KR102030906B1 - Method for making composition for differentiating into chondrocyte using HLA-Homozygous CBMC-derived iPSCs composition - Google Patents

Abstract

The present invention provides a method for producing a composition for chondrocyte differentiation, which can provide a new strategy for personalized regenerative medicine using CBMC-hiPSCs of homozygotes, and the chondrocytes differentiated therefrom and the composition for chondrocyte differentiation or chondrocyte differentiation therefrom. It relates to a pharmaceutical composition for preventing or treating cartilage-related diseases comprising.
Therefore, the composition for chondrocyte differentiation or chondrocytes prepared by the method for preparing chondrocyte differentiation according to the present invention is an HLA homozygote, and the expression level of chondrocyte marker gene of a type suitable for cartilage transplantation is high. It can be usefully used for prevention, amelioration or treatment.

Description

Method for making composition for differentiating into chondrocyte using HLA-Homozygous CBMC-derived iPSCs composition} of HLA homozygotes using human pluripotent cells derived from cord blood mononuclear cells

The present invention provides a method for producing a composition for chondrocyte differentiation, which can provide a new strategy for personalized regenerative medicine using CBMC-hiPSCs of homozygotes, and the chondrocytes differentiated therefrom and the composition for chondrocyte differentiation or chondrocytes It relates to a pharmaceutical composition for preventing or treating cartilage-related diseases comprising.

Articular cartilage is an elastic white tissue that wraps around the tip of the bone and protects it from friction. Articular cartilage is an elastic white tissue that wraps around the tip of the bone and protects it from friction. Cartilage is mostly composed of various types of collagen, prothioglycans and flexible fibers, rich in chondrocytes and a large amount of extracellular matrix (ECM). Chondrocytes produce extracellular matrix compositions. In addition, because the cartilage is damaged because it is trapped in a small space called lacuna, the migration and recovery of chondrocytes becomes difficult. In addition, because cartilage is avascular tissue, there are no blood vessels for nutrition. Cartilage-free blood vessels interfere with stem cell migration and reduce tissue regeneration. These features mean that damaged cartilage is almost impossible to heal naturally. Therefore, it is important to produce functional chondrocytes capable of producing extracellular matrix in vitro or to obtain fully grown cartilage for transplantation.

 Cartilage repair is accomplished by implanting bone marrow-derived mesenchymal stem cells (BMCSs) or chondrocytes isolated from their knee joints. Since BMSCs and autologous chondrocytes have the potential to differentiate into cartilage cells, they have various advantages in cartilage formation. BMSC is relatively easy to obtain and is already widely used as a cell therapeutic composition for various diseases such as rheumatoid arthritis and osteoarthritis. However, due to the slow differentiation rate and unstable phenotype, there is a limit to restoration. Both BMSC and autologous chondrocytes tend to lose their intrinsic properties after 3-4 days in vitro. It has also been reported that the production and differentiation capacity of BMSCs depends on the age of the patient and the condition of the disease. In the case of autologous chondrocytes, damage to the knee joint is inevitable in the process of obtaining. Thus, new cell sources for cartilage repair are needed.

It is important to produce vitreous cartilage for successful cartilage transplantation. Vitreous cartilage is a flexible type of cartilage, mostly composed of type 2 collagen. Long research has shown that transplanted chondrocytes have a tendency to differentiate into hypertrophic chondrocytes, which causes fibrocartilage-like morphology rather than glass cartilage. Although cell-based therapies are commonly used in hospitals, it is not proven whether BMSCs and autologous chondrocytes can successfully repair mature human cartilage. Mature cartilage transplantation through the grafting of osteochondral cartilage may be an alternative to treating severely damaged cartilage in addition to cell-based therapy. The advantage of osteochondral grafting is the implantation of vitreous cartilage. One part of the healthy cartilage of the joint is implanted in the damaged part. Allogeneic cartilage transplantation poses a risk of rejection, which affects the success of allografts. However, osteochondral junction (mosaicplasty) is a condition for healthy donor site and transplantation. These limitations are still an important issue in cartilage regeneration and further research is needed.

Human derived pluripotent stem cells (hiPSCs) are illuminated as an alternative cell source for regenerative medicine. The discovery of hiPSCs has provided new strategies in drug screening and mechanical studies of various diseases. In addition, hiPSCs are a source of potentially relevant cells for replacing damaged tissues such as articular cartilage that have limited regeneration. Unlike BMSC and autologous chondrocytes, hiPSC is strongly recommended because of its self-renewal ability and differentiation into target cells including chondrocytes. In the proper culture environment, hiPSCs have strong potential as an alternative source of cartilage regeneration.

In the last reprogramming protocol, dermal fibroblasts were used for iPSC production. There is still limited opportunity for surgical biopsy procedures to obtain these cells for a wide range of applications. Dermal fibroblasts have been reported to have high genetic mutations due to exposure to the external environment. Blood cells have been recommended as an alternative for reprogramming. Compared with fibroblasts, peripheral blood mononuclear cells (PBMCs) are relatively possible. Reprogramming has been successful with various attempts using PBMC.

In this study, human iPSCs derived from CBMC (CBMC-hiPSCs) were tested. Recently, CBMC-hiPSCs have been successfully differentiated into cardiomyocytes and hepatocytes [Non-Patent Documents 1, 2, 3]. Previous studies have demonstrated the potential of CBMC-hiPSC in cartilage formation through micromass cultures. However, despite previous studies, there is still a need for studies on the possibility of CBMC-hiPSC differentiation into chondrocytes and cartilage regeneration. Chondrocyte pellets produced from CBMC-hiPSC can be used in clinical regenerative medicine. Cartilage regeneration was attempted with pellet culture using CBMC-hiPSC to achieve this goal. The CBMC-hiPSCs produced were aggregated into an embryoid body (EB) and mesenchymal-like growth cells were promoted by contacting the cultures in gelatin medium. Chondrocyte pellets were produced using EB growth cells.

Here, we will report a feature on how to produce cartilage-like chondrocyte pellets from CBMC-hiPSC. This will represent a potential cell source for future cartilage regeneration.

Secondly, induced pluripotent stem cells (iPSCs) can be obtained from multiple cell sources by a combination of compounds or genetic elements. Like embryonic stem cells (ESCs), iPSCs can be used endlessly in vitro and can be preserved in a multipotent state without differentiation. In addition to their self-renewal capacity, these multipotent cells can differentiate into a variety of cells. The development of iPSCs opens up new possibilities for the production of individual stem cells. Custom iPSCs have significant potential for disease modeling and regenerative medicine in cell-organ therapies. The produced iPSC has a human leukocyte antigen (HLA) that is haplotype with the donor. Therefore, iPSC is considered to be an ideal material for autoimplantation without immunorejection since it has the same immune identity. Although customized stem cell basic medicine is possible, manufacturing a single clinical level of iPSC is time consuming, expensive and expensive. The whole differentiation process also requires the same level of clinical management. Thus, these problems limit the commercialization of custom iPSCs.

