KR102022120B1 - Pharmaceutical composition for treatment of obesity comprising delphinidin or pharmaceutically acceptable salts thereof as an effective component - Google Patents

Pharmaceutical composition for treatment of obesity comprising delphinidin or pharmaceutically acceptable salts thereof as an effective component Download PDF

Info

Publication number
KR102022120B1
KR102022120B1 KR1020150157142A KR20150157142A KR102022120B1 KR 102022120 B1 KR102022120 B1 KR 102022120B1 KR 1020150157142 A KR1020150157142 A KR 1020150157142A KR 20150157142 A KR20150157142 A KR 20150157142A KR 102022120 B1 KR102022120 B1 KR 102022120B1
Authority
KR
South Korea
Prior art keywords
del
cells
treatment
obesity
present
Prior art date
Application number
KR1020150157142A
Other languages
Korean (ko)
Other versions
KR20170054686A (en
Inventor
김용식
나이므르 라만
전미소
Original Assignee
순천향대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 순천향대학교 산학협력단 filed Critical 순천향대학교 산학협력단
Priority to KR1020150157142A priority Critical patent/KR102022120B1/en
Publication of KR20170054686A publication Critical patent/KR20170054686A/en
Application granted granted Critical
Publication of KR102022120B1 publication Critical patent/KR102022120B1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/332—Promoters of weight control and weight loss

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of obesity containing delphinidin (Del) and its pharmaceutically acceptable salts as an active ingredient, a dietary supplement and the active ingredient to cells, thereby forming fat in cells. A method for causing various physiological changes associated with inhibition. As the active ingredient of the present invention, delphinidin and its pharmaceutically acceptable salts effectively inhibit triglyceride accumulation in cells without promoting side effects and promote intracellular lipolysis, and thus, drugs and health for the prevention or treatment of obesity. It is highly likely to be developed as a functional food, and furthermore, when the active ingredient of the present invention is treated in a cell, various physiological and chemical change environments related to intracellular fat formation may be formed, and thus, it may be actively used for research on development of related therapeutic agents such as obesity. .

Figure 112015109206435-pat00004

Description

Pharmaceutical composition for the prevention or treatment of obesity containing delphinidin and its pharmaceutically acceptable salts as an active ingredient {PHARMACEUTICAL COMPOSITION FOR TREATMENT OF OBESITY COMPRISING DELPHINIDIN OR PHARMACEUTICALLY ACCEPTABLE SALTS THEREOF AS AN EFFECTIVE COMPONENT}

The present invention relates to a pharmaceutical composition for the prevention or treatment of obesity containing delphinidin (Del) and its pharmaceutically acceptable salts as an active ingredient, a dietary supplement and the active ingredient to cells, thereby forming fat in cells. A method for causing various physiological changes associated with inhibition.

Adipose tissue is a central tissue for maintaining systemic homeostasis, and excessive accumulation of white adipose tissue causes obesity (1) . The process of conversion from immature pre-adipocytes to adipocytes is called adipogenesis, which is regulated by several factors including hormonal signals and various transcriptional factors. In the early stages of lipogenesis, stimulating lipogenic hormones , along with inhibition of Wnt / β-catenin signaling (3) , result in the expression of early transcription factors such as CCAAT / enhancer-binding protein (C / EBP) -β and -δ. It is necessary to induce (2) . As a result, after the expression of these early genes, the stimulation of mid-term lipoogenesis stimulates peroxisome prolifertor-activated receptor γ (PPARγ) and C / EBPα, which are master regulators, and the adiponectin and fatty acid-binding necessary for final differentiation and adipocyte formation. leads to the expression of protein 4 (FABP4) (2) . Recent studies have shown that several signal transduction pathways are involved in the regulation of fat formation. For example, canonical Wnt / β-catenin signaling is of increasing interest in the field of obesity, since activation of Wnt / β-catenin signaling can effectively inhibit lipoogenesis (3, 4) . In particular, Wnt10b can inhibit the differentiation of pro-adipocytes into mature adipocytes by inhibiting the expression of PPARγ and C / EBPa (3) . Moreover, ectopic expression of Wnt10b and Wnt1 in 3T3-L1 pre-adipocytes can inhibit adipogenesis (3, 5, 6) .

As an extracellular glycoprotein, Wnt, along with a multifunctional β-catenin regulated by cytoplasmic destruction complexes including cytoplasmic axin, casein kinase-Iα (CKIα) and Gsk3β, determines cell fate, It is known to be involved in differentiation, tumorigenesis and transcriptional regulation. In the absence of Wnt stimulation, cytoplasmic β-catenin is phosphorylated at Ser45 and Ser33 / Ser37 / Thr41 residues respectively by CK1α and Gsk3β (7) . Among the Wnt signals, β-catenin is dissociated from the destruction complex, and dissociated β-catenin can be stabilized and transferred to the nucleus, where TCF / LEF is used to regulate expression of downstream target genes such as PPARγ and C / EBPa. (8, 9)

In recent years, natural compounds and phytochemicals from plants, fruits and food by-products have increased interest in stability and excellent efficacy in the development of dietary supplements and medicines related to obesity. Several phytochemicals, such as curcumin (10) , (-)-epigallocatechin gallate (11) , kirenol (12) , retinoic acid (13), and platycodin D (14) , regulate the canonical Wnt / β-catenin signaling pathway. It is known to exhibit an anti-lipogenic effect. In a related study, black soybean anthocyanin has been reported to inhibit the differentiation of 3T3-L1 pre-fat cells, suggesting that they may be candidates for anti-obesity and anti-diabetic treatment (15) .

Delphinidin (Del) is a major dietary anthocyanin found in abundance in various green-yellow fruits and vegetables (16, 17) and is known to have a variety of biological activities such as antioxidant, anti-inflammatory and anticancer effects (18, 19) . However, although anthocyanin is generally known to be effective in obesity, the effects of Delphinidin's fat formation process and its molecular mechanism have not been studied.

The inventors of the present invention investigated the anti-obesity effect through the inhibition of Del's 3T3-L1 pre-fat cell differentiation. As a result, the inventors of the present invention confirmed that Del inhibits the accumulation of intracellular fat by regulating Wnt / β-catenin signaling and lipogenic transcription factors, and Del is a candidate for treating metabolic diseases related to obesity and obesity. The present invention has been completed by proposing to be possible.

