is highly related to the transition temperature of EBP.

The transition temperature of EBP also depends on the amino acid sequence and its molecular weight. For the correlation of the sequence and T _t EBP relationship was carried out a number of studies such as Urry (Urry DW, Luan C.-H., Parker TM, Gowda DC, Parasad KU, Reid MC, and Safavy A. 1991. Temperature of polypeptide inverse temperature transition depends on mean residue hydrophobicity.J. Am. Chem. Soc. 113: 4346-4348.). Urry et al. In the pentapeptides of Val-Pro-Gly-Val-Gly, when the fourth amino acid "guest residue" is substituted with a residue that is more hydrophilic than Val, T _t rises compared to the original sequence, and conversely, hydrophobic than Val. Substitution of the guest residue with the residue found that T _t was lower than the original sequence. That is, it was found that EBP having hydrophilic amino acids as guest residues had a relatively high T _{t and} that EBP having hydrophobic amino acids as guest residues had a relatively low T _t . This finding enabled us to determine which amino acids to use as guest residues in the EBP sequence and to change the composition ratio of the guest residues to produce EBPs with specific T _t (Protein-Protein Interactions: A Molecular Cloning Manual , 2002, Cold Spring Harbor Laboratory Press, Chapter 18. pp. 329-343).

The EBP indicating, the EBP showing a relatively high T _t hydrophilicity greater of the guest residues through the regulation of the mole fraction of amino acids constituting the guest moiety, or relatively hydrophobicity of the guest residue large, low T _t, as described previously It can manufacture. EBP blocks according to the present invention can also raise or lower T _t by changing the amino acid sequence and molecular weight comprising the guest residue.

The term "amino acid" used in the present invention means a natural "amino acid" or "artificial" amino acid, preferably means a natural "amino acid. For example, the amino acid refers to glycine, alanine, serine, valine, leucine, isoleucine, threonine, methionine, glutamine, asparagine, cysteine, lysine, histidine, aspartic acid, glutamic acid, phenylalanine, arginine, tyrosine, or tryptophan.

As used herein, abbreviations such as Gly (G) and Ala (A) are amino acid abbreviations. Gly stands for glycine and Ala stands for alanine. Glycine is also expressed as G and alanine is also expressed as A. The abbreviation is a widely used expression in the art.

The nature of these amino acids is well known in the art. Specifically, it shows hydrophilicity (negative or positive charge) or hydrophobicity.

In the present invention, "hydrophilic amino acid" is an amino acid exhibiting hydrophilic properties, such as lysine, arginine and the like.

In addition, "hydrophobic amino acid" is an amino acid showing hydrophobic properties, such as phenylalanine, leucine and the like.

Neutral polar amino acids include serine, threonine, asparagine and glutamine, and negatively charged acidic amino acids include aspartic acid and glutamic acid, and positively charged basic amino acids include arginine and lysine.

The term "polypeptide" as used herein refers to any polymer chain of amino acids. The terms "peptide" and "protein" are interchangeable with the term "polypeptide", which also refers to a polymer chain of amino acids. The term "polypeptide" includes "polypeptide" analogs of natural or synthetic proteins, protein fragments and protein sequences. The polypeptide may be a monomer or a polymer.

The term "phase transition" means that the state of a substance changes, such as when water turns into water vapor or ice turns into water.

As used herein, "stimulatory reactive fusion polypeptide" refers to a fusion polypeptide whose shape or property changes in response to a stimulus. In the present invention, the stimulus may be heat (temperature).

Applying heat to the stimulatory reactive fusion polypeptide of the present invention, i.e., increasing the temperature, changes the shape of the fusion polypeptide and its properties (solid or liquid).

The peptide constituting the stimulatory reactive fusion polypeptide of the present invention is composed of a CCP block and an EBP block. As used herein, the double block means that the polypeptide constituting the CCP and the polypeptide constituting the EBP are linked to each other, and may also be referred to as "CCP-EBP" or "CCP-EBP double block". EBP is also referred to as EBPP (plastic EBP) or EBPE (elastic EBP). Another term triple block refers to a polypeptide in which a polypeptide constituting CCP and a polypeptide constituting EBP are linked in the order of “CCP-EBP-CCP”. Sometimes referred to as "CCP-EBP-CCP" or "CCP-EBP-CCP triple block".

In the present invention, although described as CCP or EBP, a plurality of concepts (CCPs or EBPs) are included. Self-assembled nanostructures, micelles, hydrogels are also expressed in the singular, but include a plurality of concepts.

The present invention is directed to new synthetic polypeptides. The polypeptide of the present invention can self-assemble to form nanostructures such as micelles or hydrogels with multi-responsiveness and can be applied to biomedical products.

The present invention has developed a fusion polypeptide having unique properties by combining CCP and heat reactive EBP. The CCP block is as follows. De novo design (Bojana Apostolovic, Maarten Danial, and Harm-Anton Klok, Coiled coils: attractive protein folding motifs for the fabrication of self-assembled, responsive and bioactive materials, Chemical Society Reviews, 2010, 2010, 39, 3541-3575) Four types of coiled-coil forming sequences with two homo and two hetero oligomerization states were designed (Tables 3 and 4).

Homo oligomer CCP (CCP [homo A] / CCP [homo B] of Tables 3 and 4) has the property of binding only the magnetic CCPs to form a coiled-coil. In contrast, hetero oligomer CCPs (CCP [hetero A] / CCP [hetero B] in Tables 3 and 4) have the property of binding to other CCPs to form coiled-coils (Bojana Apostolovic, Maarten Danial, and Harm-Anton). Klok, Coiled coils: attractive protein folding motifs for the fabrication of self-assembled, responsive and bioactive materials, Chemical Society Reviews, 2010, 2010, 39, 3541-3575). Specifically, in the case of the homo oligomer, since the positively and negatively charged amino acids coexist per coiled-coil repeating unit, intramolecular or intermolecular homo CPPs may form a bond by themselves. In contrast, since the hetero oligomer has only positive or negative charges per coiled-coil repeating unit, it can be bonded only when it encounters a hetero CCP having a different charge.

CCP can be used as a physical crosslinker to design triblock polypeptides of the ABA type. A of ABA forms a coiled-coil with CCP to serve as a physical crosslinker, and B may be a random block, a polypeptide, or a polyelectrolyte. In the present invention, a polypeptide, ie, EBP, was used.

In an embodiment of the invention, a double block was made by fusing a homo oligomer CCP to the C terminus of EBP. As shown in FIG. 2A, below the transition temperature (T _t ) of the EBP, the EBP of the fusion polypeptide of the present invention is water soluble and forms self-assembled nanostructures with the coiled-coil interaction of the CCP. 2B, above the transition temperature of EBP, EBP forms a core by thermal aggregation and CCP forms a shell to form a micelle self-assembled nanostructure. These self-assembles aggregate by the coiled-coil interaction of the CCP to form a hydrogel. At this time, homo-oligomer CCP or hetero-oligomer CCP that can be combined with different coils can be used.

In the present invention, the term "hydrogel" means a material having a three-dimensional hydrophilic polymer network structure that can generally contain a large amount of water, and it is thermodynamically stable after swelling in an aqueous solution and thus is a liquid and a solid. It has mechanical and physicochemical properties corresponding to its intermediate form.

In the present invention, the fusion polypeptide employs the self-assembly of CCP and the stimulation (eg, thermal) reactivity of EBP. CCP in the fusion polypeptide of CCP-EBP or the fusion polypeptide of CCP-EBP-CCP can act as a physical crosslinker to form a hydrogel. Below the transition temperature of EBP, only the coiled-coil interaction of the fusion polypeptide of the present invention is involved in the self-assembly of the network. As the transition temperature of EBP increases, aggregation occurs due to EBP hydrophobic change. Coiled-coil interactions turn into stronger physical crosslinks and form hydrogels (FIG. 3).

The present invention provides a reversible hydrogel. The fusion polypeptide of the present invention exhibits phase change behavior with temperature change by EBP with stimulatory reactivity. In other words, the hydrogel is not formed at a low temperature below the transition temperature, but the hydrogel is formed above the transition temperature, and if the temperature is lowered again, the hydrogel is not formed.

Reversible hydrogels according to the present invention are useful in injectable drug delivery systems, functional tissue engineering and regenerative medicine.

The fusion polypeptides according to the invention are capable of physical crosslink formation at temperatures above the biological environment, ie at temperatures above the transition temperature. Thus, hydrogels using the fusion polypeptides according to the present invention are protein-based reversible hydrogels with stimulatory reactivity, suitable for biomaterial injection.

Hydrogels according to the present invention have been developed for use in injectable biomaterials for drug delivery storage, tissue engineering scaffolds, fillers in regenerative medicine and the like.

In another aspect, the present invention provides a drug delivery composition comprising a hydrogel made from the above-mentioned double block and triple block stimulatory reactive fusion polypeptides; And support for tissue engineering.

The scaffold for tissue engineering according to the present invention includes all the scaffolds that can be used in the field of tissue engineering aimed at maintaining, improving or restoring the function of the body by making and transplanting a substitute for living tissue. .

In another aspect, the present invention provides a kit for tissue or organ regeneration comprising a hydrogel made of the above-mentioned double block and triple block stimulatory reactive fusion polypeptides.

Tissue or organ regeneration kit according to the present invention, in addition to the support for tissue engineering, a reinforcing layer for maintaining the shape of the support may be added. The reinforcing layer may be selected from biodegradable polymer materials such as PCL, PLA, PLGA, PGA.

Triple-block polypeptides of the ABA type were designed to act as hydrogels by fusing CCP, a physical crosslinker, on either side of the EBP. At low temperatures (below the EBP transition temperature), the triple block polypeptide (CCP-EBP-CCP) is in a highly elastic liquid state due to the interaction between the molecules in the coiled-coil and the molecules, and the transition temperature of the intermediate EBP block. The foregoing provides strong physical crosslinking of aggregated EBP blocks by thermal stimulation with coiled-coil interaction to turn into a viscoelastic solid. This physical crosslinking is enhanced by the chain length change of the CCP and the state of interaction between the homo oligomer CCP and the hetero oligomer CCP. In addition, as the length of the CCP chain increases, hydrophobic and ionic interactions enhance crosslinking. In order to eliminate the interactions that lead to the formation of loops inside some molecules that are not bridges, especially when forming intermolecular networks in hydrogels, we designed hetero oligomers to enhance the interactions between molecules. The interaction between the molecules of the hetero oligomer allows for stronger crosslinking with the intermediate EBP block above the EBP transition temperature to form a stronger hydrogel.

The fusion polypeptide of the present invention consists of self-assembled CCP and thermally reactive EBP and can enhance the mechanical properties of the physically crosslinked hydrogel. Below the T _{t of the} EBP, only coiled-coil interactions are involved in the self-assembly of the network. The increased T _t of the EBP causes the aggregation of the EBP to occur so that the coiled-coil interaction is stronger. Turns into physical crosslinking. Physically crosslinked hydrogels using such enhanced mechanical properties will be able to control the functionality of the biomaterial. And the fusion polypeptide of the present invention can be used for drug delivery, tissue engineering and regenerative medicine.

The stimulatory reactive fusion polypeptides of the present invention provide the effect of forming reversible self-assembled nanostructures and hydrogels. In addition, the fusion polypeptide of the present invention can be used for drug delivery, tissue engineering and regenerative medicine.