Thus, there is a need for an alternative system that can cover a large portion of the population with minimal cell lines. This alternative system should have a low risk of allograft rejection when used in many patients. The history of successful organ and hematopoietic stem cell transplantation has confirmed the importance of the HLA gene, which is directly related to the individual's immune identity. In 2005 it was recommended to reduce the cell lines required to store ESCs separately from HLA-homozygous individuals. This storage system requires only cells that are homozygous from the donor with one HLA-A, -B and DRB1 haplotype. These three gene subsets are of paramount importance in reducing HLA location and rejection potential. This strategy has been applied to the settlement of iPSC storage.

Recently, attempts have been made to establish homozygous iPSC banks that can cover the largest range of populations in various countries. In a recent study, models of homozygous iPSC banks could cover California's multi-ethnic and mixed race population. Based on various combinations of haplotypes of five families (Black / African American, American Indian, Asian / Pacific Islander, Hispanic and Caucasian / Non-Hispanic), the probability of population agreement was calculated. Given all cis (plote level) and trans (genotype level) agreements, the model was generated to reflect the detailed calculations between the iPSC haplotype bank and the receptor population. In Japan, it was calculated earlier that 50 of the 24,000 population could cover 90.7% of the Japanese population. A more recent study in Japan calculated that 140 donors were needed to cover 90% of the population. However, in order to achieve this goal, 160,000 Japanese applicants had to be screened.

Therefore, the inventors categorized homozygous HLA-A, -B and DRB1 types that can cover the Korean (South) population to the maximum using the data of the Catholic Hematopoietic Stem Cell Bank. CBMC and PBMC were obtained from donors for clinical iPSC production and reprogrammed according to good drug manufacturing practice. This study is the first report on a homozygous iPS cell line in Korea, supported by the Korean government for research and clinical trials.

 Li Y, Liu T, Van Halm-Lutterodt N, Chen J, Su Q, Hai Y: Reprogramming of blood cells into induced pluripotent stem cells as a new cell source for cartilage repair. Stem Cell Research & Therapy 2016, 7: 1-11.  Pham TL, Nguyen TT, Van Bui A, Nguyen MT, Van Pham P: Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology 2016, 68: 645-658.  3Stecklum M, Wulf-Goldenberg A, Purfurst B, Siegert A, Keil M, Eckert K, Fichtner I: Cell differentiation mediated by coculture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cell Dev Biol Anim 2015, 51: 183-191.  Guzzo RM, Scanlon V, Sanjay A, Xu RH, Drissi H: Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev 2014, 10: 820-829.  Nejadnik H, Diecke S, Lenkov OD, Chapelin F, Donig J, Tong X, Derugin N, Chan RC, Gaur A, Yang F, et al: Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev 2015, 11: 242-253.  Guzzo RM, Gibson J, Xu RH, Lee FY, Drissi H: Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem 2013, 114: 480-490.

Accordingly, the present inventors have confirmed the self-renewal ability and multi-differentiation ability of cord blood mononuclear cell-derived hiPSC (CBMC-hiPSC) derived from cord blood mononuclear cells, and completed the present invention which can be used for regeneration of cartilage using the cord blood mononuclear cell-derived hiPSC.

Accordingly, an object of the present invention is to provide a method for preparing chondrocyte differentiation using an embryoid body from cord blood mononuclear cell-derived human pluripotent cells (CBMC-hiPSC).

Another object of the present invention to provide a composition for chondrocyte differentiation prepared from the method for producing a composition for chondrocyte differentiation.

Another object of the present invention to provide a chondrocyte differentiated from the composition for chondrocyte differentiation.

Another object of the present invention to provide a pharmaceutical composition for preventing or treating cartilage-related diseases using the composition for chondrocyte differentiation.

Still another object of the present invention is to provide a pharmaceutical composition for preventing or treating cartilage-related diseases using the chondrocytes.

In order to achieve the above object, the present invention provides a method for preparing a composition for differentiating chondrocytes comprising the following steps:

Iii) forming and obtaining an embryoid body from cord blood mononuclear cell-derived human pluripotent cells (CBMC-hiPSC);

Ii) forming and obtaining embryoid body-derived outgrowth cells from the culture of step iii); And

Iii) culturing the growth cells of step ii) to obtain chondrogenic pellets.

According to one preferred embodiment of the present invention, the cord blood mononuclear cell-derived human pluripotent cells (CBMC-hiPSC) of step iii) can be obtained by reprogramming cord blood mononuclear cells.

According to another preferred embodiment of the present invention, the reprogramming may be to induce into pluripotent cells by treating Sendai virus containing the Yamanaka factor in the cord blood mononuclear cells.

According to another preferred embodiment of the present invention, the growth cells of step ii) may be formed by plating a culture in gelatin medium.

According to another preferred embodiment of the present invention, it may be to smear 50 to 70 cultures per 1 cm 2 of the gelatin medium.

According to another preferred embodiment of the present invention, the umbilical cord monocyte-derived human pluripotent cells of step iii) may be HLA homozygotes.

According to another preferred embodiment of the present invention, the type of HLA homozygote may be one of Korean HLA homozygote.

According to another preferred embodiment of the present invention, the type of HLA homozygote of Korean may be any one selected from the group consisting of HLA-A * 33, HLA-B * 44 and HLA-DRB1 * 13.

In another aspect, the present invention can provide a composition for chondrocyte differentiation prepared from the method for producing a composition for chondrocyte differentiation.

According to a preferred embodiment of the present invention, the composition for chondrocyte differentiation may be one or more genes selected from the group consisting of ACAN, COL2A1, COMP and SOX9 is increased.

According to another preferred embodiment of the present invention, the chondrocyte differentiation composition may have a gene expression level of COL1A1 or COL10 lower than the gene expression level of COL2A1.

In another aspect, the present invention can provide a chondrocyte differentiated from the composition for chondrocyte differentiation.

According to a preferred embodiment of the present invention, the chondrocytes may be one or more gene expression is increased selected from the group consisting of ACAN, COL2A1, COMP and SOX9.

According to another preferred embodiment of the present invention, the chondrocyte may have a gene expression level of COL1A1 or COL10 lower than the gene expression level of COL2A1.