KR 10-2015-0053321 A

[1] E. D. Rosen, B. M. Spiegelman (2006) Adipocytes as regulators of energy balance and glucose homeostasis. Nature 444: 847-853. [2] S. R. Farmer (2006) Transcriptional control of adipocyte formation. Cell Metab 4: 263-273. [3] C. N. Bennett, S. E. Ross, K. A. Longo, L. Bajnok, N. Hemati, K. W. Johnson, S. D. Harrison, O. A. MacDougald (2002) Regulation of Wnt signaling during adipogenesis. J Biol Chem 277: 30998-31004. [4] S. E. Ross, N. Hemati, K. A. Longo, C. N. Bennett, P. C. Lucas, R. L. Erickson, O. A. MacDougald (2000) Inhibition of adipogenesis by Wnt signaling. Science 289: 950-953. [5] K. A. Longo, W. S. Wright, S. Kang, I. Gerin, S. H. Chiang, P. C. Lucas, M. R. Opp, O. A. MacDougald (2004) Wnt10b inhibits development of white and brown adipose tissues. J Biol Chem 279: 35503-35509. [6] B. T. MacDonald, K. Tamai, X. He (2009) Wnt / beta-catenin signaling: components, mechanisms, and diseases. Dev Cell 17: 9-26. [7] C. Liu, Y. Li, M. Semenov, C. Han, GH Baeg, Y. Tan, Z. Zhang, X. Lin, X. He (2002) Control of beta-catenin phosphorylation / degradation by a dual-kinase mechanism. Cell 416 108: 837-847. [8] M. Moldes, Y. Zuo, R. F. Morrison, D. Silva, B. H. Park, J. Liu, S. R. Farmer (2003) Peroxisome-proliferator-activated receptor gamma suppresses Wnt / beta-catenin signaling during adipogenesis. Biochem J 376: 607-613. [9] J. F. Liu, C. T. Wu (2006) [Beta-catenin expression in intestinal mucosa of rats with severe abdominal infection]. Nan Fang Yi Ke Da Xue Xue Bao 26: 1733-1735. [10] J. Ahn, H. Lee, S. Kim, T. Ha (2010) Curcumin-induced suppression 422 of adipogenic differentiation is accompanied by activation of Wnt / beta-catenin signaling. Am J Physiol Cell Physiol 298: C1510-1516. [11] H. Lee, S. Bae, Y. Yoon (2013) The anti-adipogenic effects of (-) epigallocatechin gallate are dependent on the WNT / beta-catenin pathway. J Nutr Biochem 24: 1232-1240. [12] M. B. Kim, Y. Song, C. Kim, J. K. Hwang (2014) Kirenol inhibits adipogenesis through activation of the Wnt / beta-catenin signaling pathway in 3T3-L1 adipocytes. Biochem Biophys Res Commun 445: 433-438. [13] D. M. Kim, H. R. Choi, A. Park, S. M. Shin, K. H. Bae, S. C. Lee, I. C. Kim, W. K. Kim (2013) Retinoic acid inhibits adipogenesis via activation of Wnt signaling pathway in 3T3-L1 preadipocytes. Biochem Biophys Res Commun 434: 455-459. [14] H. Lee, S. Bae, Y. S. Kim, Y. Yoon (2011) WNT / beta-catenin pathway mediates the antiadipogenic effect of platycodin D, a natural compound found in Platycodon grandiflorum. Life Sci 89: 388-394. [15] H. K. Kim, J. N. Kim, S. N. Han, J. H. Nam, H. N. Na, T. J. Ha (2012) Black soybean anthocyanins inhibit adipocyte differentiation in 3T3-L1 cells. Nutr Res 32: 770-777. [16] J. M. Yun, F. Afaq, N. Khan, H. Mukhtar (2009) Delphinidin, an anthocyanidin in pigmented fruits and vegetables, induces apoptosis and cell cycle arrest in human colon cancer HCT116 cells. Mol Carcinog 48: 260-270. [17] S. Moriwaki, K. Suzuki, M. Muramatsu, A. Nomura, F. Inoue, T. Into, Y. Yoshiko, S. Niida (2014) Delphinidin, one of the major anthocyanidins, prevents bone loss through the inhibition of excessive osteoclastogenesis in osteoporosis model mice. PLoS One 9: e97177. [18] B. Jayaprakasam, LK Olson, RE Schutzki, MH Tai, MG Nair (444 2006) Amelioration of obesity and glucose intolerance in high-fat-fed C57BL / 6 mice by anthocyanins and ursolic acid in Cornelian cherry (Cornus mas) . J Agric Food Chem 54: 243-248. [19] T. Wu, Q. Tang, Z. Gao, Z. Yu, H. Song, X. Zheng, W. Chen (2013) Blueberry and mulberry juice prevent obesity development in C57BL / 6 mice. PLoS One 8: e77585. [20] Q. Q. Tang, T. C. Otto, M. D. Lane (2003) Mitotic clonal expansion: a synchronous process required for adipogenesis. Proc Natl Acad Sci U S A 100: 44-49. [21] A. K. Agarwal, A. Garg (2006) Genetic disorders of adipose tissue development, differentiation, and death. Annu Rev Genomics Hum Genet 7: 175-199. [22] S. Gesta, Y. H. Tseng, C. R. Kahn (2007) Developmental origin of fat: tracking obesity to its source. Cell 131: 242-256. [23] B. M. Cheung, T. T. Cheung, N. R. Samaranayake (2013) Safety of antiobesity drugs. Ther Adv Drug Saf 4: 171-181. [24] O. Boss, N. Bergenhem (2006) Adipose targets for obesity drug development. Expert Opin Ther Targets 10: 119-134. [25] Y. M. Patel, M. D. Lane (2000) Mitotic clonal expansion during preadipocyte differentiation: calpain-mediated turnover of p27. J Biol Chem 275: 17653-17660. [26] S. O. Freytag, T. J. Geddes (1992) Reciprocal regulation of adipogenesis by Myc and C / EBP alpha. Science 256: 379-382. [27] M. Fu, M. Rao, T. Bouras, C. Wang, K. Wu, X. Zhang, Z. Li, TP Yao, RG Pestell (2005) Cyclin D1 inhibits peroxisome proliferator-activated receptor gamma-mediated adipogenesis through histone deacetylase recruitment. J Biol Chem 280: 16934-16941. [28] E. D. Rosen, C. J. Walkey, P. Puigserver, B. M. Spiegelman (2000) 466 Transcriptional regulation of adipogenesis. Genes Dev 14: 1293-1307. [29] Y. Zuo, L. Qiang, SR Farmer (2006) Activation of CCAAT / enhancer-binding protein (C / EBP) alpha expression by C / EBP beta during adipogenesis requires a peroxisome proliferator-activated receptor-gamma-associated repression of HDAC1 at the C / ebp alpha gene promoter. J Biol Chem 281: 7960-7967. [30] M. Nishizuka, A. Koyanagi, S. Osada, M. Imagawa (2008) Wnt4 and Wnt5a promote adipocyte differentiation. FEBS Lett 582: 3201-3205. [31] WP Cawthorn, AJ Bree, Y. Yao, B. Du, N. Hemati, G. Martinez-Santibanez, OA MacDougald (2012) Wnt6, Wnt10a and Wnt10b inhibit adipogenesis and stimulate osteoblastogenesis through a beta-catenin-dependent mechanism . Bone 50: 477-489. [32] DV Tauriello, I. Jordens, K. Kirchner, JW Slootstra, T. Kruitwagen, BA Bouwman, M. Noutsou, SG Rudiger, K. Schwamborn, A. Schambony, MM Maurice (2012) Wnt / beta479 catenin signaling requires interaction of the Dishevelled DEP domain and C terminus with a discontinuous motif in Frizzled. Proc Natl Acad Sci U S A 109: E812-820. [33] J. Liu, H. Wang, Y. Zuo, S. R. Farmer (2006) Functional interaction between peroxisome proliferator-activated receptor gamma and beta-catenin. Mol Cell Biol 26: 5827-5837. [34] J. Ninomiya-Tsuji, F. M. Torti, G. M. Ringold (1993) Tumor necrosis factor-induced c-myc expression in the absence of mitogenesis is associated with inhibition of adipocyte differentiation. Proc Natl Acad Sci U S A 90: 9611-9615.

The problem to be solved in the present invention is to provide delphinidin and its pharmaceutically acceptable salts for pharmaceutical and nutraceutical use for the prevention or treatment of obesity.

In addition, the problem to be solved in the present invention is to treat cells with delphinidin and its pharmaceutically acceptable salts to inhibit intracellular triglyceride accumulation, promote intracellular lipolysis, cell cycle arrest, regulate cell adipose transcription factor expression and It is an object of the present invention to provide a method of inhibiting cell fat formation, such as intracellular Wnt signaling pathway control.

In order to solve the above problems, the present invention provides a pharmaceutical composition for the prevention or treatment of obesity containing delphinidin and its pharmaceutically acceptable salts as an active ingredient.

The present invention also provides a nutraceutical for preventing or improving obesity containing delphinidin and its pharmaceutically acceptable salts as an active ingredient.