Figure 1 schematically illustrates the CCP single, double and triple block polypeptide gene cloning process: A) Modification of pET-21a (+) to allow insertion of adapters with AcuI and BseRI restriction sites to perform RDL box. CCP nucleic acid cassette inserted into modified pET-21a (+) digested with XbaI and BseRI. B) Multimerization of CCP genes with RDL. The vector is linearized by XbaI and BseRI cleavage and cleaved into XbaI and AcuI for gene insertion. After ligation, repeat the same process until the desired gene length is achieved. C) Seamless cloning for the preparation of double and triple block polypeptides. Double block polypeptide synthesis by inserting the EBPP gene (cut with XbaI and AcuI) into the CCP gene containing plasmid (linearized with XbaI and BseRI). The next step was to insert the CCP gene (cut with XbaI and AcuI) into a double block containing plasmid (linearized with XbaI and BseRI) to triple-block polypeptide synthesis of CCP-EBPP-CCP.
Figure 2 schematically illustrates the self-assembly process of EBPP-CCP double block polypeptide: A) EBPP-CCP double block polypeptide with homo oligomer, below the transition temperature of EBPP, CCP is coiled-coil Action to form a core, EBPP is water-soluble and acts as a shell. B) Two EBPP-CCP double block polypeptides with hetero oligomers each form micelles above the transition temperature of EBPP due to aggregation of EBPP and hydrophilic properties of hetero oligomer CCP. When these two types of double block polypeptides are mixed, the coiled-coil interaction between the CCP heterooligomeric molecules and the CCP can act as a physical crosslinker between the EBPP blocks, forming a hydrogel.
Figure 3 schematically shows the self-assembly process of the triple block polypeptide of CCP-EBPP-CCP: A) is a short CCP chain consisting of homo oligomers, B) is a longer CCP chain. At temperatures below the EBPP transition temperature, the EBPP is water soluble and self-assembles into a loosely coupled network created by the coiled-coil interaction of the CCP. Above the transition temperature of EBPP, loosely connected networks can form reversible hydrogels by thermal coagulation of the intermediate block, EBPP. C) shows CCP-EBPP-CCP triple block polypeptide with heteroA and heteroB. When these two types of triple block polypeptides are mixed, they form physically crosslinked hydrogels by coiled-coil interactions between heterooligomers. The coiled-coil interactions of these hetero oligomers can eliminate loop formation by their intramolecular interactions. Loosely connected networks form hydrogels with high mechanical properties by thermal coagulation and physical crosslinking of EBPP above the transition temperature of EBPP.
4 is agarose gel electrophoresis photographs of all CCP genes cloned by RDL: A) CCP [homoA]_n, B), CCP [homoB]_n, C) CCP [heteroA]_n, D) CCP [heteroB]_n. Lane M is the size marker and the number of haptads for each CCP is shown above, the left side is the gene size marker and their gene size is shown on the right.
Figure 5 is agarose gel electrophoresis picture of EBPP-CCP double block and CCP-EBPP-CCP triple block gene cloned by RDL. A) biblock polypeptide and lane 1) EBPP [G_OneA₃F₂]₆-CCP [homoA]₂Lane 2) EBPP [G_OneA₃F₂]₆-CCP [homoA] ₄ Lane 3) EBPP [G_OneA₃F₂]₁₂-CCP [homoA]₂Lane 4) EBPP [G_OneA₃F₂]₁₂-CCP [homoA]₄. B) triple block polypeptide, lane 1) CCP [homoA]₂ -EBPP [G_OneA₃F₂]₆-CCP [homoA]₂, Lane 2) CCP [homoA]₄ -EBPP [G_OneA₃F₂]₆-CCP [homoA]₄, Lane 3) CCP [homoA]₂ -EBPP [G_OneA₃F₂]₁₂-CCP [homoA]₂, Lane 4) CCP [homoA]₄ -EBPP [G_OneA₃F₂]₁₂-CCP [homoA]₄. The gene size of the marker is shown on the left, and the gene size of each block is shown on the right.
FIG. 6 is a copper stained SDA-PAGE (12%) gel image of ITB purified EBPP-CCP biblock and triblock polypeptides: A) with biblock polypeptide, lane 1) EBPP [G_OneA₃F₂]₆-CCP [homoA]₂Lane 2) EBPP [G_OneA₃F₂]₆-CCP [homoA]₄Lane 3) EBPP [G_OneA₃F₂]₁₂-CCP [homoA]₂Lane 4) EBPP [G_OneA₃F₂]₁₂-CCP [homoA]₄. B) triple block, lane 1) CCP [homoA]₂ -EBPP [G_OneA₃F₂]₆-CCP [homoA]₂, Lane 2) CCP [homoA]₄ -EBPP [G_OneA₃F₂]₆-CCP [homoA]_4.Lane M is the size marker and the gene size of the marker is on the left and the molecular weight of each block is on the right.
7 shows EBPP [G_OneA₃F₂]_n Thermal profile of EBPP single block, double block and triple block using the library. A) EBPP [G_OneA₃F₂]₆Single Block and CCP [homoA]_One,CCP [homoA]₂or CCP [homoA]₄Double block having a. B) EBPP [G_OneA₃F₂]₁₂Single Block and CP [homoA]₂or CCP [homoA]₄Double block having a. C) CCP [homoA]₂-EBPP [G_OneA₃F₂]₆-CCP [homoA]₂ And CCP [homoA]₄-EBPP [G_OneA₃F₂]₆-CCP [homoA]₄Triple block of. D) EBPP [G, a double block polypeptide at 15 C]_OneA₃F₂]₆-CCP [homoA]_One, EBPP [G_OneA₃F₂]₆-CCP [homoA]₂, EBPP [G_OneA₃F₂]₆-CCP [homoA]₄Dynamic light scattering (DLS).
8 shows EBPPI [G_OneA₃F₂]₆ Electrophoresis picture of the triple block polypeptide using the library: A) Agarose gel and B) Copper staining SDS-PAGE (15%). M is the size marker and the expected size of each block is shown on the right. Lane 1) CCP [homoA]₂-EBPP [G_OneA₃F₂]₆-CCP [homoA]₂; Lane 2) CCP [homoA]₄-EBPP [G_OneA₃F₂]₆-CCP [homoA]₄ And lane M) size markers.
9 shows EBPPI [G in 10 mM PBS, pH 7.4)._OneA₃F₂]₆ Thermal profile of triblock polypeptides using libraries: A) and B) in turn are CCP [homoA]₂-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₂ And CCP [homoA]₄-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₄Is a concentration-dependent heat profile. C) and D), in turn, have a CCP [homoA] at 25 uM concentration.₂-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₂ And CCP [homoA]₄-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₄The effect of the factor on the concentration is shown.
10 shows A) CCP [homoA] at 10C.₂-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₂ B) CCP [homoA]₄-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₄Is the size measurement result. The size was measured at 25 uM in PBS, PBS with 8 M Urea, PBS with 6 M GndCl. Samples were equilibrated at 10 C for 10 minutes before measurement.
FIG. 11 shows vibrational rheology measurements of triple block polypeptides using a library at 30 wt% of 10 mM PBS (pH 7.4). A) and B) in turn, at 4 C and 37 C (g 2%), CCP [homoA]₂-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₂ And CCP [homoA]₄-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₄Is the result of the frequency sweep test. C) and D) in turn, CCP [homoA]₂-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₂ And CCP [homoA]₄-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₄Of 1^oTemperature dependent rheology measurement at C / min heating rate, E) and F) are CCP [homoA]₂-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₂ And CCP [homoA]₄-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₄Of 1^oTemperature dependent rheological measurements at C / min cooling rate (g 2%, 1 rad / s).
FIG. 12 shows the effect of factors on the vibrational rheology measurement of triblock polypeptides. A) and B) were in turn CCP [homoA] using 10 mM PBS (pH 7.4) containing 4 C, 2 M urea₂-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₂ And CCP [homoA]₄-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₄The frequency sweep test result of (γ 2%). C) and D), in turn, are CCP [homoA]₂-EBPI [G_OneA₃F₂]₆ -CCP [homoA]₂ And CCP [homoA]₄-EBPPI [G_OneA₃F₂]₆ -CCP [homoA]₄ Temperature sweep test results using PBS with 2M urea at a heating rate of 1 ° C / min (γ 2%, 1 rad / s).
FIG. 13 is a photographic image showing reversible sol-gel transition of a fusion polypeptide according to one embodiment of the present invention. FIG.

Example 1: Material

Novagen Inc. PET-21a vector and BL21 (DE3) E. coli cells were purchased from (Madison, WI, US). Top 10 competent cells were purchased from Invitrogen (Carlsbad, CA, US). Oligonucleotides were chemically synthesized by Cosmo Gene Tech (Seoul, South Korea). Fermentas (Ontario, Canada) purchased a thermosensitive alkaline phosphatase FastAP and a restriction endonuclease comprising BamHI and XbaI. Other restriction endonucleases were obtained from New England Biolabs (Ipswich, MA, US), including BseRI, AcuI, and other restriction enzymes. T4 DNA ligase was obtained from Elpis Bio-tech (Taejeon, South Korea). All kits for DNA mini-preparation, gel extraction, and PCR purification were obtained from Geneall Biotechnology (Seoul, South Korea). Dyne Agarose High for agarose gel electrophoresis was obtained from DYNE BIO (Seongnam, South Korea). All Top 10 cells were grown in TB DRY culture (MO BIO Laboratories, Carlsbad, Calif., US) and plated in SOC (Formedium, UK) solid medium after cloning. All BL21 (DE3) cells were grown in Circle Grow (Solon, OH, US) purchased from MP Biomedicals. Phosphate buffered saline (PBS, pH 7.4), ampicillin for SDS-PAGE was purchased from Sigma-Aldrich (St Louis, MO).

Example 2: Notation for Different EBP Blocks and Their Fusion Polypeptides

Different EBPs with pentapeptide repeating units Val-Pro- (Gly or Ala) -X _aa -Gly [VP (G or A) XG] are named as follows. The X _aa may be any amino acid except Pro. First, the pentapeptide repeat of the plastic Val-Pro-Ala-X _aa- Gly (VPAXG) is defined as the plastic elastin-based polypeptide with plasticity (EBPP). Meanwhile, the pentapeptide repeat of Val-Pro-Gly-X _aa- Gly (VPGXG) is called the elastin-based polypeptide with elasticity (EBPE). Second, in [X _i Y _j Z _k ] _n , the capital letters in parentheses are the short-term amino acid code of the guest residue, ie, the amino acid at position 4 (X _aa or X) of the EBP pentapeptide, Subscripts represent the ratio of guest residues in the EBP monomer gene as repeat units. Subscript number n of [X _i Y _j Z _k ] _n denotes the total number of iterations of EBP of SEQ ID NO: 1 [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG] or SEQ ID NO: 2 [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG] Indicates. For example, EBPP [G ₁ A ₃ F ₂ ] ₁₂ is an EBPP block consisting of 12 repeating units of SEQ ID NO: 2 [VPAXG VPAXG VPAXG VPAXG VPAXG], wherein at the fourth guest residue position (X _aa ) The ratio of Gly, Ala, and Phe is 1: 3: 2.

Four CCPs were de novo designed with two homo and two hetero oligomers (Bojana Apostolovic, Maarten Danial, and Harm-Anton Klok, Coiled coils: attractive protein folding motifs for the fabrication of self-assembled, responsive and bioactive materials , Chemical Society Reviews, 2010, 2010, 39, 3541-3575). Each CCP consists of three haptads. The second and third haptads of each CCP are similar, while the first CCP has a different "f" position. the f position was replaced with Glycine. The reason for this is to insert the CCP gene into the vector system of the present invention for seamless cloning of the fusion polypeptide according to the present invention. The two homo oligomers are represented by Homo A (SEQ ID NO: 45) and Homo B (SEQ ID NO: 46) and differ in the three amino acid constructs at positions "a", "c", and "g". In contrast, hetero oligomers are represented by hetero A (SEQ ID NO: 47) and hetero B (SEQ ID NO: 48) and differ in four amino acid configurations at the positions "a", "c", "e", and "g". _N in CCP [homo / hetero] _n represents the total number of repetitions of SEQ ID NO: 45 or 46 or 47 or 48. The double block of CCP-EBP and the triple block of CCP-EBP-CCP marked hyphens between EBP and CCP and indicated the EBP composition. For example, EBPP [G ₁ A ₃ F ₂ ] _n -CCP [homo / hetero] _n is a double block and CCP [homo / hetero] _n -EBPP [G ₁ A ₃ F ₂ ] _n -CCP [homo / hetero] _n is a triple block.

Example 3: Preparation of Modified pET-21a (+) Vector for Seamless Gene Cloning

pET-21a (+) was modified to introduce BseRI and AcuI restriction sites for recursive directional ligation (RDL) of EBP and CCP genes. Vectors were prepared by double digestion of 50 U XbaI, 50 U BamHI in FastDigest buffer for 30 minutes at 37 ° C., and the 5 ′ ends were removed with 10 U CIP in NEB buffer for 1 hour at 37 ° C. Phosphorylation. Restriction vectors were purified using a PCR purification kit. Two oligonucleotides with XbaI and BamHI sticky ends and BseRI and AcuI restriction sites, ie, SEQ ID NO: 49 (5'- ctagaaataattttgtttaactttaagaaggaggagtacatatgggctactgataatgatcttcag -3 '') and SEQ ID NO: 50 (5'- gatcctgaagatcattatcagttactac Was designed. This oligonucleotide DNA contains a Tyr and a start codon and a stop codon for spectrophotometric detection of the protein. Two oligonucleotides were annealed by heating 50 μL of 2 μM oligonucleotide concentration in T4 DNA ligase buffer at 95 ° C. for 2 minutes and then the solution was slowly cooled to room temperature over 3 hours. XbaI and BamHI into linearized pET-21a (+) vectors by incubating 20 pmol of annealed dsDNA and 0.1 pmol of linearized vector in T4 DNA ligase buffer with 1 U of T4 DNA ligase at 30 ° C. for 30 minutes. A modified cloning insert with a sticky end was inserted. The ligation product was transformed into chemical E. Coli Top 10 recipient cells and applied on super optimal broth with catabolite repression (SOC) plates supplemented with 50 μg / ml ampicillin. The size of the insert was restricted to XbaI and BamHI, then checked by agiros gel electrophoresis and the sequence was confirmed by DNA sequencing.