In another aspect, the present invention may provide a pharmaceutical composition for preventing or treating cartilage-related diseases including the chondrocyte differentiation composition or chondrocytes.

According to a preferred embodiment of the present invention, the cartilage-related disease may be one or more selected from the group consisting of rheumatoid arthritis, osteoarthritis, osteomalacia, cartilage damage and cartilage defect.

Therefore, the composition for chondrocyte differentiation or chondrocytes prepared by the method for preparing chondrocyte differentiation according to the present invention is an HLA homozygote, and the expression level of chondrocyte marker gene of a type suitable for cartilage transplantation is high. It can be usefully used for prevention, amelioration or treatment.

1 is a result of the line characteristics of the three CBMC-hiPSC, (a) is a morphological result of the resulting CBMC-hiPSC line and (b) is a result showing that the CBMC-hiPSC stained with alkaline phosphatase, ( c) is the relative expression of pluripotency markers in the CBMC-hiPSC line, (d) is an image result showing the immunofluorescence staining of the generated CBMC-hiPSC line.
Figure 2 is the production of cartilage forming pellets using CBMC-hiPSCs, (a) is a schematic of cartilage pellet production, (b) is a morphological result of CBMC-hiPSC, (c) is a morphological result of the generated EB (D) is an image result of EB-derived growth cells attached to a gelatin coated culture dish, and (e) is an image showing an image of cartilage pellets.
FIG. 3 shows the genetic characteristics of cartilage forming pellets generated from CBMC-hiPSC, showing the expression levels of COL2A1, ACAN, COMP and SOX9 in cartilage forming pellets for 10, 20 and 30 days (*, + p <0.05, **, ++ p <0.01, ***, +++ p <0.001).
4 is a histological analysis of CBMC-hiPSC-derived cartilage forming pellets, with safranin O, alcian blue and toluidine blue at 10, 20 and 30 days. The result is a stained pellet image.
5 is an immunohistochemical analysis of BMC-hiPSC-derived cartilage forming pellets, (a) is a result showing the images of the pellets harvested at various time points stained with antibodies to type 2 collagen and aggrecan (aggrecan) , (b) is the result showing pellet images stained with antibodies to type 1 collagen.
6 is an additional analysis of the gene markers of cartilage forming pellets derived from CBMC-hiPSCs and MSCs, (a) is a result showing the expression level of COL1A1, a representative gene of fibrocartilage and COL10, a hypertrophic marker at various time points. (b) shows the ratios of COL2A1 and COL1A1 on days 10, 20 and 30, and (c) shows ACAN, COMP, COL2A1, SOX9, COL1A1 and BMCC and CBMC-hiPSC derived cartilage pellets on day 30. Results show relative expression of COL10 (*, + p <0.05, **, ++ p <0.01, ***, +++ p <0.001).
Figure 7 shows the expression levels of cartilage formation-related factors ACAN and CLO2A1 in chondrocytes differentiated from CBMC-derived iPSCs and chondrocytes differentiated from peripheral blood cells (PBMC) -derived iPSCs according to the present invention. The result is a comparison.
8 is a result of confirming good manufacturing practice (GMP) grade homozygous human hematopoietic antigen (HLA) -induced pluripotent stem cells. Screening antigen (HLA) types and transferring selected HLA type cells to a GMP facility, reprogramming the cells into iPSCs within the facility, then passing various assays for characterization and establishing cell lines), b) is the result of immunofluorescence staining of the resulting homozygous IPSCs, (c) is the result of confirming pluripotency markers by reverse transcriptase chain reaction, and (d) is the alkaline phosphatase staining image and positive iPSC colony Colon count results, (e) is the normal karyotype result of the generated iPSC, (f) immunofluorescence staining of iPSC differentiated into three germ layers.

Way

CBMC  Separation

CBMCs were obtained from cord blood banks at St. Mary's Hospital in Seoul. Umbilical cord blood was diluted with phosphate buffered saline (PBS) and centrifuged at 850 xg for 30 minutes through a Ficoll gradient. CBMCs were collected, washed and frozen. Prior to use, frozen CBMCs were thawed and resuspended in StemSpan medium (STEMCELL Technological, Vancouver, British Columbia, Canada) supplemented with CC110 cytokine cocktail (STEMCELL). Cells were maintained at 5% CO ₂ , 37 ° C. for 5 days before reprogramming.

Blood Sample and Code of Ethics

The institutional Review Board (IRB) of the Catholic University of Korea at the St. Mary's Hospital in Seoul approved the study.

Sendai virus  Used Reprogram  (reprogramming)

Reprogramming is the process by which epigenetic marks change during the development of a mammal. In general, induced pluripotent stem cell reprogramming refers to a technique for inducing pluripotent stem cells by artificially overexpressing factors necessary for reprogramming to somatic cells. Methods for overexpressing the gene include viruses, plasmid vectors, mRNA, proteins and the like.

CBMCs were seeded in 24-well plates at 3 × 10 ⁵ concentrations. Reprogramming was induced using the CytoTune-iPS Sendai Reprogram Kit. Infection was performed with multiplex infections of 7.5 per 3 × 10 ⁵ cell infection unit. After the addition of the viral components, the cells were centrifuged for 30 minutes at 1,160 xg at 35 ° C. and then incubated at 5% CO ₂ , 37 ° C. The next day the cells were transferred to 12-well plates coated with vitronectin (Life Technologies) and precipitated by centrifugation at 1,160 × g, 35 ° C. for 10 minutes. After centrifugation, TeSR-E8 medium (STEMCELL) was added at a ratio of 1: 1. Reprogrammed cells were maintained and expanded in TeSR-E8 medium by daily medium exchange.

Alkaline phosphatase  (alkaline phosphatase Dyeing

To obtain colonies large enough for staining, 6-well plates coated with Vitronectin at 2 × 10 ³ concentrations were inoculated and expanded for 5-7 days. Staining of undifferentiated iPSC colonies was performed using an alkaline phosphatase detection kit (Millipore, Billerica, Mass., USA). Cells were washed with PBS containing 0.05% Tween-20 and fixed with 4% paraformaldehyde for 2 minutes. A dyeing reagent was prepared by mixing Fast Red Violet, Naphthol AS-BI phosphate solution and water in a 2: 1: 1 ratio. The cells were washed twice with PBST. The dyeing solution mixture was treated for 15 minutes at room temperature (RT). After incubation, cells were washed with PBST and covered with PBS to prevent drying. Stained colonies were measured under a microscope.