The present invention also provides a method for inhibiting triglyceride accumulation in a cell comprising treating the cell with delphinidin and a pharmaceutically acceptable salt thereof.

The present invention also provides a method for intracellular lipolysis comprising treating cells with delphinidin and its pharmaceutically acceptable salts.

The present invention also provides a method of stopping cell cycle progression comprising treating cells with delphinidin and its pharmaceutically acceptable salts.

The cell cycle is preferably in the G 0 / G 1 phase.

The cell cycle progression stop may be due to a decrease in the expression level of Cdk2, a decrease in the expression level of Cdk6, and an increase in the expression level of p27 / KIP1.

In addition, the present invention provides a lipoform selected from the group consisting of C / EBβ, C / EBP, C / EBPa, PPARy, adiponectin and aP2 comprising treating cells with delphinidin and its pharmaceutically acceptable salts thereof. Provided are methods for inhibiting expression of transcription factors.

The present invention also provides a method for activating an intracellular Wnt signal transduction pathway comprising treating a cell with delphinidin and a pharmaceutically acceptable salt thereof.

The activation of the Wnt signal transduction pathway is preferably selected from the group consisting of activation of β-catenin, negative regulation and phosphorylation of Gsk3β, increased expression of cyclin D1 and increased expression of c-myc.

As the active ingredient of the present invention, delphinidin and its pharmaceutically acceptable salts effectively inhibit triglyceride accumulation in cells without promoting side effects and promote intracellular lipolysis, and thus, drugs and health for the prevention or treatment of obesity. It is highly likely to be developed as a functional food, and furthermore, when the active ingredient of the present invention is treated in a cell, various physiological and chemical change environments related to intracellular fat formation may be formed, and thus, it may be actively used for research on development of related therapeutic agents such as obesity. .

1A to 1F show the effects of Del on cell survival, intracellular triglyceride accumulation and lipolysis, FIG. 1A shows the structure of Dle, and FIG. 1B shows 3T3-L1 pre-fat cells with or without Del treatment. 1C shows the cell viability of 3T3-L1 adipocytes after 6 days of differentiation with or without Del treatment, and FIG. 1D shows the fat accumulation in 3T3-L1 adipocytes by Del treatment, Figure 1e is a result quantitatively showing the fat accumulation through the absorbance measurement, Figure 1f shows the effect of lipolysis by Del treatment.
Figure 2a to 2e shows the effect of Del in mitotic clonal expansion (MCE) during the initial lipoidization process, Figure 2a shows the appearance of fat accumulation in 3T3-L1 adipocytes with or without Del treatment, Figure 2b Shows quantitatively the degree of fat accumulation by Oil Red O staining, Figure 2c shows the results of flow cytometry analysis of cells in MDI medium with or without Del treatment, Figure 2d shows the fraction of cells per cell cycle Figure 2e shows the expression pattern of the cell cycle regulatory protein following Del treatment.
Figure 3a and Figure 3b shows the change in the lipogenic transcription factor by Del treatment, Figure 3a shows the gene expression pattern of a representative lipogenic transcription factor, Figure 3b shows the expression of several proteins.
4a to 4c show the effect of Del in the canonical Wnt signaling pathway, FIG. 4a shows the Wnt expression pattern, FIG. 4b shows the change in the concentration of Wnt receptors and co-receptors after Del treatment, and FIG. 4c Shows the mRNA expression of Dvl1 , Dvl3 and Axin2 .
5A to 5F show the recovery of Del cytoplasmic β-catenin and its migration to the nucleus. FIG. 5A shows the concentration change of β-catenin mRNA according to Del treatment, and FIG. 5B shows various doses of Del treatment. Figure 5c shows the change in the concentration of β-catenin protein according to, Figure 5c shows the change in the concentration of β-catenin protein in the fat formation process during Del treatment, Figure 5d shows the cellular or nuclear β-catenin protein with or without Del treatment Figure 5e shows the mRNA concentration change of Gsk3β by Del treatment, Figure 5f shows the expression pattern of p-Gsk3β (Ser9), Gsk3β, cyclin D1 and c-Myc following Del treatment.

EMBODIMENT OF THE INVENTION Hereinafter, this invention is demonstrated in detail.

The inventors of the present invention assayed the anti-obesity effect of delphinidin in anthocyanin pigments present in large amounts in plants and vegetables for the development of novel anti-obesity agents, and effectively inhibited triglyceride accumulation and fat degradation in adipocytes. The present invention was completed by confirming that it can be promoted.

Accordingly, the present invention provides a pharmaceutical composition for preventing or treating obesity containing delphinidin and its pharmaceutically acceptable salts as an active ingredient.

Pharmaceutical compositions comprising delphinidins of the present invention and pharmaceutically acceptable salts thereof are oral such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like according to conventional methods for the purpose of each use. It can be formulated and used in various forms, such as formulation, injection of sterile injectable solution, or can be administered orally or through various routes including intravenous, intraperitoneal, subcutaneous, rectal, and topical administration.

Such pharmaceutical compositions may further include carriers, excipients or diluents, and examples of suitable carriers, excipients or diluents that may be included include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, Starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, amorphous cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil Etc. can be mentioned. In addition, the pharmaceutical composition of the present invention may further include a filler, an anticoagulant, a lubricant, a humectant, a perfume, an emulsifier, a preservative, and the like.

In a preferred embodiment, solid preparations for oral administration include tablets, pills, powders, granules, capsules and the like, which solid preparations comprise at least one excipient such as starch, calcium carbonate, Sucrose, lactose, gelatin and the like are mixed and formulated. In addition, lubricants such as magnesium stearate, talc and the like may also be used in addition to simple excipients.

As a preferred embodiment, oral liquid preparations may be exemplified by suspensions, solvents, emulsions, syrups, and the like, and various excipients, for example, wetting agents, sweeteners, Fragrances, preservatives and the like.

As a preferred embodiment, the preparation for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilizers, suppositories and the like. Non-aqueous solvents and suspending agents may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like. Injectables may include conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifiers, stabilizers, preservatives, and the like.

Delfinidine and pharmaceutically acceptable salts thereof of the present invention are administered in a pharmaceutically effective amount. In the present invention, “pharmaceutically effective amount” means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and an effective dose level means the type, severity, activity of the drug, Sensitivity to drug, time of administration, route of administration and rate of release, duration of treatment, factors including concurrent use of drugs, and other factors well known in the medical arts. The pharmaceutical compositions of the present invention may be administered as individual therapeutic agents or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered as single or multiple doses. Taking all of the above factors into consideration, it is important to administer an amount that can obtain the maximum effect in a minimum amount without side effects, which can be easily determined by those skilled in the art.

In a preferred embodiment, the effective amount of delphinidin and its pharmaceutically acceptable salts in the pharmaceutical composition of the present invention may vary depending on the age, sex and weight of the patient, and generally 1 to 5,000 mg / kg body weight, preferably 100 to 3,000 mg may be administered daily or every other day or divided into 1 to 3 times a day. However, the dosage may be increased or decreased depending on the route of administration, the severity of the disease, sex, weight, age, etc., and the above dosage does not limit the scope of the present invention in any way.

The pharmaceutical composition of the present invention can be administered to a subject through various routes. All modes of administration can be expected, for example by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or intracerebroventricular injection.

As used herein, "administration" means providing a patient with any substance by any suitable method, wherein the route of administration of the pharmaceutical composition of the present invention is oral or parenteral via all common routes as long as the target tissue can be reached. Oral administration. In addition, the composition of the present invention may be administered using any device capable of delivering an active ingredient to a target cell.

"Subject" in the present invention is not particularly limited, but includes, for example, humans, monkeys, cattle, horses, sheep, pigs, chickens, turkeys, quails, cats, dogs, mice, rats, rabbits or guinea pigs. And preferably mammals, and more preferably humans.