Example 4: EBP and CCP Monomer Gene Synthesis and Oligomerization thereof

EBP sequences with the pentapeptide repeat units (Val or Ile) -Pro- (Gly or Ala) -X _aa -Gly, whose fourth residues vary in different molar ratios, are designed at the DNA level to produce T _t below the physiological temperature. Optimized. For the 19 EBP libraries, the DNA and amino acid sequences of EBPs with various pentapeptide repeat units are shown in Tables 1 and 2, respectively.

TABLE 1

Gene sequence of the EBP library. Plastic EBP (EBPP) with pentapeptide repeats of Val-Pro-Ala-X _aa -Gly; And elastic EBP (EBPE) with pentapeptide repeats of Val-Pro-Gly-X _aa -Gly all replicated to have the same guest residue composition and ratio. EBPPI with pentapeptide repeats of Ile-Pro-Ala-X _aa -Gly was designed.

TABLE 2

Amino acid sequence of the EBP library

The pentapeptide repeat unit (Val or Ile) -Pro- (Gly or Ala) -X _aa -Gly, where X _aa can be any amino acid except Pro, has a unique stimulatory reactivity including temperature and pH. Different EBPs were designed at the DNA level. EBP with plasticity (EBPP) with a pentapeptide repeat that is Val-Pro-Ala-X _aa -Gly and elastic EBPE with a pentapeptide repeat that is Val-Pro-Gly-X _aa -Gly ( EBP with elasticity (EBPE), all were cloned to have the same guest residue composition and proportions. Table 1 and Table 2 show gene and amino acid sequences of different EBPs each having a pentapeptide repeat unit. For example, EBPE [G ₁ A ₃ F ₂ ] ₁₂ and EBPP [G ₁ A ₃ F ₂ ] ₁₂ have almost identical molar masses, as well as combinations where the fourth residues of the EBP pentapeptide repeat units are identical. Indicates. And due to different third amino acid residues (Ala or Gly) of the pentapeptide repeating unit, they have different mechanical properties. Positive and negatively charged EBPs were constructed by introducing charged amino acids such as Lys, Asp, Glu, and His into the guest residues. To determine if the first amino acid (Val or Ile) of the repeating unit sequence affects thermal reactivity and hydrogel formation above the transition temperature, Ile-Pro-, a new pentapeptide repeating unit starting with Ile rather than starting with Val A new EBPPI library with Ala-X _aa -Gly was constructed.

For each pair of oligonucleotides encoding various EBPs, 50 μL of each of the two oligonucleotides (2 μM each) was heated in T4 DNA ligase buffer for 2 minutes at 95 ° C., and then the reaction The solution was annealed by slowly cooling at room temperature over 3 hours. A total of 4 μg of modified mpET-21a replication vector was digested and dephosphorylated with 15 U BseRI and 10 U FastAP thermal alkaline phosphatase for 30 minutes at 37 ° C. The restriction enzyme treated plasmid DNA was purified using a PCR purification kit and then eluted in 40 μL of distilled deionized water. 90 pmol of annealed dsDNA and 30 pmol of linearized mpET-21a replication vector at 16 ° C. for 30 minutes were incubated in T4 DNA ligase buffer with 1 U of T4 DNA ligase to a specific position in the pET-21a vector. The ligation of the DNA insert was carried out. The ligation reaction plasmids were transformed into Top10 chemical receptor cells, which were then applied onto SOC plates supplemented with 50 μg / ml ampicillin. Then, the DNA sequence was confirmed by DNA sequencing. All EBP monomer genes were constructed. Vectors containing copies of the genes of the unit EBP were digested and dephosphorylated with 10 U of XbaI, 15 U of BseRI, and 10 U of FastAP thermal alkaline phosphatase in Cutsmart buffer for 30 minutes at 37 ° C. Restricted plasmid DNA was purified using a PCR purification kit and then eluted in 40 μL of distilled deionized water. To prepare insert parts, a total of 4 μg of EBP monomer genes were digested with 10 U of XbaI and 15 U of AcuI in Cutsmart buffer for 30 minutes at 37 ° C. After digestion, the reaction products were separated by electrophoresis using agarose gel and the inserts were purified using a gel extraction kit. The ligation reaction was performed by incubating 90 pmol purified insert with 30 pmol linearized vector with 1 U of T4 DNA ligase at 16 ° C. in T4 DNA ligase buffer for 30 minutes. The product was transformed into Top10 chemical receptor cells, which were then plated on SOC plates supplemented with 50 μg / ml ampicillin. Transformants were initially screened by diagnostic restriction digests in agarose gel electrophoresis results treated with restriction enzymes after culture and gene extraction, and further confirmed by DNA sequencing as described above.

The CCP monomer gene preparation was as follows: Each pair of oligonucleotides encoding four CCP genes was heated at 95 ° C. for 2 minutes at 50 μL of an oligonucleotide concentration of 2 μM in T4 DNA ligase buffer over 3 hours. It was slowly cooled to room temperature and annealed. The resulting dsDNA product is nonpalindromic, 2 bp, 3 'overhang. For vector preparation, a total of 4 μg of modified pET-21a vector was digested with 15 U BseRI in FastDigest buffer for 30 minutes at 37 ° C. The restriction vector was purified using a PCR purification kit and then eluted in 40 μL of distilled deionized water. DNA with linearized modified pET-21a vector by incubating 30 pmol of linearized pET-21a vector with 30 pmol of linearized pET-21a vector at 16 ° C. for 30 minutes in T4 DNA ligase buffer with 1 U of T4 DNA ligase. Inserts were inserted. The ligation products were transformed into Top10 chemical receptor cells, which were then applied onto SOC plates supplemented with 50 μg / ml ampicillin. Transformants were initially screened by agarose gel electrophoresis treatment with restriction enzymes after culture and gene extraction, and DNA sequences were confirmed by DNA sequencing. CCP monomer genes were synthesized and each CCP gene was multimerized up to 24 haptads. To prepare the insert, a total of 4 μg of vector containing CCP monomer genes was double digested with 10 U BseRI and 15 U AcuI in Cutsmart buffer for 30 min at 37 ° C. After digestion, the reaction products were separated by electrophoresis using agarose gel and the inserts were purified using a gel extraction kit. The ligation reaction was performed by incubating 90 pmol purified insert with 30 pmol linearized vector (limited to BseRI) with 1 U of T4 DNA ligase at 16 ° C. in T4 DNA ligase buffer for 30 minutes. The product was transformed into Top10 chemical receptor cells, which were then plated onto SOC plates supplemented with 50 μg / ml ampicillin. Transformants were initially screened by agarose gel electrophoresis results treated with restriction enzymes after culture and gene extraction and further confirmed by DNA sequencing as described above.

Four types of CCPs were designed using homo and hetero oligomers to fuse with EBP. In all CCPs, "a" and "d" were chosen as hydrophobic amino acids, so that the polypeptide would be better at coiled-coil formation, so that ionic interactions would occur more stably, "e" and " g "selects a charge residue. A charge amino acid was introduced at "c" to increase reactivity, and Ala was introduced at position "b" so that helix can be formed well. A polar amino acid "Gln" was introduced at position "f" exposed to a solvent. Helix forms better than other polar amino acids (Wayne D. Kohn and Robert S. Hodges, De novo design of a-helical coiled coils and bundles: models for the development of protein-design principles, Trends in Biotechnology, 1998 , 16, 379-389).

The "f" position of the first haptad was modified to introduce Gly between the CCP genes of the vector system. Nucleic acid and amino acid sequences of all CCPs are shown in Tables 3 and 4, respectively. The CCP nucleic acid cassette consists of three haptades, which is the minimum number for stable coiled-coil interaction.

TABLE 3

Gene sequence of CCP

TABLE 4

Amino acid sequence of CCP

First, homo oligomers were fused with EBP to form self-assembled nanostructures. FIG. 2A shows a double block polypeptide with a molecular design of EBPP [G ₁ A ₃ F ₂ ] _n -CCP [homoA / homoB] _n , which self-assembles below the transition temperature of EBP to form nanostructures. CCP fuses with EBPP at the C-terminus of EBPP [G ₁ A ₃ F ₂ ] _n and forms a coiled-coil at low temperatures (below the transition temperature) and EBP is water soluble below the transition temperature. At low temperatures, nanostructure size can be controlled by varying the number of CCP haptards. 2B is a biblock polypeptide having a molecular design of EBPP [G ₁ A ₃ F ₂ ] _n -CCP [heteroA / heteroB] _n . Because of the thermal coagulation of EBPP above the transition temperature and the amphipathic nature of the CCP, these double blocks can form micelles. Mixing these double block polypeptides together can form a hydrogel by coiled-coil interactions between molecules.

To design self-assembling hydrogel constructs with stimulatory responsiveness, a triblock polypeptide in ABA form was designed. It can be used for tissue regeneration. CCP acts as a physical crosslinker. EBP with heat transfer properties was used to give stimulus responsiveness. 3A and 3B schematically show triple block polypeptides using haptades having different lengths, which self-assemble into physical cross-linking networks in response to temperature changes. The EBP block is in the middle, and the CCP blocks are fused at both ends of the EBP block to form a crosslinking network in and between molecules. The physical strength of the crosslinked network is further enhanced by the thermal reactivity of the EBP with thermal aggregation. 3C schematically depicts triblock polypeptides with hetero oligomers to enhance the interaction between molecules of a physical crosslinking gel. Each triple block polypeptide has the same CCP block at both ends, so that loop formation does not occur due to intramolecular interactions. Mixing the two triple block polypeptides shown in FIG. 3C results in interactions between molecules (coil-coil interactions) below or below the transition temperature of EBP and the network is relatively loose. However, when the temperature rises above the transition temperature, harder hydrogel is formed by thermal coagulation of EBP and crosslinking of CCPs hetero oligomers.

Gene cloning was performed to prepare single, double and triple block polypeptide genes of CCP. 1A is a modified pET21a (+) having an XbaI and BamHI sticky ends and introducing an adapter containing BseRI and AcuI sequences for recursive directional ligation (RDL). First, an adapter with XbaI and BamHI sticky ends is inserted into pET21a (+) and forms mpET21a (+) which is cleaved with XbaI and BamHI. In the second step, the CCP gene nucleic acid cassette is inserted into mpET21a (+) (FIG. 1B). 1C is a schematic diagram of EBP-CCP double block and CCP-EBP-CCP triple block polypeptide cloning. First, the EBPP gene is inserted into a CCP-containing plasmid to make an EBP-CCP double block polypeptide clone. The CCP gene is then inserted into an EBP-CCP double block to obtain a CCP-EBP-CCP triple block polypeptide.

To determine the effect of the coiled-coil length of CCP on double and triple block peptides, all CCP genes were multimerized up to 24 haptads. Desired gene length was checked with agarose gel and DNA sequence confirmed by sequencing. 4 shows the length of all CCPs cleaved with BamHI and XbaI. The length of CCPs containing adapters on agarose gels varied from 129 bp to 570 bp for each 3-24 haptad.

Example 4: Cloning, Purification and Characterization of Fusion Polypeptides

First, a double block fusion polypeptide of CCP-EBP was synthesized by inserting the EBP gene (cut with BseRI and AcuI) into a vector containing a coiled-coil sequence (restricted by BseRI). The triple block fusion polypeptide of CCP-EBP-CCP was synthesized by inserting the coiled-coil gene into the plasmid containing the synthesized EBP-CCP double block. All block lengths were digested with XbaI and Bam HI and screened by agarose gel electrophoresis to confirm by DNA sequencing.