Immunocytochemical Staining

Six well plates coated with Vitronectin at 2 × 10 ³ concentrations were inoculated to obtain iPSC colonies large enough for staining. Medium was expanded for 5-7 days to induce iPSC colonies daily. After expansion, iPSCs were washed with PBS and fixed with 4% paraformaldehyde. Cells were permeated for 10 minutes using 0.1% triton X-100 (BIOSESANG). After infiltration, cells were blocked for 30 minutes at room temperature with PBS (PBA) containing 2% bovine serum albumin (BSA; Sigma Aldrich, St. Louis, MO, USA). Primary antibodies were diluted in PBA at the following dilution ratios; OCT4 (1/100; Santa Cruz, CA, USA), KLF4 (1/250; Abcam, Cambridge, UK), SOX2 (1/100; BioLegend, San Diego, CA, USA), TRA-1-60 (1 / 100; Millipore), TRA-1-81 (1/100; Millipore) and SSEA4 (1/200; Millipore). Primary antibodies were incubated for 2 hours at room temperature. Alexa Fluor 594- (1/400; Life Technologies) and 488-conjugated secondary antibody (1/400; Life Technologies) were diluted with PBA and incubated for 1 hour at room temperature, avoiding light. Cells were washed and mounted using ProLong Antifade mounting reagents (Thermo Fisher Scientific, Waltham, Mass., USA). Stained colonies were detected by immunofluorescence microscopy.

CBMC - iPSC  Using a sample Polymerase  (polymerase) chain reaction

⁵ × 10 ⁵ iPSCs were harvested and frozen at −20 ° C. Total mRNA was extracted using Trizol (Life Technologies) and cDNA was synthesized using Revert Aid ™ First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). Reverse transcriptase polymerization was performed using the synthesized cDNA. Primer sequences are shown in Table 1 below.

Primer Sequences for Potential Markers Used in Real-Time RT-PCR Target Name Direction Primer sequence Size OCT3 / 4 Forward  ACCCCTGGTGCCGTGAA 190 Reverse  GGCTGAATACCTTCCCAAATA SOX2 Forward  CAGCGCATGGACAGTTAC 321 Reverse  GGAGTGGGAGGAAGAGGT NANOG Forward  AAAGGCAAACAACCCACT 270 Reverse  GCTATTCTTCGGCCAGTT LIN28 Forward  GTTCGGCTTCCTGTCCAT 122 Reverse  CTGCCTCACCCTCCTTCA DPPB5 Forward  CGGCTGCTGAAAGCCATTTT 215 Reverse  AGTTTGAGCATCCCTCGCTC TDGF1 Forward  TCCTTCTACGGACGGAACTG 140 Reverse  AGAAATGCCTGAGGAAAGCA GAPDH Forward  GAATGGGCAGCCGTTAGGAA 414 Reverse  GACTCCACGACGTACTCAGC

Karyotyping Karyotyping )

Cells were incubated until it reached about 80%. Chromosomal resolution additives (Genial Genetic Solutions, Runcorn, UK) were added to each well. After incubation, colcemid® was treated for 30 minutes. Cells were harvested and treated with the solution in preheated stock solution. The mixture was fixed with a mixture of acetic acid and methanol solution in a ratio of 1: 3. Slides were prepared for chromosome analysis using trypsin-Giemsa banding technique.

iPSC  Functional identification of iPSCs )

 Human pluripotent stem cell function confirmation kit (R & D, Minneapolis, MN, USA) was purchased to evaluate the differentiation capacity of the three germ layers. One day before the experiment, Cultrex PathClear BME (R & D) was coated on the petri dish according to the manufacturer's instructions. A medium specific for each embryo layer was prepared and cells were cultured separately. After differentiation, cells were washed with PBS and fixed with 4% paraformaldehyde. Permeable and blocked for 45 minutes with 0.3% Triton X-100 and 1% PBA. Antibodies to Otx2 (1/10, ectoderm), Brachyury (1/10 mesoderm) and Sox17 (1/10, endoderm) were diluted. Suspended in PBA and incubated for 3 hours at room temperature.

After washing the primary antibody, Alexa Fluor 568 Donkey anti-goat secondary antibody (1: 200; R & D) was diluted with PBA and incubated for 1 hour. The cells were washed with PBA and the DAPI solution was treated for 10 minutes at room temperature. The cells were washed and covered with PBS. Staining results were confirmed using a fluorescence microscope.

EB  Derived growth Cell induction ( EB -derived outgrowth cell induction)

CBMC-hiPSC was expanded and 2 × 10 ⁶ cells were prepared. Cells were resuspended in Aggrewell medium (STEMCELL) and plated in 100-mm petri dishes. Cells were incubated at 5% CO ₂ , 37 ° C. for one day. The next day, the medium was changed to TeSR-E8 medium and the cells were kept inflated for 6 days. After the expansion process, EBs were harvested and resuspended in DMEM containing 20% fetal bovine albumin (FBS) and placed on gelatin coated dishes to induce growth cells. Cells were maintained at 37 ° C. with 5% CO ₂ for one week before cartilage differentiation.

EB  Cartilage Differentiation Using Derived Growth Cells Chondrogenic  differentiation using EB -derived outgrowth cells)

Growth cells derived from EB were washed and isolated from the culture dish. The cell mass was removed by passing through a 40 μm cell strainer (Thermo Fisher Scientific). Single growing cells were counted and 3 x 10 ⁵ cells were prepared per pellet. 3 x 10 ⁵ growth cells were cultured in cartilage differentiation medium (DMEM, 20% knockout serum replacement, 1x non-essential amino acids, 1 mM L-glutamine, 1% sodium pyruvate, 1% ITS + Premix, 10 ^-7 M dexamethasone, 50 μm Ascorbic acid, 40 ㎍ / mL L-proline, supplemented with 50ng / mL human bone morphogenetic protein 2 and 10ng / mL human transforming growth factor beta 3), was incubated in conical tubes. Cells were centrifuged at 750 xg for 5 minutes. The resulting pellets were kept for 30 days and the cultures were changed daily. BMSC was used as a positive control.

Cartilage formation Pellet  Histological analysis

The pellet was fixed for 2 hours at room temperature using 4% paraformaldehyde. One layer of gauze was placed in a cassette and the pellet transferred to gauze. Dehydration was performed sequentially with ethanol solution. The dehydration solution was removed with a graded mixture of ethanol and xylene (Ducksan Pure Chemical, Ansan, Korea) and paraffin infiltrated overnight. The next day the pellets were fixed in paraffin blocks and 7 μm sections were obtained using a microtome. The slides were dried at 60 ° C. for 2 hours. Sections were deparaffinized with 2 cycles of xylene. Sections were rehydrated with decreasing sequential ethanol cereal and washed with tap water for 5 minutes.