The present invention also provides a nutraceutical for preventing or improving obesity containing delphinidin and its pharmaceutically acceptable salts as an active ingredient.

The health functional food of the present invention can be used in various ways such as foods and beverages effective for the prevention or improvement of obesity. The health functional food of the present invention is a food containing delphinidin and its pharmaceutically acceptable salts, for example, various foods, beverages, gums, teas, vitamin complexes, dietary supplements, and the like, powders, granules, It can be used in the form of a tablet, capsule or beverage.

The delphinidins and pharmaceutically acceptable salts thereof of the present invention can generally be added at 0.01 to 15% by weight of the total food weight, the health beverage composition is in a ratio of 0.02 to 10g, preferably 0.3 to 1g based on 100ml Can be added.

In addition to containing the compound as an essential ingredient in the indicated ratios, the health functional food of the present invention may contain food-acceptable food supplement additives such as natural carbohydrates and various flavoring agents as additional ingredients.

Examples of the natural carbohydrates include conventional sugars such as monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.

As the flavoring agent, natural flavoring agents such as stevia such as taumartin, rebaudioside A or glycyrgin, and synthetic flavoring agents such as saccharin and aspartame may be used. The ratio of the natural carbohydrate is generally used in the range of about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the health functional food of the present invention. In addition to the above, the health functional food of the present invention includes various nutrients, vitamins, minerals, synthetic flavors and natural flavoring agents, colorants and neutralizing agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloids Thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated drinks and the like. In addition, the health functional food of the present invention may contain a flesh for preparing natural fruit juice, fruit juice beverage, vegetable beverage and the like. These components can be used independently or in combination. The proportion of such additives is generally selected from the range of 0.01 to about 20 parts by weight per 100 parts by weight of delphinidin of the present invention and pharmaceutically acceptable salts thereof.

In addition to the use of delphinidin and its pharmaceutically acceptable salts as active ingredients of the pharmaceutical compositions and health functional foods described above, the present invention may provide a variety of biological experimental methods, including When the active ingredient of the present invention is treated to a cell, methods for causing various physiological and chemical changes in a cell closely related to fat accumulation or fat cell formation process in a cell, and a basis and application for the development of therapeutic drugs for diseases related to obesity, etc. It may be widely used in research.

Accordingly, the present invention provides a method for inhibiting triglyceride accumulation in a cell comprising treating the cell with delphinidin and a pharmaceutically acceptable salt thereof.

The present invention also provides a method for intracellular lipolysis comprising treating cells with delphinidin and its pharmaceutically acceptable salts.

The present invention also provides a method of stopping cell cycle progression comprising treating cells with delphinidin and its pharmaceutically acceptable salts.

The cell cycle is preferably a G 0 / G 1 phase, and the stop of the cell cycle progression may be due to a decrease in the expression level of Cdk2, a decrease in the expression level of Cdk6 and an increase in the expression level of p27 / KIP1.

In addition, the present invention provides a lipoform selected from the group consisting of C / EBβ, C / EBP, C / EBPa, PPARy, adiponectin and aP2 comprising treating cells with delphinidin and its pharmaceutically acceptable salts thereof. Provided are methods for inhibiting expression of transcription factors.

The present invention also provides a method for activating an intracellular Wnt signal transduction pathway comprising treating a cell with delphinidin and a pharmaceutically acceptable salt thereof.

The activation of the Wnt signal transduction pathway is preferably selected from the group consisting of activation of β-catenin, negative regulation and phosphorylation of Gsk3β, increased expression of cyclin D1 and increased expression of c-myc.

In the above methods, the term 'treating' the delphinidin of the present invention and a pharmaceutically acceptable salt thereof to a cell is a process of introducing the active ingredients into a cell of interest, and specific methods thereof are known in the art. have.

For example, a method of adding the active ingredient of the present invention to a medium cultured in a laboratory environment ( in vitro ) or a test animal ingesting the active ingredient of the present invention to a target animal of the test animal The active ingredient can be reached ( in vivo ), and the experimental animal is preferably a mammal except human.

In the above methods, 'cell' refers to an animal cell and may be a tissue cell or cell line isolated from a living body. In addition, the cells may preferably be pre-fat cells or differentiating fat cells or differentiated fat cells.

The method for separating, culturing, and obtaining the target cells is not only known in the art, but can be easily performed by those skilled in the art through the entire specification.

Hereinafter, the present invention will be described in more detail with reference to specific examples.

[ Example ]

1. Materials and Methods

1.1. Chemicals and Reagents

Delphinidin chloride (purity ≧ 90%, HPLC) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Dexamethasone, isobutyl-1-metylxanthine (IBMX), insulin, troglitazone, Oil Red O dye, 3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyltetrazolium bromide (MTT) and 4% formaldehyde are Sigma- It was purchased from Aldrich (St. Louis, MO, USA). Dulbecco's modified Eagle's medium (DMEM) and newborn calf serum (NBCS) were purchased from Gibco (Grand Island, NY, USA). Fetal bovine serum was purchased from Atlas Biologicals (Fort Collins, Co., USA). Penicillin-streptomycin solution was purchased from Hyclone Laboratories, Inc. (South Logan, NY, USA). Antibodies to C / EBβ, C / EBPa, PPARγ, adiponectin, aP2, Cyclin D3, cdk2, cdk4, cdk6 and p27 / KIP1 were purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies against C / EBPa, PPARγ, Cyclin D1, c-Myc, Gsk3β and Lamin B were purchased from Santa Cruz Biotechnology, Inc. Antibodies against β-catenin and β-actin were purchased from Abcam (Cambridge, Mass., USA). BCA protein assay kits were purchased from Thermo Scientific (Rockford, IL, USA) and protein loading buffers were obtained from Bio-Rad Laboratories, Inc. (Hercules, CA, USA). The lipolysis assay kit was purchased from Biovision (Milpitas, CA, USA).

1.2. Cell Culture, Differentiation and Treatment

3T3-L1 mouse embryo fibroblasts were obtained from Korean Cell Line Bank (KCLB-10092.1), 10% (v / v) heat-inactivated NCS and 1% (v / v) antibiotic / antimycotic solution (100 U / ml penicillin, 100 U). / ml streptomycin) in high-glucose DMEM medium was incubated at 37 ℃ in a humidified incubator containing 5% CO 2 . 3T3-L1 pre-adipocyte differentiation was induced by replacement with DMEM (MDI) containing 10% fetal bovine serum (FBS), 0.5 mM IBMX, 1 μM dexamethasone and 10 μg / ml insulin. After 2 days, MDI medium was replaced with DMEM with 10% FBS and 10 μg / ml insulin. After 5-7 days of induction of differentiation, about 90% of the pre-adipocytes were converted to rounded mature adipocytes. Insulin-feeding medium was changed every 2 days. Prior to addition to the medium, Del was completely dissolved in distilled water (Qiagen, Valencia, CA, USA), and the stock solution was stored at -20 ° C for later use. Cells were treated in Del-feed culture medium or simple culture medium as a control. After 1 day of treatment, the Del-feed medium was changed every 48 hours.

1.3. Cell viability assay

3T3-L1 pre-fat cells were seeded, grown on 96-well plates at a density of 1 × 10 4 cells / well, and then treated with various concentrations of Del for the indicated times. After incubation was complete, 20 μl of 5 mg / ml MTT solution was added and the cells were incubated at 37 ° C. for 3 hours. The obtained formazan crystals were dissolved in 150 μl DMSO and absorbance was measured at 590 nm using a Victor ™ X3 multilabel reader (Perkin Elmer, Waltham, Mass., USA).