To express the fusion polypeptide, the mpET-21a (+) vector, which contains double and triple blocks, respectively, was transformed with E. Coli BL21 (DE3). Single colonies were injected into 50 mL Circlegrow containing 50 μg / mL ampicillin in a 250 mL flask and incubated for 12 hours in a shaking incubator at 37 ° C. at 200 rpm. It was then injected into 500 mL Circlegrow containing 50 μg / mL ampicillin in a 2 L flask and subcultured for 8 hours in a shaking incubator at 37 to 200 rpm. Twenty ml each of the flasks incubated in 500 mL Circlegrow containing 50 μg / mL ampicillin in 24 2 L flasks each was incubated in a shaking incubator at 200 rpm at 37 ° C. and the absorbance value reached 1.0. When 1 mM of IPTG was injected. After 12 hours of incubation, the cultures were harvested and the fusion polypeptides were purified by ITC (inverse transition cycling). Cell pellets were resuspended in PBS and cell lysates were obtained by sonication in an ice bath (VC-505, Sonic and materials Inc, Danbury, CT). Cell debris was separated by centrifugation at 16000 rpm for 20 min at 4 ° C., aqueous lysates were transferred to a new tube and mixed well by addition of PEI solution to a final concentration of 0.5% (w / v). Nucleic acid contaminants were removed by centrifugation at 16000 rpm for 15 minutes at 4 ° C. NaCl salt was added to the final thickener 3-4 M to the PEI treated sample to trigger the phase transition of the fusion protein. Aggregated fusion proteins were separated by centrifugation at 16000 rpm for 20 minutes at 40 ° C. The aggregated fusion protein was resuspended in cold PBS solution and the sample was centrifuged at 16000 rpm for 15 minutes at 4 ° C. to remove remaining insoluble material. This aggregation and resuspension process was repeated 4-5 times until the purity of the fusion protein reached> 95%. Purity and molecular weight of the double and triple block polypeptides were analyzed by copper staining SDS-PAGE. Phase transition behavior of the fusion polypeptide was measured by UV / Vis spectrophotometer and dynamic light scattering (DLS). The 350 nm optical density (OD ₃₅₀ ) of each 25 μM solution of double and triple blocks of PBS was measured as a function of temperature with a heating rate of 1 ° C./min from 10 ° C. to 80 ° C. The transition temperature T _t is defined as the temperature at which the first derivative value d (OD ₃₅₀ ) / dT of turbidity as a function of temperature was maximum. DLS was performed to determine the hydrodynamic radius (R _h ) of double and triple blocks at a dispersion angle of 90 ° and at a specific temperature of 25 μM. At each temperature, the samples were equilibrated for 10 minutes prior to light dispersion.

To investigate the effects of the thermal response and coiled-coil interactions of EBPPs, CCPs [homo / hetero] with de novo designed CCPs, 3, 6, and 12 haptads were identified as EBPP [G ₁ A ₃ F ₂ ] _n And EBPPI [G ₁ A ₃ F ₂ ] _n . Tables 5 and 6 show the double blocks and expected molecular weights of EBPP-CCP [homo] and EBPP-CCP [hetero] of different lengths.

TABLE 5

Double Block Polypeptides of CCP-EBP. Homo oligomer CCP and EBPP [G ₁ A ₃ F ₂ ] _{6 & 12} combine to form micelles

TABLE 6

CCP-EBP Double Block Polypeptide. CCP heteromers combine with EBPP [G ₁ A ₃ F ₂ ] _{6, 12} to form micelles

Tables 7 and 8 show triple blocks and expected molecular weights of different lengths of CCP [homo] -EBPP-CCP [homo] and CCP [hetero] -EBPP-CCP [hetero].

TABLE 7

Triple Block Polypeptides of CCP [homo] -EBPP-CCP [homo]. CCP [homo] is fused at both ends of EBPP to form a physically crosslinked hydrogel.

  TABLE 8

Triple block polypeptide of CCP [hetero] -EBPP-CCP [hetero]. CCP [hetero] is fused at both ends of EBPP to form a physically crosslinked hydrogel.

5A and 5B show agarose gels of double and triple blocks, respectively, with EBPP [G ₁ A ₃ F ₂ ] _n and CCP [homoA] _n . The gene sizes shown on the right in the double block were 732, 858, 1272, and 1398 bp, were digested with XbaI and BamHI and confirmed the DNA sequence. Like the double block, the triple block was cloned into RDL and the gene sizes cut with XbaI and BamHI were 858, 1110, 1398 and 1650 bp. For polypeptide synthesis and purification, four double blocks and four triple blocks were transformed with BL21 (DE3) to express in E. coli and purified by ITC. This is a non-chromatographic method for purifying EBPs using the thermal transfer behavior of EBPs. Four double blocks and four triple blocks are:

Double block: EBPP [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₂ , EBPP [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₄ , EBPP [G ₁ A ₃ F ₂ ] ₁₂ - CCP [ _{homoA] 2, EBPP [G 1} A 3 F 2] 12 - CCP [homoA] 4,

Triple Block: CCP [homoA] ₂ -EBPP [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₂ , CCP [homoA] ₄ -EBPP [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₄ , CCP [homoA] ₂ -EBPPI [G ₁ A ₃ F ₂ ] ₁₂ - CCP [homoA] ₂ , CCP [homoA] ₄ -EBPP [G ₁ A ₃ F ₂ ] ₁₂ - CCP [homoA] ₄

FIG. 6A shows copper staining SDS-PAGE of a double block polypeptide of EBPP [G ₁ A ₃ F ₂ ] _n - CCP [homoA] _n , showing EBPP [G ₁ A ₃ F ₂ ] ₆ -CCP [homoA] ₂ and FIG. The molecular weights of EBPP [G ₁ A ₃ F ₂ ] ₁₂ -CCP [homoA] ₂ are similar to their expected molecular weights. On the other hand, EBPP [G ₁ A ₃ F ₂ ] ₆ -CCP [homoA] ₄ and EBPP [G ₁ A ₃ F ₂ ] ₁₂ -CCP [homoA] ₄ , which have a longer CCP, move on the SDS-PAGE. It wasn't. This seems to be due to strong coiled-coil interactions remaining after the SDS treatment and that the oligomerized CCP block stays on top of the gel without moving. As shown in FIG. 6B, the triple block polypeptide shows a similar pattern.

Thermal transfer of the fusion polypeptides of the invention was determined by turbidity profiling as a function of temperature at a heating rate of 1 ° C./min. The transition temperature T _t is defined as the temperature at which the first derivative of turbidity as a function of temperature was the maximum. 7A and 7B show double block polypeptides with EBPP single block and EBPP [G ₁ A ₃ F ₂ ] ₆ and EBPP [G ₁ A ₃ F ₂ ] ₁₂ at 25 uM PBS (10 mM, pH 7.4) Heat profile. Single block EBPP [G ₁ A ₃ F ₂ ] ₆ , EBPP [G ₁ A ₃ F ₂ ] ₁₂ are completely dissolved below T _t , and above LCST, rapid transition occurs due to thermal aggregation. On the other hand, EBPP-CCP double blocks form nanostructures by coiled-coil interaction at low temperatures (below transition temperature), and overall aggregation occurs above LCST of EBPP. The double block with EBPP [G ₁ A ₃ F ₂ ] ₆ shows the nanostructure formation more clearly, since the chain length of EBP may be important because EBP shows high water solubility at low temperature (below transition temperature). Shows that it can. As the CCP length increases from 3 to 12, the LCST decreases because the hydrophobic interaction increases as the CCP length increases, increasing the coiled-coil haptad. 7C is a thermal profile of a triple block with an EBPP single block and EBPP [G ₁ A ₃ F ₂ ] ₆ . 7D shows the R _h of the double block at low temperature. EBPP [G ₁ A ₃ F ₂ ] ₆ -CCP [homoA] _1, EBPP [G ₁ A ₃ F ₂ ] ₆ -CCP [homoA] ₂ and EBPP [G ₁ A ₃ F ₂ ] ₆ -CCP [homoA] ₄ The sizes of are 135, 161 and 201 nm, respectively. Nanostructure size is related to CCP length. If the length of the CCP block is small, the size of the nanostructure is small, and if the length of the CCP block is increased due to the increase in the number of haptads, the size of the nanostructure becomes large.

The hydrogel network was studied as an ABA-type triple block with EBPPI by replacing Val, the first amino acid of pentapeptide, with Ile. 8A and 8B are agarose by CCP [homoA] and purified by gel _{ITC 2 -EBPPI [G 1 A 3} F 2] 6 - CCP [homoA] 2 and _{CCP [homoA] 4 -EBPPI [G} 1 A 3 F 2 ] ₆ - shows the SDS-PAGE results of CCP [homoA] ₄ . Triple blocks with CCP [homoA] ₂ in SDS-PAGE shifted by the expected molecular weight. CCP [homoA] _4, on the other hand, moved higher than expected. This trend was similarly observed in double blocks with CCP [homoA] ₄ . The thermal behavior of the triple blocks was analyzed by measuring the absorbance at 350 nm at a heating rate of 1 ° C./min. 9 is a _{CCP [homoA] 2 -EBPPI [G} 1 A 3 F 2] 6 - CCP [homoA] 2 and CCP [homoA] ₄ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - Shows the effect of sample concentration and urea on the coiled-coil interaction of CCP [homoA] ₄ . As expected, shorter CCP blocks exhibit higher transitions than longer blocks because less coiled-coil formation occurs. LCST decreased with increasing concentration in all triple blocks. In all triple blocks, the transition temperature increased with increasing urea concentration, and no transition occurred over the entire temperature range of 10-80 ° C when the urea concentration was 8 M. At low temperatures urea breaks the coiled-coil interaction and at high temperatures reduces EBP aggregation. At high temperatures, due to the thermal transition of EBPP and EBPPI, total aggregation of all triblock peptides is formed. 10 is a PBS, PBS containing 8 M urea, 6 triple block at 25 uM concentration of the M GndCl included _{PBS CCP [homoA] 2 -EBPPI [} G 1 A 3 F 2] 6 - CCP [homoA] 2 and CCP [homoA] ₄ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - shows the size of CCP [homoA] ₄ . In PBS, both blocks show the main peak of the nanostructure region with water soluble peaks. On the other hand, 8 M element containing PBS and 6 M GndCl containing PBS shifted the nanostructure peak to water-soluble or smaller sized regions, but still had higher size peaks. These sizing results show that these polypeptides have coiled-coil interactions even at high concentrations of urea and GndCl. These two triple blocks can be used as hydrogels because they can form physical crosslinks above the LCST of the intermediate block EBP.

Example 5: Rheological Measurement of Triple Block Polypeptides

CCP-EBPP-CCP triple block polypeptide solutions of various concentrations were prepared in 10 mM PBS (pH 7.4), and dynamic-shear rheological tests were conducted to study the modulus of elasticity (G ′) and loss modulus. (G ″), complex shear modulus (G *), complex viscosity (η *), and loss angle (δ) were quantified as a function of temperature and frequency. G ″ characterizes the elastic behavior of the material while G ″ characterizes the viscous behavior of the material. G * and η * represent the frequency dependent stiffness and the frequency dependent viscous drag of the viscoelastic liquid or solid, respectively. The loss angle δ is a relative measure of viscosity to elasticity (Newton viscous fluid: δ = 90 °; elastic solids: δ = 0 °). Metal solvent traps under fully hydrated conditions were used to prevent solvent evaporation over a temperature range of 10 ° C. to 45 ° C. All samples were equilibrated at the desired temperature before each experiment for 10 minutes. Dynamic frequency sweep measurements were performed in linear viscoelastic regions at different temperatures, as confirmed by an independent strain sweep test (strain sweep range: 0.2-20%, each frequency: 0.1 or 10 rad / s). Each frequency range was 0.1 to 10 rad / s at 4 ℃ (less than T _t) and 37 ℃ (greater than T _t) with respect to the frequency switch test. Reversibility of their rheological and mechanical properties by conducting temperature sweep tests at 1 rad / s and 2% strain over a temperature range from 1 ° C to 40 ° C with a duration of 1 minute per turn for forward heating and reverse cooling measurements Was investigated.