Sections were incubated in 1% alcian blue solution for 30 minutes for alcian blue staining. The slides were then washed and counterstained with nucleus fast red for 1 minute. Safranin O staining was performed by incubating slides for 10 minutes in Weigert's iron hematoxylin. The slides were washed and incubated for 5 minutes in 0.1% safranin O solution.

Sections were incubated for 4 minutes in toluidine blue solution for toluidine staining. After the staining process, sections were washed and passed through an increasing series of ethanol. Remove ethanol with 2 cycles of xylene and slide the VectaMount ^TM Fixed using PermanentMountingMedium (VectorLaboratories). Staining was confirmed under a microscope.

Immunohistochemistry

Sections were dried at 60 ° C. for 2 hours and deparaffinized with 2 cycles of xylene. Sections were rehydrated with decreasing sequential ethanol cereal and washed with tap water for 5 minutes. Antigen unmasking was induced by incubation in citrate buffer for 15 minutes and cooling for 20 minutes. The cooled sections were washed twice with deionized water (DW). The activity of endogenous peroxidase was blocked by incubating sections in 3% hydrogen peroxide diluted for 10 minutes with DW. Sections were washed twice with DW and then further washed with Tris buffered saline (TBS) containing 0.1% Tween-20 (TBST). Sections were blocked for 20 minutes at room temperature with TBS containing 1% BSA. Primary antibodies diluted with blocking solution were added to the sections and incubated overnight at 4 ° C. Primary antibodies were diluted in the following ratios; Collagen type 1 (1/100, Abcam), type 2 collagen (1/100, Abcam) and agrican (1/100, GeneTex, Irvine, CA, USA). Negative control slides were treated with the same amount of blocking solution without antibody. The next day, sections were washed three times for 3 minutes each in TBST and the secondary antibody (1/200) was incubated for 40 minutes at room temperature. Sections were washed with TBST and ABC reagents and incubated for 30 minutes. Slides were washed three times with TBST and DAB solution (Vector Laboratories) was applied for 1 minute. Sections were washed with DW until the color was washed. Mayer's hematoxylin was applied to the sections for 1 minute for counter staining. Sections were washed and passed through an increasing series of ethanol. Ethanol was removed with 2 cycles of xylene and slides were mounted using VectaMount ^™ Permanent Mounting Medium (Vector Laboratories). Staining was confirmed by bright field microscope.

Of cartilage forming pellets Polymerase (Polymerase) reaction

Ten cartilage forming pellets were harvested at each time point and frozen at -80 ° C. Samples were snap frozen with liquid nitrogen and ground with a pestle. Ground pellet samples were incubated with Trizol for mRNA extraction. CDNA was synthesized from the extracted mRNA, and polymerase chain reaction was performed with primers for chain cell specific markers. Primer sequences of RT-PCR are shown in Table 2. Primer sequences of real-time PCR are shown in Table 3 below. The threshold of average cycles obtained from triplicate experiments was used to calculate gene expression for averaging GAPDH as an internal control.

Sequence of primers for cartilage markers in RT-PCR Target Name Direction Primer sequence Size SOX9 Forward GAACGCACATCAAGACGGAG 631 Reverse TCTCGTTGATTTCGCTGCTC ACAN Forward TGAGGAGGGCTGGAACAAGTACC 349 Reverse GAGGTGGTAATTGCAGGGAACA COL2A1 Forward TTCAGCTATGGAGATGACAATC 472 Reverse AGAGTCCTAGAGTGACTGAG COMP Forward CAACTGTCCCCAGAAGAGCAA 588 Reverse TGGTAGCCAAAGATGAAGCCC COL1A1 Forward CCCCTGGAAAGAATGGAGATG 148 Reverse TCCAAACCACTGAAACCTCTG COL10 Forward CAGTCATGCCTGAGGGTTTT 196 Reverse GGGTCATAATGCTGTTGCCT GAPDH Forward GAATGGGCAGCCGTTAGGAA 414 Reverse GACTCCACGACGTACTCAGC

Sequence of primers for cartilage markers in RT-PCR Target Name Direction Primer sequence Size SOX9 Forward TTCCGCGACGTGGACAT 77 Reverse TCAAACTCGTTGACATCGAAGGT ACAN Forward AGCCTGCGCTCCAATGACT 107 Reverse TAATGGAACACGATGCCTTTCA COL2A1 Forward GGCAATAGCAGGTTCACGTACA 79 Reverse CGATAACAGTCTTGCCCCACTTA COMP Forward AGCAGATGGAGCAAACGTATTG 76 Reverse ACAGCCTTGAGTTGGATGCC COL1A1 Forward CCCCTGGAAAGAATGGAGATG 148 Reverse TCCAAACCACTGAAACCTCTG COL10 Forward CAGTCATGCCTGAGGGTTTT 196 Reverse GGGTCATAATGCTGTTGCCT

result

Separated CBMC  Used hiPSC  produce

Reprogramming of CBMCs was facilitated using Sendai virus containing the Yamanaka factor. Yamanaka factor is a gene capable of inducing pluripotency. After transduction, CBMC-hiPSCs formed colonies similar to embryonic stem cells (FIG. 1A). CBMC-hiPSC was purified into cell lines with the same cell morphology. The same CBMC-hiPSC was used for further characterization. Confirmed CBMC-hiPSC was stained with alkali phosphate (FIG. 1B). Expression of multipotent markers including OCT4, SOX2, NANOG, LIN28, KLF4 and c-MYC was also measured (FIG. 1C). The parent CBMC was used as a negative control. Expression of OCT4, SOX2, NANOG, LIN28 was increased in CBMC-hiPSC. However, expression of KLF4 and c-MYC was less in CBMC-hiPSC than in CBMC. Typical cell surface markers (SSEA4, OCT4, SOX2, KLF4, TRA-1-80 and TRA-1-60) were confirmed by immunochemical analysis (FIG. 1D). All differentiated cell lines expressed markers that became the standard of pluripotency. After reprogramming, CBMC-hiPSC maintains normal karyotype and differentiates into various germ cells. These data indicate that CBMC-hiPSC has been successfully generated and has multiple versatility.