1.4. Cell cycle analysis

Postconfluent 3T3-L1 cells induced differentiation with MDI addition in the presence or absence of 50 μM Del for 12, 18, and 24 h. Cells were then harvested and fixed in 70% ethanol at 4 ° C. for at least 1 hour. After washing with 1 × PBS, the cells were stained with propidium iodine (PI) solution containing RNase at a concentration of 20 μg / ml for 30 minutes. Fluorescence-activated cell sorting (FACS) analysis was performed with a Becton-Dickinson FACScan system, and data were analyzed with FACSDiva software (Becton-Dickinson, San Jose, Calif.).

1.5. Lipolysis analysis lipolysis  assay)

Lipolysis analysis was performed according to the manufacturer's protocol. In summary, 3T3-L1 pre-fat cells were seeded and grown to confluent in 96-well plates at a density of 1 × 10 4 cells / well. After 2 days post confluence, cells were treated with varying concentrations of Del and induced differentiation by the method described above. After 7 days of differentiation, cells were rinsed with 1 × phosphate-buffered saline (PBS) and washed with lipolysis assay buffer. Next, lipolysis was stimulated with isoproterenol for at least 1 hour. Thereafter, a reaction mixture containing a glycerol assay buffer, a glycerol probe, and a glycerol enzyme was added to the solution, and the absorbance was measured at 590 nm using a Victor ™ X3 multilabel reader. The amount of glycerol in the sample was determined by comparison with the glycerol standard curve and normalized to the cellular protein level.

1.6. Oil Red O staining

After 6 days of differentiation, cells were washed with 1 × PBS, fixed with 10% formalin for at least 1 hour, and stained with 0.3% filtered Oil Red O solution for 15 minutes. Stained cells were thoroughly rinsed with distilled water and phenotypic changes of fully differentiated cells were photographed with an Axiovert-25 microscope (Carl Zeiss, Jena, Germany). Images of the entire culture well were captured using a Canon 6D digital camera. To quantify the amount of Oil Red O, stained cells were eluted with 100% isopropanol and absorbance was measured using Victor ™ X3 at 520 nm.

1.7. Quantitative Reverse transcription -Polymerase chain reaction (RT-PCT) analysis

Total RNA was extracted using an RNA extraction kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions, and the concentration was measured using a scandrop analytik jena AG spectrophotometer (Jena, Germany). To apply total RNA (1 μg) to reverse transcription-polymerase chain reaction (RT-PCR), cDNA was synthesized using Maxime RT PreMix kit (Intron Biotechnology, Seoul, Korea) and Veriti 96-Well Thermal Cycler (Applied Biosystems, Reaction was carried out in Singapore. Quantitative real-time PCR was performed using the iQ ™ SYBR Green Supermix kit (Bio-Rad, Singapore) in a CFX96 ™ Real-Time PCR detection system (Bio-Rad, Singapore). The sequences of the primers used in this study are shown in Table 1. Target gene expression was normalized to glyceraldehyde-3-phosphate dehydrogenase (Gapdh).

qRT - PCR primer  set name Primer sequence (5 '→ 3') sense Antisense Gapp GACATGCCGCCTGGAGAAAC AGCCCAGGATGCCCTTTAGT Pparg TTTGAAAGAAGCGGTGAACCAC ACCATTGGGTCAGCTCTTGTG Cebpb CAAGCTGAGCGACGAGTACA CAGCTGCTCCACCTTCTTCT Cebpa GAGCCGAGATAAAGCCAAACA CGGTCATTGTCACTGGTCAACT Cebpd ACGACGAGAGCGCCATC TCGCCGTCGCCCCAGTC Adipoq GATGCAGGTCTTCTTGGTCCTAA GGCCCTTCAGCTCCTGTC Fabp4 GTGATGCCTTTGTGGGAAACCTGGAAG TCATAAACTCTTGTGGAAGTCACGCC Ccnnb1 CCGTTCGCCTTCATTATGGA GGCAAGGTTTCGAATCAATCC Fzd2 TCATCTTTCTGTCCGGCTGCTACA AGCTGGCCATGCTGAAGAAGTAGA Lrp5 TGAAGGAATGGCTGTGGACTGGAT TGTCAAGGTCTCTCCACACAAGCA Lrp6 ACCTCAATGCGATTTGTTCC GGTGTCAAAGAAGCCTCTGC Dvl1 ATGAGGAGGACAATACGAGCC GCATTTGTGCTTCCGAACTAGC Dvl3 GTCACCTTGGCGGACTTTAAG AAGCAGGGTAGCTTGGCATTG Gsk3b TGGCAGCAAGGTAACCACAG CGGTTCTTAAATCGCTTGTCCTG Axin2 GAGTAGCGCCGTGTTAGTGACT CCAGGAAAGTCCGGAAGAGGTATG Wnt1 GGTTTCTACTACGTTGCTACTGG GGAATCCGTCAACAGGTTCGT Wnt5a ACTGGCAGGACTTTCTCAAGGACA GCCTATTTGCATCACCCTGCCAAA Wnt5b CCAGTGCAGAGACCGGAGATG GTTGTCCACGGTGCTGCAGTTC Wnt6 ATGGATGCGCAGCACAAGCG ATGGATGCGCAGCACAAGCG Wnt10a CCACTCCGACCTGGTCTACTTTG TGCTGCTCTTATTGCACAGGC Wnt10b GCTGACTGACTCGCCCACC AAGCACACGGTGTTGGCCGT

1.8. Preparation of whole cell extract and Weston Blot  analysis

Prior to recovery, Del-treated or untreated cells were washed twice with ice cold 1 × PBS and lysed with RIPA lysis buffer (Santa Cruz Biotechnology, Inc.) with protease inhibitor cocktail, 2 mM PMSF and 1 mM sodium orthovanadate. Lysates were recovered by scraping, cells were incubated for 15 minutes on ice and samples were centrifuged at 10,000 × g, 4 ° C. for 15 minutes to obtain supernatant. Protein concentration was determined using the BCA protein assay kit (Pierce, Rockford, IL). The same amount of protein was loaded for each sample and separated on 4-20% sodium dodecyl sulfate polyacrylamide gradient gel (Mini-PROTEAN Precast Gel, Bio-Rad). After electrophoresis, the proteins were transferred to a polyvinylidene fluoride (PVDF) membrane (Trans-Blot SD Semi-Dry Cell, Bio-Rad) for about 1.5 hours at 13V using a semi-dry transfer cell (Bio-Rad). Membranes were blocked with 5% dried skim milk containing 1 × Tris-buffered saline (TBS) containing 0.1% Tween 20 (TBST) for 1 hour at room temperature on a shaker and the primary antibody overnight at 4 ° C. Incubated. After incubation of the primary antibody, the membranes were washed three times for 5 minutes each with 1 × TBST. Membranes were incubated with a specific horseradish peroxidase-conjugated secondary antibody on a shaker for 1.5 hours at room temperature and washed three times for about 5 minutes. All washing steps were performed at 1 × TBST. Immune response protein signals were detected using a chemiluminescent ECL assay and measured using molecular imaging software (Bio-Rad). The brightness and contrast were slightly adjusted for good visualization of the data, but the same change was applied to the entire image panel, leaving no loss from the image. Anti-β-actin was used as a control. Western blot data was quantified using ImageJ software (National Institutes of Health, USA).

1.9. Preparation of Nuclear Extracts

Nuclear extracts were prepared according to the manufacturer's instructions (Carlsbad, California, USA). In summary, the medium was aspirated from cell culture dishes and cells were washed twice with 1 × PBS containing phosphatase inhibitors. The cells were scraped and centrifuged at 200 × g for 5 minutes at 4 ° C. to separate the pellets. It was suspended in 1 × hypotonic solution containing detergent, homogenized by pipetting several times up and down, and then the samples were incubated for 15 minutes on ice. The cytoplasmic portion was removed by centrifuging the homogenized pellet at 14,000 x g for 1 minute at 4 ° C. Next, the remaining nuclear pellets are suspended in lysis buffer containing 10 mM dithiothreitol and protease inhibitors, incubated for 30 minutes on ice on a 150 rpm rocking platform, vortexed for 30 seconds at the highest setting, and then 10 minutes at 4 ° C. Centrifuge at 14,000 × g. The nuclear extract was recovered and stored at -80 ° C until analysis.