11 is a _{CCP [homoA] 2 -EBPPI [G} 1 A 3 F 2] 6 - CCP [homoA] 2 and CCP [homoA] ₄ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - Oscillatory rheology of 30 wt% solution of CCP [homoA] ₄ . 11A and 11B show 4 ^o C (below transition temperature) and 37 ^o C (above transition temperature), CCP [homoA] ₂ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₂ and CCP [homoA] ₄ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - shows the frequency dependent rheological behavior of CCP [homoA] ₄ . At 4 ^o C G 'and G ″ are frequency dependent and there is no intersection between G ′ and G ″ over 0.1 to 10 rad / s. At 37 ^o C, the G 'value of CCP [homoA] ₂ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₂ is higher than G ″ in all frequency ranges (0.1 to 10 rad / s). On the other hand, CCP [homoA] ₄ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₄ has a cross point at 0.3 rad / s, indicating that it is a physical crosslinking gel above T _t . 11C and 11D in turn show CCP [homoA] ₂ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₂ and CCP [homoA] ₄ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA ] ₄ shows temperature dependent circulation at 1 ^o C / min heating rate. At ^{4 o C, CCP [homoA]} 4 -EBPPI [G 1 A 3 F 2] 6 - CCP [homoA] 4 is a _{CCP [homoA] 2 -EBPPI [G} 1 A 3 F 2] 6 - CCP [homoA] 2 Compared with, it has higher G 'and G ″, lower T _t because the longer CCP length results in stronger coiled-coil interaction. CCP [homoA] ₂ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₂ and CCP [homoA] ₄ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₄ is 14 ^o C And thermal transition occurs at 7 ^o C, CCP [homoA] ₂ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₂ and CCP [homoA] ₄ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₄ has an intersection at 30 ^° C and 23 ^° C, respectively. A clear intersection seen above the transition temperature of EBPPI in the two triple block polypeptides is to identify physically crosslinked hydrogels above the transition temperature. 11E and 11F show CCP [homoA] ₂ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₂ and a cooling rate of 1 ^o C / min. CCP [homoA] ₄ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₄ Each temperature sweep shows the reversibility of ABA type triple blocks similar to heating. The retraction of T _t and the intersection of CCP [homoA] ₄ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₄ clearly shows stronger coiled-coil interaction.

Next, the effect of factors on the coiled-coil interaction of self-assembled ABA type triple blocks at 4 ^° C. was observed. 12A and 12B show CCP [homoA] ₂ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] _{2 in} PBS with 2 M elements at 4 ^o C (below transition temperature); CCP [homoA] ₄ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - shows the frequency dependent rheological behavior of CCP [homoA] ₄ . 12C and 12D show PBS with 2 M elements, CCP [homoA] ₂ -EBPPI [G ₁ A ₃ F ₂ ] ₆ - CCP [homoA] ₂ and CCP [homoA] ₄ -EBPPI at a heating rate of 1 ^o C / min. _{[G 1 a 3 F 2]} 6 - shows the CCP [homoA] _4, each of the temperature-dependent cycling. At low temperatures, urea reduces the coiled-coil interaction of the self-assembly end blocks when compared to the absence of urea, thereby reducing the G ′ 'and G ″ values of the two triple blocks. On the other hand, at high temperatures, urea affects EBPPI aggregation, and no crossing was observed over the range of 1 ^o C-40 ^o C. This trend was also observed in the thermal profile at low concentrations of the triple blocks (25 uM).

13 is in 10 mM PBS (pH 7.4) CCP [homoA] 6 - EBPPI [G 1 A 3 F 2] 6 -CCP [homoA] reversible sol of 25 wt% solution of _6-a picture image showing a gel transition. At low temperatures below the EBPPI transition temperature, it is a viscous liquid, since the intermediate EBPPI block is water soluble and both end blocks have coiled-coil interaction. Aggregation occurs when the temperature rises above the LCST of EBPPI because the thermal stimulus causes the intermediate block, EBPPI, to aggregate to form a physically crosslinked hydrogel. This self-assembly reversibly changes from viscoelastic solids to viscous liquids when the temperature decreases from 37 ° C to 4 ° C, demonstrating the reversibility of the gelation process.

The present invention is a fusion polypeptide, nanostructures thereof and biomedical fields comprising an elastin-based polypeptide (EBP) and a coiled-coil forming peptide (CCP) It is for a hydrogel to be applied to. The present invention provides a polypeptide fused to EBP having a stimulatory response (eg, thermal reactivity) and a CCP capable of self-assembling, and the fusion polypeptide makes a self-assembled structure.

In the double block of CCP-EBP, below the transition temperature (T _t ), EBP is water soluble and the CCP block forms micelle cores through intramolecular and intermolecular interactions. For stimulatory self-assembled hydrogels, EBP-CCP double blocks or triple block polypeptides of CCP-EBP-CCP are self-assembled by thermal aggregation, and CCP is physically crosslinked to stimulate self-assembly. Form a hydrogel.

The inventors studied the CCP chain length effect and homo to hetero oligomerization using EBPs of different molecular weights to enhance the physical reaction of the self-assembled network. The EBP-CCP fusion polypeptides of the invention provide nanostructures and physical crosslinking means for a variety of biomedical applications.

Self-assembled CCP and heat-reactive EBP can be fused to form self-assembled nanostructures and hydrogels and used in the field of biomedical applications. The EBP-CCP double block forms nanostructures due to coiled-coil interactions and water-soluble EBP moieties below the EBP transition temperature. CCP-EBP-CCP triple blocks form physically crosslinked hydrogels due to coiled-coil interaction and EBP aggregation. Rheological measurements clearly show the intersection above the transition temperature and show a higher elastic module at 37 C. Several parameters were studied to enhance the physical crosslinking of CCP. For example, hydrophobic and ionic interactions of CCP blocks increase with longer CCP chain lengths. To remove the inner loops of the homo oligomers, hetero oligomers were introduced to create reactions between molecules that act as bridges between polypeptides. The stimulatory fusion polypeptides of the invention can also be used as injectable hydrogels for tissue regeneration.