CBMC - iPSCs  Differentiation into chondrocytes

To confirm the cartilage regeneration ability of CBMC-iPSC, cartilage differentiation was performed through EB culture and growth cell induction. A simple scheme of cartilage differentiation pellet generation process is shown in Figure 2a. CBMC-iPSCs colonies were prepared for cartilage hatching (FIG. 2B). CBMC-iPSCs were expanded and aggregated into EBs (FIG. 2C). EB expanded for several days and was transferred to gelatin koi petri dishes and induced to growth cells (2d). Growth cells were expanded and divided into single cells for chondrocyte differentiation. 2X10 ⁶ Using iPSc, numerous cartilage forming pellets were obtained. After 30 days of differentiation, cartilage forming pellets were formed using EB growth cells. The resulting cartilage forming ferret showed a three-dimensional spheroidal shape. From the above, it was confirmed that CBMC-hiPSCs can differentiate into chondrocytes and form a spheroidal cartilage by ECM accumulation.

Cartilage formation Pellet  Confirmation of cartilage gene expression

Through the previous process, cartilage blood pellets were successfully produced from CBMC-hiPSC. The differentiated cells also synthesized ECM components and showed cartilage-like characteristics. Expression of major ECM constituent proteins such as Aggrecan (ACAN), type 2 collagen (COL2A1) and cartilage oligomer matrix protein (COMP) was confirmed at 10, 20 and 30 days, respectively. As a result, it was confirmed that the expression of ACAN, COL2A1 and COMP is increased (Fig. 3). Sox9 (Sex-determining region Y-box 9) is known as an early cartilage differentiation marker and transcription factor that regulates gene expression of ECM proteins. After 20 days, the expression of Sox9 increased. That is, the genetic characteristics of the resulting cartilage pellets were confirmed. Corresponding to the cartilage-like morphology, an increase in gene expression of the major ECM component proteins was identified.

Of cartilage forming pellets  Histological characteristics

As confirmation of increased cartilage marker expression, protein levels of cartilage pellets produced from CBMC-hiPSCs were evaluated by histological analysis (FIG. 4). Safranin O, alcian blue and toluidine blue staining are staining methods used for ECM detection in cartilage. As a result of the staining, ECM accumulation was confirmed in the inner part of the pellet even in the early stage of differentiation (day 10). Lacunae is one of the main features of articular cartilage. Empty bone-bearing capacity was seen after 10 days. However, the size decreased as the differentiation progressed. At 30 days of differentiation, ECM accumulates in the capacity, and it appears to be osteoporotic in articular cartilage. At 30 days, the intensity of staining was almost the same.

The quality of cartilage is determined by the major type of ECM protein. Therefore, it is important to identify specific proteins. Aggrecan and type 2 collagen proteins are known to be the major constituents of ECM. Type 2 collagen is the major collagen type that represents vitreous cartilage. Antibodies against collagen type 2 and agrican were stained on cartilage differentiation pellets (FIG. 5A). The staining intensity of type 2 collagen was higher in CBMC-hiPSC derived cartilage forming pellets than the MSC control. Corresponding to previous staining results, agrican and type 2 collagen were mostly detected inside the pellets on day 30. The main feature of fibrocartilage is the high expression of type 1 collagen. It was confirmed that the cartilage forming pellets did not have the predominant characteristics of fibrous cartilage (FIG. 5B). Expression of type 1 collagen was relatively higher than that of MSC control mice. However, expression remained constant and did not increase significantly during differentiation. Cartilage forming pellets produced from CBMC-hiPSCs are characterized by similar characteristics to the pellets derived from MSC after 30 days of differentiation. Chondrocytes differentiated from CBMC-hiPSCs were able to produce ECM component proteins. The cartilage forming pellets derived from CBMC-hiPSC had higher expression of type 2 collagen than type 1 collagen. In conclusion, we confirmed that CBMC-hiPSCs can produce cartilage-like features similar to those of glassy cartilage.

CBMC - hiPSCs  And In MSCs  Cartilage formation resulting Pellet  gene Marker  analysis

Collagen is the most abundant protein that makes up ECM. There are many different types of collagen, but type 1 and 2 collagen is mainly associated with cartilage. In previous experiments, the expression of collagen type 1 and type 2 collagen was confirmed by histological analysis (FIGS. 5A and 5B). Based on the above results, the expression of the type 1 collagen (COL1A1) gene was analyzed (FIG. 6A). The gene expression of collagen type 10 (COL10), a protein known as the dominant type expressed in hypertrophic cartilage, was also analyzed. Histochemical staining confirmed stable expression of type 1 collagen. However, expression of COL1A1 decreased at each time point. Expression of COL10 did not change during the differentiation process. As mentioned earlier, the ratio of type 2 collagen can change the resulting properties of cartilage forming pellets. Previous gene expression data were used to assess the gene expression ratio of COL2A1 to COL1A1 (FIG. 6B). The total growth rate indicates a high expression of supernatural bone genes for fibrocartilage genes. CBMC-hiPSC-derived cartilage forming pellets were compared with cartilage forming pellets produced in BMSC on day 30 using real time PCR (FIG. 6C). There was no statistical significance of ACAN expression between the two samples. The expression of COL2A1 and SOX9 was significantly higher in cartilage pellets differentiated from CBMC-hiPSC compared to BMSC derived pellets. However, COMP was highly expressed in MSC control pellets. The expression of the fibrous marker COL1A1 was also higher in the MSC control pellets. However, the expression of the hypertrophic marker COL10 was markedly low in CBMC-hiPSC derived cartilage forming pellets. These results highlight the potential of CBMC-hiPSC as a potential cell source for cartilage regeneration for future applications.

Review

Regeneration of damaged articular cartilage due to joint-related diseases, trauma or trauma is still a clinical issue. At this time, since human iPSCs provide new possibilities for tailored medicines, studies related to cartilage formation have been made using iPSCs obtained from stem cells of various bodies.

We reprogrammed CBMC into iPSC using Sendai virus mediators containing Yamanaka factor (FIG. 1A). Because of the existence of cord blood banking systems around the world, CBMC is widely used. The transition from cord blood banks to iPSC banks for allogeneic regenerative medicine has tremendous potential and potential. Based on data on the HLA phenotype, the CBMC-based iPSC banking system can provide an efficient strategy for cell therapy through cell line construction of homozygous HLA type iPSCs. Homozygous cell lines can be widely used in treatment with minimal material or cell lines. This concept is equally applicable to cartilage regeneration. Cartilage production using the HLA-homozygous iPSC line can eliminate immune rejection during allografts. Therefore, the use of CBMC-iPSC is a very efficient application for future cartilage transplantation. Many reports suggest that the origin of somatic cells used for reprogramming can affect developmental and differentiation capacity. Previous studies have shown the potential of CBMC-iPSC in cartilage formation through micromass culture [Non-Patent Document 4]. It consisted of one CBMC-iPSC line and two cartilage joint-derived iPSC lines. Further experimentation is required to demonstrate that CBMC-iPSC is an ideal cell source for cartilage regeneration. We attempted cartilage differentiation using CBMC-iPSC (n = 3) and analyzed the possibility of cartilage regeneration through various experiments. Cartilage differentiation was performed through pellet culture for later application to transplants.