1.10. Statistical analysis

All data are expressed as mean ± standard deviation (SD). Significant differences between the different treatment groups were detected using Student's t-test and two-way ANOVA followed by post-hoc Bonferroni test. p values <0.05 were considered statistically significant.

2. result

2.1. Del  Intracellular Triglycerides  Inhibit accumulation and promote lipolysis

Prior to elucidating Del's function in 3T3-L1 pre-adipocyte differentiation, the inventors of the present invention determined the appropriate dose of Del for use in 3T3-L1 pre-adipocytes and differentiated 3T3-L1 cells via a cell viability assay. Decided. As shown in FIG. 1B, no significant cytotoxicity was observed when Del was treated with 3T3-L1 pre-adipocytes at a concentration of 10-300 μM for 24 hours. However, mild cytotoxicity was observed when Del was treated with 3T3-L1 pre-fat cells for 48 hours at 200 μM and 300 μM concentrations. In addition, the inventors observed the effects of varying doses of Del on differentiated 3T3-L1 cells. As shown in FIG. 1C, when 3T3-L1 cells were treated with hormonal cocktail MDI-medium alone for 6 days, differentiated 3T3-L1 cells were slightly decreased. It appeared to decrease. Interestingly, however, survival of 3T3-L1 cells was maintained when MDI was used with low doses of Del. Therefore, the inventors of the present invention decided to use a low dose of Del in further studies with 3T3-L1 cells. Next, in order to confirm the effect of the intracellular triglyceride accumulation of Del, differentiation into adipocytes was induced by treatment with post-confluent 3T3-L1 pre-fat cells with MDI medium with or without 25-100 μM Del ( 1D and 1E). Microscopic observation after Oil Red O staining on day 6 showed that Del treatment inhibited intracellular triglyceride accumulation in a concentration dependent manner compared to the control exposed with MDI medium alone (FIG. 1D). Quantitative analysis showed that 25, 50 and 100 μM Del treatments could reduce intracellular triglyceride accumulation by 30%, 38% and 58%, respectively, when 3T3-L1 cells were treated with PPARγ agonist troglitazone. Compared with an increase in fat accumulation by 22% (FIG. 1E). To investigate the effect of Del on lipolysis in differentiated 3T3-L1 adipocytes, the inventors of the present invention performed lipolysis measurements. When cells were treated with 25-100 μM Del, the secretion of glycerol was promoted in adipocytes that differentiate in a dose dependent manner (FIG. 1F). From these results, it can be expected that Del has an anti-lipogenic effect in 3T3-L1 pre-fat cells.

2.2. In the early stages of lipogenesis Del  Block cell cycle progression

Next, the inventors of the present invention observed whether inhibition of triglyceride accumulation in Del-mediated cells depends only on the dose or on the duration of administration. In this experiment, cells were treated with 50 μΜ Del for various time periods (FIG. 2). Interestingly, the cells treated with 50 μM Del in the early differentiation stage were found to have a greater reduction in intracellular triglyceride accumulation than the cells in the mid and late stages. In addition, when Del was treated for 0-2, 0-4 and 0-6 days, fat accumulation was inhibited by 26%, 39% and 40%, respectively, but for 2-4, 2-6 and 4-6 days When treated, inhibition of fat accumulation by 21%, 31% and 17%, respectively, was confirmed (FIGS. 2A, 2B). Mitotic clonal expansion (MCE) is essential for pro-adipocytes to differentiate into adipocytes, which occurs mainly in the early stages of differentiation (20) . Since Del showed a good effect on triglyceride accumulation in the early stages of differentiation, the inventors of the present invention confirmed whether Del treatment affected MCE. Flow cytometry data increased G 0 / G 1 phase cells at 18-24 hours, although Del treatment did not significantly affect cell cycle distribution during the initial 12 hours compared to control cells treated with MDI alone. After 24 hours, G 2 / M phase cells were confirmed to be reduced (Fig. 2c, Fig. 2d). These results can be understood that Del stops the cell cycle in the G 0 / G 1 phase. Western blot data showed that the expression of cell cycle regulatory protein Cdk6 was completely inhibited by Del treatment, but the Cdk2 protein concentration decreased significantly at 12 hours. However, the concentration of the cyclin-dependent kinase inhibitor p27 / KIP1 was significantly increased by Del treatment. Cyclin D3 and Cdk4 concentrations did not change significantly, but the amount of cyclin D1 was increased by Del treatment (FIG. 2E). From these results, Del is expected to induce cell cycle arrest in the G 0 / G 1 phase via protein concentration regulation of Cdk2, Cdk6 and p27 / KIP1.

2.3. In the process of fat formation Del  Regulation of lipogenic transcription factors

Differentiation of pro-adipocytes into adipocytes is tightly regulated by several major transcription factors such as C / EBP, C / EBP, C / EBPa, PPARy, adiponectin and aP2. The inventors of the present invention investigated whether Del affects the expression of lipoforming transcription factors in the lipoforming process. In order to induce pro-adipocyte differentiation, 3T3-L1 culture medium was replaced with MDI medium, which can mainly induce the expression of early transcription factors such as C / EBPβ and C / EBPδ, as shown in FIG. 3A. Expression of mid and late lipogenic markers such as C / EBPa, PPARγ, adiponectin and aP2 were strongly expressed on day 4 as expected. Interestingly, treatment with 50 μM Del reduced mRNA expression of transcription factors such as C / EBβ and C / EBδ on day 1. However, C / EBβ protein concentration remained unchanged until 2 days. Then, the protein concentration of C / EBβ was greatly reduced (FIG. 3B). In addition, Del significantly reduced the concentrations of C / EBPa, PPARγ, adiponectin and aP2 at the transcriptional and translational stages (FIGS. 3A, 3B). These results suggest that Del can effectively inhibit important lipogenic transcription factors.

2.4. Del  Caused by canonical Wnt  Activation of signaling pathways

The canonical Wnt signaling pathway is involved in early adipocyte differentiation and is considered as an anti-obesity target. During Wnt signaling, multifunctional β-catenin dissociates from cytoplasmic inhibitory complexes consisting of Gsk3β, casein kinase Iα and axin, migrates into the nucleus and regulates target genes such as c-Myc and cyclin D1. Therefore, understanding the regulation and stabilization of β-catenin during lipogenesis is an important process for developing anti-obesity drugs. To study the mechanism of action of Del in lipogenesis, the inventors of the present invention investigated the role in the Wnt signaling pathway. As shown in FIG. 4, Del induced significantly Wnt1 and Wnt10b expression, but did not significantly change the expression of Wnt5a, Wnt5b, Wnt6 and Wnt10a (FIG. 4A). In addition, the expression levels of Wnt receptor Fzd2 and its co-receptors Lrp5 / 6 were significantly increased by Del treatment (FIG. 4B). Moreover, mRNA levels of Dvl1 and Dvl3 were greatly upregulated, but Axin2 expression was not significantly changed (FIG. 4C). This suggests that Del effectively activates Wnt signaling during early lipoogenesis.