<110> Industry-University Cooperation Foundation Hanyang University ERICA Campus          Inje university industry-academic cooperation foundation <120> Elastin Fusion Proteins with Coiled-coil forming peptides, Their          Stimuli-triggered Self-assembly, Methods of Preparation and          Biomedical use Thereof <130> DHP17-381 <150> KR 16 / 126,510 <151> 2016-09-30 <160> 85 <170> KopatentIn 2.0 <210> 1 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> Elastin-based peptide, Xaa can be any amino acid, natural or          non-natural <400> 1 Val Pro Gly Xaa Gly Val Pro Gly Xaa Gly Val Pro Gly Xaa Gly Val   1 5 10 15 Pro Gly Xaa Gly Val Pro Gly Xaa Gly Val Pro Gly Xaa Gly              20 25 30 <210> 2 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> Elastin-based peptide, Xaa can be any amino acid, natural or          non-natural <400> 2 Val Pro Ala Xaa Gly Val Pro Ala Xaa Gly Val Pro Ala Xaa Gly Val   1 5 10 15 Pro Ala Xaa Gly Val Pro Ala Xaa Gly Val Pro Ala Xaa Gly              20 25 30 <210> 3 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 3 gtcccaggtg gaggtgtacc cggcgcgggt gtcccaggtg gaggtgtacc tgggggtggg 60 gtccctggta ttggcgtacc tggaggcggc 90 <210> 4 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 4 gttccagctg gcggtgtacc tgctgctggt gttccggccg gtggtgttcc ggcgggcggc 60 gtgcctgcaa taggagttcc cgctggtggc 90 <210> 5 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 5 gttccgggtg gtggtgttcc gggtaaaggt gttccgggtg gtggtgttcc gggtggtggt 60 gttccgggta tcggtgttcc gggtggtggc 90 <210> 6 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 6 gttccggcgg gtggtgttcc ggcgaaaggt gttccggcgg gtggtgttcc ggcgggtggt 60 gttccggcga tcggtgttcc ggcgggtggc 90 <210> 7 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 7 gttccgggtg gtggtgttcc gggtgatggt gttccgggtg gtggtgttcc gggtggtggt 60 gttccgggta tcggtgttcc gggtggtggc 90 <210> 8 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 8 gttccggcgg gtggtgttcc ggcggatggt gttccggcgg gtggtgttcc ggcgggtggt 60 gttccggcga tcggtgttcc ggcgggtggc 90 <210> 9 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 9 gttccgggtg gtggtgttcc gggtgaaggt gttccgggtg gtggtgttcc gggtggtggt 60 gttccgggta tcggtgttcc gggtggtggc 90 <210> 10 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 10 gttccggcgg gtggtgttcc ggcggaaggt gttccggcgg gtggtgttcc ggcgggtggt 60 gttccggcga tcggtgttcc ggcgggtggc 90 <210> 11 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 11 gtcccgggtg cgggcgtgcc gggatttgga gttccgggtg cgggtgttcc aggcggtggt 60 gttccgggcg cgggcgtgcc gggctttggc 90 <210> 12 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 12 gtgccggcgg cgggcgttcc agcctttggt gtgccagcgg cgggagttcc ggccggtggc 60 gtgccggcag cgggcgtgcc ggcttttggc 90 <210> 13 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 13 gtgccggcgg cgggcgttcc agcctttggt gtgccagcgg cgggagttcc ggccaaaggc 60 gtgccggcag cgggcgtgcc ggcttttggc 90 <210> 14 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 14 gtgccggcgg cgggcgttcc agcctttggt gtgccagcgg cgggagttcc ggccgatggc 60 gtgccggcag cgggcgtgcc ggcttttggc 90 <210> 15 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 15 gttccagcgt ttggcgtgcc agcgaaaggt gttccggcgt ttggggttcc cgcgaaaggt 60 gtgccggcct ttggtgtgcc ggccaaaggc 90 <210> 16 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 16 gttccagcgt ttggcgtgcc agcggatggt gttccggcgt ttggggttcc cgcggatggt 60 gtgccggcct ttggtgtgcc ggccgatggc 90 <210> 17 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 17 gtgccggcgc atggagttcc tgccgccggt gttcctgcgc atggtgtacc ggcaattggc 60 gttccggcac atggtgtgcc ggccgccggc 90 <210> 18 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 18 gttccggccg gaggtgtacc ggcgcatggt gttccggcac atggtgtgcc ggctcacggt 60 gtgcctgcgc atggcgttcc tgcgcatggc 90 <210> 19 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 19 gttccggccg gaggtgtacc ggcgcatggt gttccggcac atggtgtgcc ggctcacggt 60 gtgcctgcgc atggcgttcc tgcgcatggc 90 <210> 20 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 20 attcctgcag ccggtatccc ggccggtggc attccggcag ccggcattcc ggccgccggc 60 atcccggcat ttggcattcc tgcagcaggc 90 <210> 21 <211> 90 <212> DNA <213> Artificial Sequence <220> <223> EBP <400> 21 attccggccg caggcattcc tgcatttggt attccggcgg caggcattcc tgccggtggc 60 atcccggcag cgggcattcc ggcctttggc 90 <210> 22 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 22 Val Pro Gly Gly Gly Val Pro Gly Ala Gly Val Pro Gly Gly Gly Val   1 5 10 15 Pro Gly Gly Gly Val Pro Gly Ile Gly Val Pro Gly Gly Gly              20 25 30 <210> 23 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 23 Val Pro Ala Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ile Gly Val Pro Ala Gly Gly              20 25 30 <210> 24 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 24 Val Pro Gly Gly Gly Val Pro Gly Lys Gly Val Pro Gly Gly Gly Val   1 5 10 15 Pro Gly Gly Gly Val Pro Gly Ile Gly Val Pro Gly Gly Gly              20 25 30 <210> 25 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 25 Val Pro Ala Gly Val Val Pro Ala Lys Gly Val Pro Ala Gly Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ile Gly Val Pro Ala Gly Gly              20 25 30 <210> 26 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 26 Val Pro Gly Gly Gly Val Pro Gly Asp Gly Val Pro Gly Gly Gly Val   1 5 10 15 Pro Gly Gly Gly Val Pro Gly Ile Gly Val Pro Gly Gly Gly              20 25 30 <210> 27 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 27 Val Pro Ala Gly Val Pro Ala Asp Gly Val Pro Ala Gly Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ile Gly Val Pro Ala Gly Gly              20 25 30 <210> 28 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 28 Val Pro Gly Gly Gly Val Pro Gly Glu Gly Val Pro Gly Gly Gly Val   1 5 10 15 Pro Gly Gly Gly Val Pro Gly Ile Gly Val Pro Gly Gly Gly              20 25 30 <210> 29 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 29 Val Pro Ala Gly Val Pro Ala Glu Gly Val Pro Ala Gly Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ile Gly Val Pro Ala Gly Gly              20 25 30 <210> 30 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 30 Val Pro Gly Ala Gly Val Pro Gly Phe Gly Val Pro Gly Ala Gly Val   1 5 10 15 Pro Gly Gly Gly Val Pro Gly Ala Gly Val Pro Gly Phe Gly              20 25 30 <210> 31 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 31 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly              20 25 30 <210> 32 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 32 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Lys Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly              20 25 30 <210> 33 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 33 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Asp Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly              20 25 30 <210> 34 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 34 Val Pro Ala Phe Gly Val Pro Ala Lys Gly Val Pro Ala Phe Gly Val   1 5 10 15 Pro Ala Lys Gly Val Pro Ala Phe Gly Val Pro Ala Lys Gly              20 25 30 <210> 35 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 35 Val Pro Ala Phe Gly Val Pro Ala Asp Gly Val Pro Ala Phe Gly Val   1 5 10 15 Pro Ala Asp Gly Val Pro Ala Phe Gly Val Pro Ala Asp Gly              20 25 30 <210> 36 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 36 Val Pro Ala His Gly Val Pro Ala Ala Gly Val Pro Ala His Gly Val   1 5 10 15 Pro Ala Ile Gly Val Pro Ala His Gly Val Pro Ala Ala Gly              20 25 30 <210> 37 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 37 Val Pro Ala Gly Gly Val Pro Ala His Gly Val Pro Ala His Gly Val   1 5 10 15 Pro Ala His Gly Val Pro Ala His Gly Val Pro Ala His Gly              20 25 30 <210> 38 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 38 Val Pro Ala Cys Gly Val Pro Ala Phe Gly Val Pro Ala Cys Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Cys Gly Val Pro Ala Phe Gly              20 25 30 <210> 39 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 39 Ile Pro Ala Ala Gly Ile Pro Ala Gly Gly Ile Pro Ala Ala Gly Ile   1 5 10 15 Pro Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro Ala Ala Gly              20 25 30 <210> 40 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> EBP <400> 40 Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro Ala Ala Gly Ile   1 5 10 15 Pro Ala Gly Gly Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly              20 25 30 <210> 41 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> CCP <400> 41 aaaatcgcgt cactggaaca aaaaattgcg aagctggaac agaaaattgc gaaactggaa 60 ggc 63 <210> 42 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> CCP <400> 42 cgcgtggcgt cactggaaca gcgtgttgct cgcctggaac agcgcgtcgc gcgtctggaa 60 ggc 63 <210> 43 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> CCP <400> 43 gaaattgcga gtctggaaca agaaattgcg gaactggaac aggagatcgc cgagctggaa 60 ggc 63 <210> 44 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> CCP <400> 44 aaagtggcga gcctgaaaca aaaagtcgcc aaactgaaac agaaagttgc taaactgaaa 60 ggc 63 <210> 45 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> CCP <400> 45 Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala   1 5 10 15 Lys Leu Glu Gln Lys              20 <210> 46 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> CCP <400> 46 Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala   1 5 10 15 Arg Leu Glu Gln Arg              20 <210> 47 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> CCP <400> 47 Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala   1 5 10 15 Glu Leu Glu Gln Glu              20 <210> 48 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> CCP <400> 48 Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala   1 5 10 15 Lys Leu Lys Gln Lys              20 <210> 49 <211> 66 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 49 ctagaaataa ttttgtttaa ctttaagaag gaggagtaca tatgggctac tgataatgat 60 cttcag 66 <210> 50 <211> 66 <212> DNA <213> Artificial Sequence <220> Artificial sequence <400> 50 gatcctgaag atcattatca gtagcccata tgtactcctc cttcttaaag ttaaacaaaa 60 ttattt 66 <210> 51 <211> 201 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 6-CCP [homoA] 1 <400> 51 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu             180 185 190 Gln Lys Ile Ala Lys Leu Glu Gln Lys         195 200 <210> 52 <211> 222 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 6-CCP [homoA] 2 <400> 52 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu             180 185 190 Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys         195 200 205 Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys     210 215 220 <210> 53 <211> 402 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 12-CCP [homoA] 2 <400> 53 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             180 185 190 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala         195 200 205 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     210 215 220 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 225 230 235 240 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 245 250 255 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             260 265 270 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         275 280 285 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     290 295 300 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly 305 310 315 320 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 325 330 335 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             340 345 350 Ala Ala Gly Val Pro Ala Phe Gly Ile Ala Lys Leu Glu Gly Lys Ile         355 360 365 Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys     370 375 380 Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu 385 390 395 400 Gln lys         <210> 54 <211> 264 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 6-CCP [homoA] 4 <400> 54 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu             180 185 190 Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys         195 200 205 Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile Ala     210 215 220 Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu 225 230 235 240 Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln                 245 250 255 Lys Ile Ala Lys Leu Glu Gln Lys             260 <210> 55 <211> 444 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 12-CCP [homoA] 4 <400> 55 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             180 185 190 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala         195 200 205 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     210 215 220 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 225 230 235 240 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 245 250 255 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             260 265 270 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         275 280 285 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     290 295 300 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly 305 310 315 320 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 325 330 335 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             340 345 350 Ala Ala Gly Val Pro Ala Phe Gly Ile Ala Lys Leu Glu Gly Lys Ile         355 360 365 Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys     370 375 380 Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu 385 390 395 400 Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys                 405 410 415 Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala             420 425 430 Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys         435 440 <210> 56 <211> 222 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 6-CCP [homoB] 2 <400> 56 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu             180 185 190 Gln Arg Val Ala Arg Leu Glu Gln Arg Val Ala Arg Leu Glu Gly Arg         195 200 205 Val Ala Ser Leu Glu Gln Arg Val Ala Arg Leu Glu Gln Arg     210 215 220 <210> 57 <211> 402 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 12-CCP [homoB] 2 <400> 57 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             180 185 190 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala         195 200 205 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     210 215 220 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 225 230 235 240 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 245 250 255 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             260 265 270 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         275 280 285 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     290 295 300 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly 305 310 315 320 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 325 330 335 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             340 345 350 Ala Ala Gly Val Pro Ala Phe Gly Val Ala Arg Leu Glu Gly Arg Val         355 360 365 Ala Ser Leu Glu Gln Arg Val Ala Arg Leu Glu Gln Arg Val Ala Arg     370 375 380 Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala Arg Leu Glu 385 390 395 400 Gln arg         <210> 58 <211> 264 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 6-CCP [homoB] 4 <400> 58 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu             180 185 190 Gln Arg Val Ala Arg Leu Glu Gln Arg Val Ala Arg Leu Glu Gly Arg         195 200 205 Val Ala Ser Leu Glu Gln Arg Val Ala Arg Leu Glu Gln Arg Val Ala     210 215 220 Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala Arg Leu 225 230 235 240 Glu Gln Arg Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln                 245 250 255 Arg Val Ala Arg Leu Glu Gln Arg             260 <210> 59 <211> 444 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 12-CCP [homoB] 4 <400> 59 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             180 185 190 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala         195 200 205 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     210 215 220 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 225 230 235 240 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 245 250 255 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             260 265 270 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         275 280 285 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     290 295 300 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly 305 310 315 320 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 325 330 335 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             340 345 350 Ala Ala Gly Val Pro Ala Phe Gly Val Ala Arg Leu Glu Gly Arg Val         355 360 365 Ala Ser Leu Glu Gln Arg Val Ala Arg Leu Glu Gln Arg Val Ala Arg     370 375 380 Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala Arg Leu Glu 385 390 395 400 Gln Arg Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg                 405 410 415 Val Ala Arg Leu Glu Gln Arg Val Ala Arg Leu Glu Gly Arg Val Ala             420 425 430 Ser Leu Glu Gln Arg Val Ala Arg Leu Glu Gln Arg         435 440 <210> 60 <211> 222 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 6-CCP [heteroA] 2 <400> 60 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu             180 185 190 Gln Glu Ile Ala Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu Gly Glu         195 200 205 Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu     210 215 220 <210> 61 <211> 402 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 12-CCP [heteroA] 2 <400> 61 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             180 185 190 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala         195 200 205 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     210 215 220 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 225 230 235 240 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 245 250 255 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             260 265 270 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         275 280 285 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     290 295 300 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly 305 310 315 320 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 325 330 335 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             340 345 350 Ala Ala Gly Val Pro Ala Phe Gly Ile Ala Glu Leu Glu Gly Glu Ile         355 360 365 Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu Ile Ala Glu     370 375 380 Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu 385 390 395 400 Gln glu         <210> 62 <211> 264 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 6-CCP [heteroA] 4 <400> 62 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu             180 185 190 Gln Glu Ile Ala Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu Gly Glu         195 200 205 Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu Ile Ala     210 215 220 Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu 225 230 235 240 Glu Gln Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln                 245 250 255 Glu Ile Ala Glu Leu Glu Gln Glu             260 <210> 63 <211> 444 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 12-CCP [heteroA] 4 <400> 63 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             180 185 190 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala         195 200 205 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     210 215 220 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 225 230 235 240 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 245 250 255 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             260 265 270 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         275 280 285 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     290 295 300 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly 305 310 315 320 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 325 330 335 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             340 345 350 Ala Ala Gly Val Pro Ala Phe Gly Ile Ala Glu Leu Glu Gly Glu Ile         355 360 365 Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu Ile Ala Glu     370 375 380 Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu 385 390 395 400 Gln Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu                 405 410 415 Ile Ala Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala             420 425 430 Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu         435 440 <210> 64 <211> 222 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 6-CCP [heteroB] 2 <400> 64 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys             180 185 190 Gln Lys Val Ala Lys Leu Lys Gln Lys Val Ala Lys Leu Lys Gly Lys         195 200 205 Val Ala Ser Leu Lys Gln Lys Val Ala Lys Leu Lys Gln Lys     210 215 220 <210> 65 <211> 402 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 12-CCP [heteroB] 2 <400> 65 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             180 185 190 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala         195 200 205 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     210 215 220 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 225 230 235 240 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 245 250 255 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             260 265 270 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         275 280 285 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     290 295 300 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly 305 310 315 320 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 325 330 335 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             340 345 350 Ala Ala Gly Val Pro Ala Phe Gly Val Ala Lys Leu Lys Gly Lys Val         355 360 365 Ala Ser Leu Lys Gln Lys Val Ala Lys Leu Lys Gln Lys Val Ala Lys     370 375 380 Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala Lys Leu Lys 385 390 395 400 Gln lys         <210> 66 <211> 264 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 6-CCP [heteroB] 4 <400> 66 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys             180 185 190 Gln Lys Val Ala Lys Leu Lys Gln Lys Val Ala Lys Leu Lys Gly Lys         195 200 205 Val Ala Ser Leu Lys Gln Lys Val Ala Lys Leu Lys Gln Lys Val Ala     210 215 220 Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala Lys Leu 225 230 235 240 Lys Gln Lys Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln                 245 250 255 Lys Val Ala Lys Leu Lys Gln Lys             260 <210> 67 <211> 444 <212> PRT <213> Artificial Sequence <220> <223> EBPP [G1A3F2] 12-CCP [heteroB] 4 <400> 67 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val   1 5 10 15 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro              20 25 30 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala          35 40 45 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala      50 55 60 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly  65 70 75 80 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                  85 90 95 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             100 105 110 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         115 120 125 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala     130 135 140 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 145 150 155 160 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val                 165 170 175 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             180 185 190 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala         195 200 205 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     210 215 220 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly 225 230 235 240 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 245 250 255 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro             260 265 270 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala         275 280 285 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala     290 295 300 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly 305 310 315 320 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val                 325 330 335 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro             340 345 350 Ala Ala Gly Val Pro Ala Phe Gly Val Ala Lys Leu Lys Gly Lys Val         355 360 365 Ala Ser Leu Lys Gln Lys Val Ala Lys Leu Lys Gln Lys Val Ala Lys     370 375 380 Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala Lys Leu Lys 385 390 395 400 Gln Lys Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys                 405 410 415 Val Ala Lys Leu Lys Gln Lys Val Ala Lys Leu Lys Gly Lys Val Ala             420 425 430 Ser Leu Lys Gln Lys Val Ala Lys Leu Lys Gln Lys         435 440 <210> 68 <211> 264 <212> PRT <213> Artificial Sequence <220> CCP [homoA] 2-EBPPI [G1A3F2] 6-CCP [homoA] 2 <400> 68 Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala   1 5 10 15 Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu              20 25 30 Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile Pro Ala Ala Gly Ile          35 40 45 Pro Ala Phe Gly Ile Pro Ala Ala Gly Ile Pro Ala Gly Gly Ile Pro      50 55 60 Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro Ala Ala Gly Ile Pro Ala  65 70 75 80 Phe Gly Ile Pro Ala Ala Gly Ile Pro Ala Gly Gly Ile Pro Ala Ala                  85 90 95 Gly Ile Pro Ala Phe Gly Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly             100 105 110 Ile Pro Ala Ala Gly Ile Pro Ala Gly Gly Ile Pro Ala Ala Gly Ile         115 120 125 Pro Ala Phe Gly Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro     130 135 140 Ala Ala Gly Ile Pro Ala Gly Gly Ile Pro Ala Ala Gly Ile Pro Ala 145 150 155 160 Phe Gly Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro Ala Ala                 165 170 175 Gly Ile Pro Ala Gly Gly Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly             180 185 190 Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro Ala Ala Gly Ile         195 200 205 Pro Ala Gly Gly Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly Ile Ala     210 215 220 Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu 225 230 235 240 Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln                 245 250 255 Lys Ile Ala Lys Leu Glu Gln Lys             260 <210> 69 <211> 348 <212> PRT <213> Artificial Sequence <220> CCP [homoA] 4-EBPPI [G1A3F2] 6-CCP [homoA] 4 <400> 69 Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala   1 5 10 15 Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu              20 25 30 Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly          35 40 45 Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile      50 55 60 Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys  65 70 75 80 Leu Glu Gln Lys Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro                  85 90 95 Ala Ala Gly Ile Pro Ala Gly Gly Ile Pro Ala Ala Gly Ile Pro Ala             100 105 110 Phe Gly Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro Ala Ala         115 120 125 Gly Ile Pro Ala Gly Gly Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly     130 135 140 Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro Ala Ala Gly Ile 145 150 155 160 Pro Ala Gly Gly Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro                 165 170 175 Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro Ala Ala Gly Ile Pro Ala             180 185 190 Gly Gly Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro Ala Ala         195 200 205 Gly Ile Pro Ala Phe Gly Ile Pro Ala Ala Gly Ile Pro Ala Gly Gly     210 215 220 Ile Pro Ala Ala Gly Ile Pro Ala Phe Gly Ile Pro Ala Ala Gly Ile 225 230 235 240 Pro Ala Phe Gly Ile Pro Ala Ala Gly Ile Pro Ala Gly Gly Ile Pro                 245 250 255 Ala Ala Gly Ile Pro Ala Phe Gly Ile Ala Lys Leu Glu Gly Lys Ile             260 265 270 Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys         275 280 285 Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu     290 295 300 Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys 305 310 315 320 Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala                 325 330 335 Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys             340 345 <210> 70 <211> 264 <212> PRT <213> Artificial Sequence <220> CCP [homoA] 2-EBPP [G1A3F2] 6-CCP [homoA] 2 <400> 70 Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala   1 5 10 15 Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu              20 25 30 Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Val Pro Ala Ala Gly Val          35 40 45 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro      50 55 60 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala  65 70 75 80 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala                  85 90 95 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             100 105 110 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val         115 120 125 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     130 135 140 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala 145 150 155 160 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala                 165 170 175 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             180 185 190 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val         195 200 205 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Ile Ala     210 215 220 Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu 225 230 235 240 Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln                 245 250 255 Lys Ile Ala Lys Leu Glu Gln Lys             260 <210> 71 <211> 444 <212> PRT <213> Artificial Sequence <220> CCP [homoA] 2-EBPP [G1A3F2] 12-CCP [homoA] 2 <400> 71 Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala   1 5 10 15 Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu              20 25 30 Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Val Pro Ala Ala Gly Val          35 40 45 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro      50 55 60 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala  65 70 75 80 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala                  85 90 95 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             100 105 110 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val         115 120 125 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     130 135 