Prior to the differentiation step, the characteristics of the produced CBMC-iPSCs were analyzed. The characteristics of undifferentiated stem cells were confirmed by staining alkali phosphates (FIG. 1B). Increased expression of multipotency markers was confirmed by immunochemical and cytogenic experiments (FIGS. 1C and 1D). All cell lines were able to differentiate into their respective germ layers and showed normal karyotypes.

 Cartilage differentiation is carried out in two important steps: induction of mesenchymal-like growth cells and cartilage pellet production. It has been found in previous studies that growth cells generated in hiPSCs are functionally and molecularly similar to autologous MSCs (Non Patent Literatures 5 and 6). They used either monolayer culture or EB culture as a pre-differentiation step to induce mesenchymal-like progenitor cells. However, direct differentiation through monolayer culture was more time consuming than EB. Morphology and differentiation of mesenchymal-like progenitor cells varied significantly with cell density.

Considering all of these, we used EB to induce mesenchymal-like growth cells (FIG. 2A). Large amounts of EB were prepared using only 2 × 10 ⁶ cells (FIG. 2B). EB preserved in gelatin medium was plated to prepare and expand the growth cells. Smearing 50-75 EB per cm ² is appropriate for growth cells of suitable density (FIG. 2C). Cartilage pellets are obtained through pellet culture using growth cells (FIG. 2D). This gave a total of 50-100 pellets (FIG. 2E). However, the quality of the cartilage pellets produced is just as important as the quantity. Expression of several specific genes associated with the ECM protein was confirmed (FIG. 3C). ACAN is a prothioglycan that aggregates in ECM and induces interaction with hyaluronan. COL2A1 is the basic protein for vitreous cartilage and represents the hypertrophic character of healthy cartilage. The expression of ACAN and COL2A1 increased significantly on day 10. The expression of COMP, a non-collagenic ECM, increased rapidly on day 20. Overexpression of COMP increased levels of ACAN and COL2A1, but had no effect on the expression of early cartilage marker SOX9. In our study, however, SOX9 expression increased in the same pattern as COMP. It was confirmed that ECM constituents were aggregated as much as cartilage produced from MSC at 30 days by various methods of specifically staining cartilage (FIG. 4).

After producing cartilage, it is important to separate vitreous cartilage from fibrocartilage. Fibrous or hypertrophic cartilage is a more mature type that tends to differentiate into bone. Cartilage pellets produced from CBMC-hiPSC showed a relatively low expression of hypertrophic markers (FIG. 5, FIG. 6). During differentiation, the expression of COL1A1 decreased, whereas the expression of COL2A1 increased.

Cartilage pellets from CBMC-hiPSC and pellets from BMSC were compared on day 30 (FIG. 6C). Expression of COL2A1 and SOX9 was markedly increased in pellets obtained from CBMC-hiPSC. Interestingly, the expression of COMP was higher in cartilage pellets obtained in BMSC. In addition, expression of COL1A1 and COL10 was increased in pellets obtained from BMSC. COMP was thought to be an important protein in tendons and cartilage. It is a protein that decorates the surface of collagen type 1 fibrils, and provides a direct linkage between type 1 collagen and type 12 collagen. It is also an indicator of cartilage injury. In recent years, COMP has been considered as a biological marker for several diseases that show high cartilage turnover, such as rheumatoid arthritis or scleroderma. This means that CBMC-hiPSC may have fewer features of fibrous or glassy cartilage compared to BMSC derived cartilage pellets.

We confirmed that cartilage regeneration using CBMC-hiPSC showed a healthy phenotype and could be considered during tissue regeneration and transplantation. Yet shorter differentiation times are needed for this application. Further research is needed to assure high vitreous cartilage, and further application of CBMC-hiPSC for cartilage transplantation is necessary.

CBMC  origin from iPSC  Of differentiated chondrocytes Eruption  Confirm increase effect

The present inventors induce chondrocyte differentiation using iPSC derived from peripheral blood cells (PBMC) and iPSC derived from CBMC of the present invention in order to confirm that the differentiation capacity can be improved in the chondrocyte differentiation method of the present invention. Each chondrocyte was obtained after differentiation, from which the expression levels of ACAN and COL2A1 involved in cartilage formation were confirmed.

As a result, as shown in FIG. 7, the expression levels of ACAN and AOL2A1 were increased about 6 to 10 times higher than those of PMBC-derived chondrocytes in CBMC-derived chondrocytes. It was confirmed that the efficiency increased.

Manufactured iPSC  Determine if homozygous

In order to confirm whether the prepared CMC-hiPSC is a homozygous (homozygote), allele types of Human Leukocyte Antigen (HLA) were analyzed for three cell lines of CMC-derived iPSC. As a result, as shown in the following [Table 4] to [Table 6], it was confirmed that the CMC-hiPSC prepared by the method of the present invention is a homozygous conjugate.

Accordingly, chondrocytes differentiated using the CMC-iPSC of the present invention can be used in the form of chondro beads to prepare cartilage tissue, and the success rate of transplantation can be increased.

HLA test (SBT) results HLA-A HLA-B HLA-C DRB1 DQB1 DPB1 CMC-hiPSC-
008 * 33: 03 (A33) * 44: 03 (B44) - * 13: 02 - - * 33: 03 (A33) * 44: 03 (B44) - * 13: 02 - -

HLA test (SBT) results HLA-A HLA-B HLA-C DRB1 DQB1 DPB1 CMC-hiPSC-
009 * 24: 02 (A24) * 07: 02 (B7) - * 01: 01 - - * 24: 02 (A24) * 07: 02 (B7) - * 01: 01 - -

HLA test (SBT) results HLA-A HLA-B HLA-C DRB1 DQB1 DPB1 CMC-hiPSC-
008 * 11: 01 (A11) * 15: 01 (B62) - * 04: 06 - - * 11: 01 (A11) * 15: 01 (B62) - * 04: 06 - -

For iPSC generation, we chose a homozygous type that would account for the highest proportion of the Korean population. However, Korean HLA types are treated as confidential due to privacy laws. In this study, we analyzed HLA type information of legally donated CBMCs stored in the Catholic Hematopoietic Stem Cell Bank. As shown in Table 7 below, information on the top 20 HLA types was obtained. HLA-A * 33, HLA-B * 44 and HLA-DRB1 * 13 accounted for about 23.97% of the entire CBMC bank, being the most frequent homozygous HLA type. The second frequent type was HLA-A * 33, HLA-B * 58, HLA-DRB1 * 13, which recorded 11.16% of the estimated population. In the top five, the coverage of the HLA type was less than 5%. Of the three HLA types, HLA-A tended to be more concentrated than the other two types. Of the 20 selected HLA types, 25% had HLA-A type of * 33 and 40% had * 02 type.