2.5. In the process of fat formation Del  By β- catenin  stabilize

β-Catenin plays a role as a pro-fat cell marker in the differentiation of 3T3-L1 pre-fat cells, as well as an important transcription factor in development and human disease. Its expression is greatly reduced in response to hormonal stimulation. Recent studies have shown that β-catenin functions as a potent negative regulator of lipoogenesis (3) . To investigate whether β-catenin is associated with Del-mediated inhibition in lipoogenesis, the inventors of the present invention examined the expression of β-catenin during the initial lipoogenesis process. As a result, when Del was treated at a concentration of 25-100 μM, it was confirmed that the expression of mRNA and protein of β-catenin was induced by dose-dependent rooming (FIGS. 5A and 5B). In contrast, β-catenin protein concentration in control cells treated with MDI alone was significantly reduced, but β-catenin concentration was recovered when treated with 50 μM Del (FIG. 5C). In addition, Del treatment significantly induced the migration of β-catenin into the nucleus (FIG. 5D). Furthermore, qRT-PCR and Western blot analysis showed that Del treatment negatively regulates Gsk3β at the transcriptional and translational stages, but induces phospho-Gsk3β (Ser9) (FIGS. 5E, 5F). As expected, the expression of the downstream β-catenin-target genes, cyclin D1 and c-Myc, was largely induced by Del treatment during 3T3-L1 pre-adipocyte differentiation (FIG. 5F). Based on these results, Del can stabilize the expression of β-catenin, which can be understood to induce the expression of β-catenin target genes cyclin D1 and c-Myc in early adipose formation.

3. Discuss

In recent years, the rise in obesity has attracted worldwide attention, and in relation to various metabolic diseases including type 2 diabetes, hyperlipidemia, hypertension and certain cancers, obesity is considered a major future health problem in the future (21, 22) . Various anti-obesity drugs have been approved by the US FDA, but most of them are discontinued due to their insignificant effects or side effects. Therefore, there is a great demand for the development of effective and safe anti-obesity drugs (23) .

Differentiation of pre-fat cells into mature adipocytes is known as an important target for the development of anti-obesity drugs (24) . Therefore, understanding the molecular mechanisms involved in the regulation of adipocyte development and adipogenesis can provide valuable information in controlling obesity (2) .

The present invention suggests that Del, a major anthocyanin, can effectively inhibit fat formation through the Wnt / β-catenin signaling pathway. The inventors of the present invention have shown that Del treatment can significantly reduce cell fat accumulation and promote lipolysis without any side effects related to cell survival. In the process of adipose formation, 100 μM Del treatment appears to be more effective in inhibiting triglyceride accumulation than low dose Del treatment. Furthermore, the duration of Del treatment is important to ensure effective suppression of fat accumulation, which initial treatment of Del can more effectively suppress fat accumulation than later stage treatment. One possible cause for this result may be a delay in cell cycle progression due to Del treatment. Lipid formation consists of three stages: early, middle and late, and is closely regulated by specific transcription factors at each stage. In the early stages, MCE, in which growth-stopping cells reenter the cell cycle in the presence of hormonal stimulation, plays an important role in increasing cell numbers (20) . Various data by the inventors of the present invention suggest that Del treatment affects MCE by stopping cells in the G 1 phase. In the lipoforming process of 3T3-L1 cells, cell cycle progression through G 1 / S checkpoints is characterized by controlled activity of cyclin-dependent kinases such as Cdk2, Cdk4 and Cdk6, turnover of p27 / KIP1, cytoplasm from the nucleus of cyclin D1. Migration and the transfer of GSK3β from the cytoplasm to the nucleus (25, 20). In addition, the inventors of the present invention observed an increase in p27 / KIP1 concentration due to Del treatment. This increase is as Del stops cell cycle progression and inhibits adipogenesis, as p27 / KIP1 is a cyclin-dependent kinase inhibitor and inhibits MCE and differentiation by blocking its negative regulation during pro-adipocyte differentiation. (25) It can be a mechanism for use. Moreover, the arrest of cell cycle progression in this study is controlled by the inhibition of Cdk2 and Cdk6 at the protein level. Surprisingly, however, Del treatment activated cyclin D1 and c-Myc and inhibited the expression of Gsk3β. The explanation for these different results is that cyclin D1 and c-Myc may be targets of anti-lipogenic factors, provided that their expression is important for synchronizing differentiated cells before they mature into adipocytes (26 , 27) . Therefore, Del-mediated G 1 cell cycle arrest is mediated by the induction of p27 / KIP1 and inhibition of Cdk2 and Cdk6, and the regulation of cyclin D1, c-Myc or Gsk3β by Del is associated with 3T3-L1 cell cycle progression. It seems to be reversed.

Exposure to lipogenic hormone stimulation can quickly stimulate the expression of early stage specific transcription factors, while at the same time the C / EBPβ and C / EBPδ inhibition signals are suppressed. In turn, activation of C / EBPa and C / EBP induces the expression of EBPα and PPARγ, the major regulators of adipose formation. PPARγ and C / EBPa can induce the expression of mature adipocyte markers such as aP2 and adiponectin (28, 2, 29) . The inventors of the present invention found that Del treatment in the lipoforming process negatively regulates the expression of major lipogenic transcription factors, including C / EBPβ, C / EBPδ, PPARγ, C / EBPα, aP2 and adiponectin, in both transcription and translation steps. This suggests that Del can be an excellent anti-obesity drug in that it can effectively inhibit fat formation.

Wnt, a secretory glycoprotein, is involved in various developmental and disease processes such as cell proliferation, cell differentiation, cell migration, and cancer. Wnt4 and Wnt5a in Wnt proteins are expressed during early adipogenesis and promote adipocyte differentiation of 3T3-L1 cells (30) . However, other Wnt ligands such as Wnt1, Wnt3a, Wnt6 and Wnt10b are known to inhibit adipocyte differentiation (3, 31) . In particular, Wnt10b can inhibit adiogenesis by stabilizing β-catenin (11) . In vitro and in vivo studies have shown that Wnt10b participates in the anti-lipogenic Wnt signaling pathway (3) . In addition, anti-Wnt10b treatment in 3T3-L1 pre-fat cells is shown to contribute to adipogenesis, suggesting that Wnt10b plays an important role in adipogenesis. Wnt receptor Fzd2 and co-receptors Lrp5 / 6 are best expressed in pre-adipocytes, but their expression in adipocytes is limited (4, 3, 32) . To assess the effect of Del on the Wnt signaling pathway, the inventors examined the expression patterns of components of the Wnt signaling pathway. Del treatment induced Wnt1 and Wnt10b expression, but Wnt5a and Wnt6 expression did not change significantly. Interestingly, it was confirmed that Wnt receptor Fzd2 and co-receptors Lrp5 / 6 were induced by Del treatment. β-catenin, a canonical Wnt signal target, is highly expressed in undifferentiated 3T3-L1 pre-fat cells, but its expression is greatly reduced when hormone stimulation is given to cells. It has been reported that β-catenin can inhibit PPARγ activity through direct interaction through its TCF / LEF domain (33) . In the absence of Wnt signaling, cytoplasmic β-catenin is rapidly degraded after phosphorylation of the N-terminus at Ser33, Ser37, Tyr41 and Ser45 by Gsk3β and casein kinase I. Pre-lipogenic gene expression of β-catenin is rapidly negatively regulated in MDI-treated 3T3-L1 cells. Therefore, regulation of β-catenin stabilization is an important step in adipocyte maturation and differentiation. In the process of adipocyte differentiation, PPARγ regulates β-catenin degradation in a Gsk3β-dependent or non-dependent manner (8, 33) . Therefore, PPARγ and β-catenin appear to be antagonistic in lipogenesis. The present study showed that Del significantly reduced the mRNA and protein of Gsk3β by phosphorylation at Ser9, which could control the stabilization of cytoplasmic β-catenin concentration. Additionally, Del treatment enables stabilized β-catenin to migrate from the cytoplasm to the nucleus, which can lead to activation of downstream β-catenin target genes cyclin D1 and c-Myc. In addition, other studies have shown that cyclin D1 and c-Myc can inhibit adipose formation by impairing PPARγ function and inhibiting C / EBPa activity through histone deacetylase recruitment (14, 13) . Moreover, another study has shown that TNFα-mediated induction of c-Myc expression inhibits adipose formation (34) . Therefore, the inhibition of PPARγ and C / EBPa expression in this study seems to be due to the activation of cyclin D1 and c-Myc, and further studies on this proposal are needed. Taken together, this study shows that Del may contribute to the inhibition of lipoogenesis through activation of the Wnt / β-catenin signaling pathway.