140 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala 145 150 155 160 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala                 165 170 175 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             180 185 190 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val         195 200 205 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     210 215 220 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala 225 230 235 240 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala                 245 250 255 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly             260 265 270 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val         275 280 285 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro     290 295 300 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala 305 310 315 320 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala                 325 330 335 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             340 345 350 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val         355 360 365 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     370 375 380 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala 385 390 395 400 Phe Gly Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys                 405 410 415 Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala             420 425 430 Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys         435 440 <210> 72 <211> 348 <212> PRT <213> Artificial Sequence <220> CCP [homoA] 4-EBPP [G1A3F2] 6-CCP [homoA] 4 <400> 72 Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala   1 5 10 15 Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu              20 25 30 Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly          35 40 45 Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile      50 55 60 Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys  65 70 75 80 Leu Glu Gln Lys Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                  85 90 95 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala             100 105 110 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         115 120 125 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     130 135 140 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 145 150 155 160 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 165 170 175 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             180 185 190 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         195 200 205 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly     210 215 220 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 225 230 235 240 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro                 245 250 255 Ala Ala Gly Val Pro Ala Phe Gly Ile Ala Lys Leu Glu Gly Lys Ile             260 265 270 Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys         275 280 285 Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu     290 295 300 Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys 305 310 315 320 Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala                 325 330 335 Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys             340 345 <210> 73 <211> 528 <212> PRT <213> Artificial Sequence <220> CCP [homoA] 4-EBPP [G1A3F2] 12-CCP [homoA] 4 <400> 73 Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala   1 5 10 15 Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu              20 25 30 Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly          35 40 45 Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile      50 55 60 Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys  65 70 75 80 Leu Glu Gln Lys Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                  85 90 95 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala             100 105 110 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         115 120 125 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     130 135 140 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 145 150 155 160 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 165 170 175 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             180 185 190 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         195 200 205 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly     210 215 220 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 225 230 235 240 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro                 245 250 255 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             260 265 270 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala         275 280 285 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     290 295 300 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val 305 310 315 320 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 325 330 335 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala             340 345 350 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         355 360 365 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     370 375 380 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 385 390 395 400 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 405 410 415 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             420 425 430 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Ile Ala Lys Leu         435 440 445 Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln     450 455 460 Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile 465 470 475 480 Ala Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu Gly Lys Ile Ala Ser                 485 490 495 Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys Ile Ala Lys Leu Glu             500 505 510 Gly Lys Ile Ala Ser Leu Glu Gln Lys Ile Ala Lys Leu Glu Gln Lys         515 520 525 <210> 74 <211> 264 <212> PRT <213> Artificial Sequence <220> CCP [homoB] 2-EBPP [G1A3F2] 6-CCP [homoB] 2 <400> 74 Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala   1 5 10 15 Arg Leu Glu Gln Arg Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu              20 25 30 Glu Gln Arg Val Ala Arg Leu Glu Gln Arg Val Pro Ala Ala Gly Val          35 40 45 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro      50 55 60 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala  65 70 75 80 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala                  85 90 95 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             100 105 110 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val         115 120 125 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     130 135 140 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala 145 150 155 160 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala                 165 170 175 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             180 185 190 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val         195 200 205 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Ala     210 215 220 Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala Arg Leu 225 230 235 240 Glu Gln Arg Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln                 245 250 255 Arg Val Ala Arg Leu Glu Gln Arg             260 <210> 75 <211> 444 <212> PRT <213> Artificial Sequence <220> CCP [homoB] 2-EBPP [G1A3F2] 12-CCP [homoB] 2 <400> 75 Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala   1 5 10 15 Arg Leu Glu Gln Arg Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu              20 25 30 Glu Gln Arg Val Ala Arg Leu Glu Gln Arg Val Pro Ala Ala Gly Val          35 40 45 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro      50 55 60 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala  65 70 75 80 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala                  85 90 95 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             100 105 110 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val         115 120 125 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     130 135 140 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala 145 150 155 160 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala                 165 170 175 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             180 185 190 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val         195 200 205 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     210 215 220 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala 225 230 235 240 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala                 245 250 255 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly             260 265 270 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val         275 280 285 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro     290 295 300 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala 305 310 315 320 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala                 325 330 335 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             340 345 350 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val         355 360 365 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     370 375 380 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala 385 390 395 400 Phe Gly Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg                 405 410 415 Val Ala Arg Leu Glu Gln Arg Val Ala Arg Leu Glu Gly Arg Val Ala             420 425 430 Ser Leu Glu Gln Arg Val Ala Arg Leu Glu Gln Arg         435 440 <210> 76 <211> 348 <212> PRT <213> Artificial Sequence <220> CCP [homoB] 4-EBPP [G1A3F2] 6-CCP [homoB] 4 <400> 76 Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala   1 5 10 15 Arg Leu Glu Gln Arg Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu              20 25 30 Glu Gln Arg Val Ala Arg Leu Glu Gln Arg Val Ala Arg Leu Glu Gly          35 40 45 Arg Val Ala Ser Leu Glu Gln Arg Val Ala Arg Leu Glu Gln Arg Val      50 55 60 Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala Arg  65 70 75 80 Leu Glu Gln Arg Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                  85 90 95 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala             100 105 110 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         115 120 125 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     130 135 140 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 145 150 155 160 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 165 170 175 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             180 185 190 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         195 200 205 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly     210 215 220 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 225 230 235 240 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro                 245 250 255 Ala Ala Gly Val Pro Ala Phe Gly Val Ala Arg Leu Glu Gly Arg Val             260 265 270 Ala Ser Leu Glu Gln Arg Val Ala Arg Leu Glu Gln Arg Val Ala Arg         275 280 285 Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala Arg Leu Glu     290 295 300 Gln Arg Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg 305 310 315 320 Val Ala Arg Leu Glu Gln Arg Val Ala Arg Leu Glu Gly Arg Val Ala                 325 330 335 Ser Leu Glu Gln Arg Val Ala Arg Leu Glu Gln Arg             340 345 <210> 77 <211> 528 <212> PRT <213> Artificial Sequence <220> CCP [homoB] 4-EBPP [G1A3F2] 12-CCP [homoB] 4 <400> 77 Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala   1 5 10 15 Arg Leu Glu Gln Arg Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu              20 25 30 Glu Gln Arg Val Ala Arg Leu Glu Gln Arg Val Ala Arg Leu Glu Gly          35 40 45 Arg Val Ala Ser Leu Glu Gln Arg Val Ala Arg Leu Glu Gln Arg Val      50 55 60 Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala Arg  65 70 75 80 Leu Glu Gln Arg Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                  85 90 95 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala             100 105 110 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         115 120 125 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     130 135 140 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 145 150 155 160 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 165 170 175 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             180 185 190 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         195 200 205 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly     210 215 220 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 225 230 235 240 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro                 245 250 255 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             260 265 270 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala         275 280 285 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     290 295 300 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val 305 310 315 320 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 325 330 335 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala             340 345 350 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         355 360 365 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     370 375 380 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 385 390 395 400 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 405 410 415 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             420 425 430 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Ala Arg Leu         435 440 445 Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala Arg Leu Glu Gln     450 455 460 Arg Val Ala Arg Leu Glu Gly Arg Val Ala Ser Leu Glu Gln Arg Val 465 470 475 480 Ala Arg Leu Glu Gln Arg Val Ala Arg Leu Glu Gly Arg Val Ala Ser                 485 490 495 Leu Glu Gln Arg Val Ala Arg Leu Glu Gln Arg Val Ala Arg Leu Glu             500 505 510 Gly Arg Val Ala Ser Leu Glu Gln Arg Val Ala Arg Leu Glu Gln Arg         515 520 525 <210> 78 <211> 264 <212> PRT <213> Artificial Sequence <220> CCP [heteroA] 2-EBPP [G1A3F2] 6-CCP [heteroA] 2 <400> 78 Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala   1 5 10 15 Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu              20 25 30 Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu Val Pro Ala Ala Gly Val          35 40 45 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro      50 55 60 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala  65 70 75 80 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala                  85 90 95 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             100 105 110 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val         115 120 125 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     130 135 140 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala 145 150 155 160 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala                 165 170 175 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             180 185 190 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val         195 200 205 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Ile Ala     210 215 220 Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu 225 230 235 240 Glu Gln Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln                 245 250 255 Glu Ile Ala Glu Leu Glu Gln Glu             260 <210> 79 <211> 444 <212> PRT <213> Artificial Sequence <220> CCP [heteroA] 2-EBPP [G1A3F2] 12-CCP [heteroA] 2 <400> 79 Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala   1 5 10 15 Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu              20 25 30 Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu Val Pro Ala Ala Gly Val          35 40 45 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro      50 55 60 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala  65 70 75 80 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala                  85 90 95 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             100 105 110 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val         115 120 125 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     130 135 140 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala 145 150 155 160 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala                 165 170 175 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             180 185 190 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val         195 200 205 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     210 215 220 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala 225 230 235 240 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala                 245 250 255 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly             260 265 270 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val         275 280 285 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro     290 295 300 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala 305 310 315 320 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala                 325 330 335 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             340 345 350 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val         355 360 365 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     370 375 380 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala 385 390 395 400 Phe Gly Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu                 405 410 415 Ile Ala Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala             420 425 430 Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu         435 440 <210> 80 <211> 348 <212> PRT <213> Artificial Sequence <220> CCP [heteroA] 4-EBPP [G1A3F2] 6-CCP [heteroA] 4 <400> 80 Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala   1 5 10 15 Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu              20 25 30 Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu Gly          35 40 45 Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu Ile      50 55 60 Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu  65 70 75 80 Leu Glu Gln Glu Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                  85 90 95 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala             100 105 110 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         115 120 125 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     130 135 140 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 145 150 155 160 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 165 170 175 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             180 185 190 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         195 200 205 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly     210 215 220 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 225 230 235 240 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro                 245 250 255 Ala Ala Gly Val Pro Ala Phe Gly Ile Ala Glu Leu Glu Gly Glu Ile             260 265 270 Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu Ile Ala Glu         275 280 285 Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu     290 295 300 Gln Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu 305 310 315 320 Ile Ala Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala                 325 330 335 Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu             340 345 <210> 81 <211> 528 <212> PRT <213> Artificial Sequence <220> CCP [heteroA] 4-EBPP [G1A3F2] 12-CCP [heteroA] 4 <400> 81 Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala   1 5 10 15 Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu              20 25 30 Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu Gly          35 40 45 Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu Ile      50 55 60 Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu  65 70 75 80 Leu Glu Gln Glu Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                  85 90 95 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala             100 105 110 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         115 120 125 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     130 135 140 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 145 150 155 160 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 165 170 175 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             180 185 190 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         195 200 205 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly     210 215 220 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 225 230 235 240 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro                 245 250 255 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             260 265 270 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala         275 280 285 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     290 295 300 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val 305 310 315 320 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 325 330 335 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala             340 345 350 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         355 360 365 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     370 375 380 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 385 390 395 400 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 405 410 415 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             420 425 430 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Ile Ala Glu Leu         435 440 445 Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln     450 455 460 Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile 465 470 475 480 Ala Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu Gly Glu Ile Ala Ser                 485 490 495 Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu Ile Ala Glu Leu Glu             500 505 510 Gly Glu Ile Ala Ser Leu Glu Gln Glu Ile Ala Glu Leu Glu Gln Glu         515 520 525 <210> 82 <211> 264 <212> PRT <213> Artificial Sequence <220> CCP [heteroB] 2-EBPP [G1A3F2] 6-CCP [heteroB] 2 <400> 82 Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala   1 5 10 15 Lys Leu Lys Gln Lys Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu              20 25 30 Lys Gln Lys Val Ala Lys Leu Lys Gln Lys Val Pro Ala Ala Gly Val          35 40 45 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro      50 55 60 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala  65 70 75 80 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala                  85 90 95 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             100 105 110 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val         115 120 125 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     130 135 140 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala 145 150 155 160 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala                 165 170 175 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             180 185 190 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val         195 200 205 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Ala     210 215 220 Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala Lys Leu 225 230 235 240 Lys Gln Lys Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln                 245 250 255 Lys Val Ala Lys Leu Lys Gln Lys             260 <210> 83 <211> 444 <212> PRT <213> Artificial Sequence <220> CCP [heteroB] 2-EBPP [G1A3F2] 12-CCP [heteroB] 2 <400> 83 Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala   1 5 10 15 Lys Leu Lys Gln Lys Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu              20 25 30 Lys Gln Lys Val Ala Lys Leu Lys Gln Lys Val Pro Ala Ala Gly Val          35 40 45 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro      50 55 60 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala  65 70 75 80 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala                  85 90 95 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             100 105 110 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val         115 120 125 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     130 135 140 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala 145 150 155 160 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala                 165 170 175 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             180 185 190 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val         195 200 205 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     210 215 220 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala 225 230 235 240 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala                 245 250 255 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly             260 265 270 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val         275 280 285 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro     290 295 300 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala 305 310 315 320 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala                 325 330 335 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly             340 345 350 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val         355 360 365 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro     370 375 380 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala 385 390 395 400 Phe Gly Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys                 405 410 415 Val Ala Lys Leu Lys Gln Lys Val Ala Lys Leu Lys Gly Lys Val Ala             420 425 430 Ser Leu Lys Gln Lys Val Ala Lys Leu Lys Gln Lys         435 440 <210> 84 <211> 348 <212> PRT <213> Artificial Sequence <220> CCP [heteroB] 4-EBPP [G1A3F2] 6-CCP [heteroB] 4 <400> 84 Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala   1 5 10 15 Lys Leu Lys Gln Lys Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu              20 25 30 Lys Gln Lys Val Ala Lys Leu Lys Gln Lys Val Ala Lys Leu Lys Gly          35 40 45 Lys Val Ala Ser Leu Lys Gln Lys Val Ala Lys Leu Lys Gln Lys Val      50 55 60 Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala Lys  65 70 75 80 Leu Lys Gln Lys Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                  85 90 95 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala             100 105 110 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         115 120 125 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     130 135 140 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 145 150 155 160 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 165 170 175 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             180 185 190 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         195 200 205 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly     210 215 220 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 225 230 235 240 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro                 245 250 255 Ala Ala Gly Val Pro Ala Phe Gly Val Ala Lys Leu Lys Gly Lys Val             260 265 270 Ala Ser Leu Lys Gln Lys Val Ala Lys Leu Lys Gln Lys Val Ala Lys         275 280 285 Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala Lys Leu Lys     290 295 300 Gln Lys Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys 305 310 315 320 Val Ala Lys Leu Lys Gln Lys Val Ala Lys Leu Lys Gly Lys Val Ala                 325 330 335 Ser Leu Lys Gln Lys Val Ala Lys Leu Lys Gln Lys             340 345 <210> 85 <211> 528 <212> PRT <213> Artificial Sequence <220> CCP [heteroB] 4-EBPP [G1A3F2] 12-CCP [heteroB] 4 <400> 85 Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala   1 5 10 15 Lys Leu Lys Gln Lys Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu              20 25 30 Lys Gln Lys Val Ala Lys Leu Lys Gln Lys Val Ala Lys Leu Lys Gly          35 40 45 Lys Val Ala Ser Leu Lys Gln Lys Val Ala Lys Leu Lys Gln Lys Val      50 55 60 Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala Lys  65 70 75 80 Leu Lys Gln Lys Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                  85 90 95 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala             100 105 110 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         115 120 125 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     130 135 140 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 145 150 155 160 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 165 170 175 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             180 185 190 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         195 200 205 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly     210 215 220 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 225 230 235 240 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro                 245 250 255 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             260 265 270 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala         275 280 285 Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     290 295 300 Val Pro Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val 305 310 315 320 Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 325 330 335 Ala Ala Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala             340 345 350 Phe Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala         355 360 365 Gly Val Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly     370 375 380 Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val 385 390 395 400 Pro Ala Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Pro                 405 410 415 Ala Ala Gly Val Pro Ala Phe Gly Val Pro Ala Ala Gly Val Pro Ala             420 425 430 Gly Gly Val Pro Ala Ala Gly Val Pro Ala Phe Gly Val Ala Lys Leu         435 440 445 Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala Lys Leu Lys Gln     450 455 460 Lys Val Ala Lys Leu Lys Gly Lys Val Ala Ser Leu Lys Gln Lys Val 465 470 475 480 Ala Lys Leu Lys Gln Lys Val Ala Lys Leu Lys Gly Lys Val Ala Ser                 485 490 495 Leu Lys Gln Lys Val Ala Lys Leu Lys Gln Lys Val Ala Lys Leu Lys             500 505 510 Gly Lys Val Ala Ser Leu Lys Gln Lys Val Ala Lys Leu Lys Gln Lys         515 520 525