Based on the information of the sorted HLA type, nine homozygous cells were selected from the Catholic Hematopoietic Stem Cell Bank for recombination. In addition, four PBMC samples with homozygous HLA type were obtained. As shown in Table 8 below, three of a total of 13 cell samples had HLA types of HLA-A * 33, HLA-B * 44 and HLA-DRB1 * 13. The obtained cells were transferred to the GMP facility of the Catholic Cell Therapy Research Institute for reprogramming. After treatment with the Yamamanaka factors, intact samples were isolated and characterized by various assays. Survival was measured based on cell adhesion. Pluripotency was confirmed by PCR and immunofluorescence. Undifferentiated state of the cells was confirmed by alkaline phosphatase staining. Karyotyping and short tandem repeat assays were performed to confirm normal genetic background. Finally, their differentiation was confirmed through differentiation into individual embryonic layers, and infection tests were performed. After this procedure, only cells that passed all quality control tests were stored in a GMP facility (FIG. 8A).

After some subcloning, all cell lines showed the proper form of iPSC. Homozygous HLA-iPSCs showed positive expression of pluripotency markers (FIGS. 8B and 8D). All cells remained undifferentiated during subculture (FIG. 8C). Normal karyotype was confirmed in the cell line (FIG. 8E). In addition, the resulting cells were able to differentiate into all three embryonic layers in vitro (FIGS. 8F and 8G). The data disclosed in FIG. 8 shows data of the CMC-hiPSC-001 cell line.

Generation of homozygous HLA-iPSCs has opened new opportunities in the development of personalized regenerative medicine. By reducing the time, money and manpower required, homozygous HLA-iPSCs can treat large numbers of patients with minimal cell sources. Depending on the HLA phenotype allele frequency, candidate HLA homozygous cell types can be selected and retained by the iPSC Resource Bank. However, homozygous cells are not frequently found, so it is important to estimate the minimum or appropriate number of iPSCs that make up the largest percentage of the population.

As a result, we established an alternative method for the frequency of homozygous HLA type in the Korean population. We first accessed the HLA-type CBMC library of the Catholic Cell Therapy Group. The CBMC Bank confirmed that 23.9% of HLA-Homozygous CBMCs in the bank exhibited the phenotypes of HLA-A * 33, HLA-B44 and HLA-DRB1 * 13. Homozygous single cells were screened through the data produced and the cells were reprogrammed to obtain iPSC. A homozygous HLA-hiPSC of HLA-A * 33, HLA-B44 and HLA-DRB1 * 13 was produced. The 13 produced HLA-iPSC lines had high multipotency and normal karyotypes and passed several contamination tests. This is the first result of Koreans' homogeneous HLA-iPSC banking with the support of the Korean government. Homozygous HLA-iPSCs will open new opportunities for successful regenerative medicine and clinical stem cell therapy.

Claims (18)

Iii) forming an embryoid body from cord blood mononuclear cell-derived human pluripotent cells (CBMC-hiPSC) derived by reprogramming cord blood mononuclear cells into a Sendai virus containing Yamanaka factor. Obtaining;
Ii) forming and obtaining embryoid body-derived outgrowth cells from the culture of step iii); And
Iii) culturing the growth cells of step ii) to obtain vitreous chondrogenic pellets;
Method for producing a composition for differentiating vitreous chondrocytes comprising a.
delete delete The method of claim 1, wherein the growth cells of step ii) are formed by plating a culture on gelatin medium.
The method for preparing a composition for differentiating vitreous chondrocytes according to claim 4, wherein 50 to 70 cultures are formed per 1 cm 2 of the gelatin medium.
The method of claim 1, wherein the umbilical cord monocyte-derived human pluripotent cells of step iii) are HLA homozygotes (homozygote).
The method of claim 6, wherein the type of HLA homozygote is a type of HLA homozygote of Korean.
8. The composition for differentiating vitreous chondrocytes according to claim 7, wherein the type of HLA homozygote of Korean is any one selected from the group consisting of HLA-A * 33, HLA-B * 44 and HLA-DRB1 * 13. Manufacturing method.
A composition for differentiating vitreous chondrocytes prepared from the method for preparing a composition for differentiating vitreous chondrocytes of claim 1
The composition is a composition for differentiating vitreous chondrocytes characterized in that the gene expression level of COL1A1 or COL10 is lower than the gene expression level of COL1A1 or COL10 of the human pluripotent cells of claim 1.
The composition for differentiating vitreous chondrocytes according to claim 9, wherein the composition for vitreous chondrocyte differentiation is increased in expression of one or more genes selected from the group consisting of ACAN, COL2A1, COMP and SOX9.
delete A glassy chondrocyte differentiated from the composition for differentiating vitreous chondrocytes of claim 9,
The chondrocytes are glass chondrocytes, characterized in that the gene expression level of COL1A1 or COL10 is lower than the gene expression level of COL1A1 or COL10 of the human pluripotent cells of claim 1.
13. The vitreous chondrocytes according to claim 12, wherein the chondrocytes have increased expression of one or more genes selected from the group consisting of ACAN, COL2A1, COMP and SOX9.
delete A pharmaceutical composition for preventing or treating cartilage-related diseases comprising the composition for differentiating vitreous chondrocytes of claim 9.
A pharmaceutical composition for preventing or treating cartilage-related diseases comprising the vitreous chondrocytes of claim 12.
The pharmaceutical composition for preventing or treating cartilage-related diseases according to claim 15, wherein the cartilage-related disease is at least one selected from the group consisting of rheumatoid arthritis, osteoarthritis, osteomalacia, cartilage damage and cartilage defect.
17. The pharmaceutical composition for preventing or treating cartilage related diseases according to claim 16, wherein the cartilage related diseases are any one or more selected from the group consisting of rheumatoid arthritis, osteoarthritis, osteomalacia, cartilage damage and cartilage defect.

Images