In conclusion, the anti-lipogenic action of Del from this study is characterized by p27 / KIP1-dependent G 1 cell cycle arrest and C / EBPβ, C / EBPδ, C / EBPα, and PPARγ through Wnt / β-catenin signaling pathways. The target genes of aP2 and adiponectin can be expected to be affected by the negative regulation of major lipogenic transcription factors. Therefore, these phenomena could be the basic research data for the development of drugs to treat obesity, and further in vivo studies will be needed.

Claims (10)

delete delete delete delete A reagent composition for stopping cell cycle progression of pre-adipocytes, including delphinidin or a pharmaceutically acceptable salt thereof. 6. The reagent composition of claim 5, wherein the cell cycle is in the G 0 / G 1 phase. The reagent composition according to claim 5 or 6, wherein the cell cycle progression is stopped by decreasing the expression level of Cdk2, decreasing the expression level of Cdk6, and increasing the expression level of p27 / KIP1. delete delete delete
KR1020150157142A 2015-11-10 2015-11-10 Pharmaceutical composition for treatment of obesity comprising delphinidin or pharmaceutically acceptable salts thereof as an effective component KR102022120B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020150157142A KR102022120B1 (en) 2015-11-10 2015-11-10 Pharmaceutical composition for treatment of obesity comprising delphinidin or pharmaceutically acceptable salts thereof as an effective component

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020150157142A KR102022120B1 (en) 2015-11-10 2015-11-10 Pharmaceutical composition for treatment of obesity comprising delphinidin or pharmaceutically acceptable salts thereof as an effective component

Publications (2)

Publication Number Publication Date
KR20170054686A KR20170054686A (en) 2017-05-18
KR102022120B1 true KR102022120B1 (en) 2019-09-18

Family

ID=59049218

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020150157142A KR102022120B1 (en) 2015-11-10 2015-11-10 Pharmaceutical composition for treatment of obesity comprising delphinidin or pharmaceutically acceptable salts thereof as an effective component

Country Status (1)

Country Link
KR (1) KR102022120B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022050431A1 (en) * 2020-09-01 2022-03-10 경상국립대학교병원 Pharmaceutical composition and health functional food for prevention or treatment of osteoarthritis

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100902768B1 (en) * 2007-05-22 2009-06-15 바이오스펙트럼 주식회사 Agents for Preventing Hair Loss Comprising Delphinidin as an Active Ingredient
KR20150053321A (en) 2013-11-07 2015-05-18 성신여자대학교 산학협력단 Anti obesity Composition comprising anthocyanin originated from black bean peels as an active ingredient

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Journal of Agricultural and food chemistry, 2008, vol. 56, pp. 647~653
Nutrition & Metabolism, 2011, vol. 8, no. 14, pp. 1~9*

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022050431A1 (en) * 2020-09-01 2022-03-10 경상국립대학교병원 Pharmaceutical composition and health functional food for prevention or treatment of osteoarthritis

Also Published As

Publication number Publication date
KR20170054686A (en) 2017-05-18

Similar Documents

Publication Publication Date Title
Lone et al. Curcumin induces brown fat-like phenotype in 3T3-L1 and primary white adipocytes
Jeon et al. Wnt/β-catenin signaling plays a distinct role in methyl gallate–mediated inhibition of adipogenesis
Rahman et al. Delphinidin, a major anthocyanin, inhibits 3T3‐L1 pre‐adipocyte differentiation through activation of Wnt/β‐catenin signaling
Forbes-Hernández et al. Strawberry (Fragaria× ananassa cv. Romina) methanolic extract promotes browning in 3T3-L1 cells
Kim et al. Apigenin isolated from Daphne genkwa Siebold et Zucc. inhibits 3T3-L1 preadipocyte differentiation through a modulation of mitotic clonal expansion
Richard et al. Naringenin inhibits adipogenesis and reduces insulin sensitivity and adiponectin expression in adipocytes
Liu et al. Cerasus humilis cherry polyphenol reduces high-fat diet-induced obesity in C57BL/6 mice by mitigating fat deposition, inflammation, and oxidation
Rahman et al. Cryptotanshinone, a compound of Salvia miltiorrhiza inhibits pre-adipocytes differentiation by regulation of adipogenesis-related genes expression via STAT3 signaling
Zhan et al. Taxifolin ameliorate high-fat-diet feeding plus acute ethanol binge-induced steatohepatitis through inhibiting inflammatory caspase-1-dependent pyroptosis
Cho et al. Ginkgetin, a biflavone from Ginkgo biloba leaves, prevents adipogenesis through STAT5-mediated PPARγ and C/EBPα regulation
Xu et al. Inhibitory effect of fucosylated chondroitin sulfate from the sea cucumber Acaudina molpadioides on adipogenesis is dependent on Wnt/β-catenin pathway
Choi et al. Heshouwu (Polygonum multiflorum Thunb.) ethanol extract suppresses pre-adipocytes differentiation in 3T3-L1 cells and adiposity in obese mice
Kwak et al. Inhibitory effects of hwangryunhaedok-tang in 3T3-L1 adipogenesis by regulation of Raf/MEK1/ERK1/2 pathway and PDK1/Akt phosphorylation
Rafe et al. Preventive role of resveratrol against inflammatory cytokines and related diseases
Shibu et al. Novel anti-aging herbal formulation Jing Si displays pleiotropic effects against aging associated disorders
Shao et al. All-trans retinoic acid shifts rosiglitazone-induced adipogenic differentiation to osteogenic differentiation in mouse embryonic fibroblasts
Zhang et al. Comparative study of DHA with different molecular forms for ameliorating osteoporosis by promoting chondrocyte-to-osteoblast transdifferentiation in the growth plate of ovariectomized mice
Lestari et al. PPARγ expression by rambutan peel extract in obesity rat model-induced high-calorie diet
KR102022120B1 (en) Pharmaceutical composition for treatment of obesity comprising delphinidin or pharmaceutically acceptable salts thereof as an effective component
Zhang et al. Lingonberry anthocyanins inhibit hepatic stellate cell activation and liver fibrosis via tgfβ/smad/ERK signaling pathway
Chen et al. Chimonanthus nitens Oliv. leaf extract exerting anti-hyperglycemic activity by modulating GLUT4 and GLUT1 in the skeletal muscle of a diabetic mouse model
Shah et al. Cross-Talk between Obesity and Diabetes: Introducing Polyphenols as an Effective Phytomedicine to Combat the Dual Sword Diabesity
WO2015005603A1 (en) Small molecule, indirubin-3-oxime, for prevention and treatment of bone disease
Khine et al. Untapped pharmaceutical potential of 4, 5, 4′-trihydroxy-3, 3′-dimethoxybibenzyl for regulating obesity: A cell-based study with a focus on terminal differentiation in adipogenesis
JP7286675B2 (en) Methods and pharmaceutical compositions for the treatment of FGFR3-associated chondrodysplasia

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E601 Decision to refuse application
J201 Request for trial against refusal decision
J301 Trial decision

Free format text: TRIAL NUMBER: 2018101000955; TRIAL DECISION FOR APPEAL AGAINST DECISION TO DECLINE REFUSAL REQUESTED 20180303

Effective date: 20190725

S901 Examination by remand of revocation
GRNO Decision to grant (after opposition)
GRNT Written decision to grant