Claims (23)

Coiled-coil forming peptide (CCP) blocks; And
An elastin-based polypeptide (EBP) block having stimulatory reactivity linked to the CCP block;
Consisting of,
Wherein said CCP block is one of the amino acid sequences set forth in SEQ ID NOs: 45, 46, 47 and 48.
The method of claim 1,
Wherein the stimulus is heat a stimulus reactive fusion polypeptide.
delete The method of claim 1,
The EBP block is,
A stimulatory reactive fusion polypeptide, consisting of the amino acid sequence represented by Formula 1 or Formula 2 below:
[Equation 1]
[SEQ ID NO: 1] n; or
[Equation 2]
[SEQ ID NO 2] n,
In Formula 1 or Formula 2,

SEQ ID NO: 1 consists of [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG];
SEQ ID NO: 2 consists of [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG];
N is an integer of 1 or more and 12 or less, and is the number of repetitions of SEQ ID NO: 1 or SEQ ID NO: 2; And
X is an amino acid other than proline and is selected from any natural or artificial amino acid when the pentapeptide VPGXG or VPAXG is repeated.
The method of claim 4, wherein
The EBP block is,
In said pentapeptide VPGXG or VPAXG, said V (valine) is substituted with I (isoleucine).
The method of claim 1,
The stimulatory reactive fusion polypeptide,
A stimuli responsive fusion polypeptide consisting of one of the amino acid sequences set forth in SEQ ID NOs: 51-67.
The method of claim 1,
The stimulatory reactive fusion polypeptide,
Below the transition temperature of the stimulus-reactive EBP, the CCP block forms a core structure to form a self-assembled nanostructure of micelle structure, stimulus-reactive fusion polypeptide.
The method of claim 1,
The stimulatory reactive fusion polypeptide,
Self-assembly of core-shell micelle structure by the formation of the core structure of the EBP block by the agglutination through the phase transition behavior of the EBP by thermal stimulation above the stimulus-reactive EBP and the formation of the amphipathic CCP block by the shell structure A stimulus reactive fusion polypeptide that forms a nanostructure.
A self-assembled nanostructure of core-shell type micellar structure is prepared by subjecting the stimulus-reactive fusion polypeptide according to any one of claims 1, 2 and 4 to 6 to thermal stimulation; And
Aggregate the prepared self-assembled nanostructures;
Hydrogel prepared by the process comprising a step,
Reversible hydrogel in which the CCP in the self-assembled nanostructures acts as a physical crosslinking agent.
Coiled-coil forming peptide (CCP) blocks;
An elastin-based polypeptide (EBP) block having stimulatory reactivity linked to the CCP block; And
Consisting of a coiled-coil forming peptide (CCP) block connected to the EBP block,
Wherein said CCP block is one of the amino acid sequences set forth in SEQ ID NOs: 45, 46, 47 and 48.
The method of claim 10,
Wherein the stimulus is heat a stimulus reactive fusion polypeptide.
delete The method of claim 10,
The EBP block is,
A stimulatory reactive fusion polypeptide, consisting of the amino acid sequence represented by Formula 1 or Formula 2 below:
[Equation 1]
[SEQ ID NO: 1] n; or
[Equation 2]
[SEQ ID NO 2] n,
In Formula 1 or Formula 2,

SEQ ID NO: 1 consists of [VPGXG VPGXG VPGXG VPGXG VPGXG VPGXG];
SEQ ID NO: 2 consists of [VPAXG VPAXG VPAXG VPAXG VPAXG VPAXG];
N is an integer of 1 or more and 12 or less, and is the number of repetitions of SEQ ID NO: 1 or SEQ ID NO: 2; And
X is an amino acid other than proline and is selected from any natural or artificial amino acid when the pentapeptide VPGXG or VPAXG is repeated.
The method of claim 13,
The EBP is
In said pentapeptide VPGXG or VPAXG, said V (valine) is substituted with I (isoleucine).
The method of claim 10,
Wherein said stimulatory reactive fusion polypeptide consists of one of the amino acid sequences set forth in SEQ ID NOs: 68-85.
The method of claim 10,
The stimulatory reactive fusion polypeptide,
Below the transition temperature of the irritant reactive EBP is in a viscoelastic liquid state; Above the transition temperature of the stimulus reactive EBP to form a physically cross-linked hydrogel, stimuli reactive fusion polypeptide.
Applying thermal stimulation to the stimuli responsive fusion polypeptide according to any one of claims 10, 11 and 13-15;
The thermal stimulus causes the EBP block in the stimuli reactive fusion polypeptide to thermally aggregate and the CCP block to act as a physical crosslinker to form a hydrogel;
Reversible hydrogel prepared by a process comprising the step.
A drug delivery composition comprising a hydrogel according to claim 9.
A support for tissue engineering comprising a hydrogel according to claim 9.
Kit for tissue or organ regeneration comprising a hydrogel according to claim 9.
A drug delivery composition comprising a hydrogel according to claim 17.
A support for tissue engineering comprising a hydrogel according to claim 17.
Kit for tissue or organ regeneration comprising a hydrogel according to claim 17.

Images