KR102004478B1 - A method for increasing production of 3-fucosyllactose - Google Patents

A method for increasing production of 3-fucosyllactose Download PDF

Info

Publication number
KR102004478B1
KR102004478B1 KR1020180044384A KR20180044384A KR102004478B1 KR 102004478 B1 KR102004478 B1 KR 102004478B1 KR 1020180044384 A KR1020180044384 A KR 1020180044384A KR 20180044384 A KR20180044384 A KR 20180044384A KR 102004478 B1 KR102004478 B1 KR 102004478B1
Authority
KR
South Korea
Prior art keywords
fucosyllactose
fucosyltransferase
production
present
heptad
Prior art date
Application number
KR1020180044384A
Other languages
Korean (ko)
Inventor
권대혁
유지원
신종혁
Original Assignee
성균관대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 성균관대학교산학협력단 filed Critical 성균관대학교산학협력단
Priority to KR1020180044384A priority Critical patent/KR102004478B1/en
Application granted granted Critical
Publication of KR102004478B1 publication Critical patent/KR102004478B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/02—Monosaccharides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01065—3-Galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase (2.4.1.65), i.e. alpha-1-3 fucosyltransferase

Abstract

The present invention relates to a method for increasing production of 3-fucosyllactose, which comprises the steps of: removing a membrane anchoring region constituting a C-terminal of α 1,3-fucosyltransferase (1,3-FT) derived from Helicobacter pylori; and increasing the number of a region of heptad repeats to introduce the same into Escherichia coli. In using the method of the present invention, it is found that an activity of α 1,3-fucosyltransferase in Escherichia coli is improved to increase production of 3-fucosyllactose. According to the present invention, the method for increasing production of 3-fucosyllactose is used to increase production of 3-fucosyllactose by 5 to 20 folds.

Description

3-푸코실락토오스의 생산을 증가시키는 방법 {A method for increasing production of 3-fucosyllactose}A method for increasing the production of 3-fucosyllactose {3-fucosyllactose}

본 발명은 3-푸코실락토오스의 생산을 증가시키는 방법에 관한 것이다.The present invention relates to a method for increasing the production of 3-fucosyllactose.

사람의 모유에는 200여종 이상의 독특한 구조를 가지는 올리고당(Human milk oligosaccharides, HMOs)이 다른 포유류의 젖에 비해 상당히 높은 농도(5~15g/L)로 존재한다(한국등록특허 제 1731263호 참조). HMOs는 prebiotics로서 장내 해로운 미생물들의 생장을 억제시키고 유익한 미생물들을 풍부하게 한다. 또한 viruses, bacteria, protozoa를 포함하는 여러 병원체들이 상피 세포 표면상의 glycoconjugate 타겟에 결합하는 것을 방해하는 역할을 한다. 200개가 넘는 HMO들 중 fucosylated oligosaccharides는 HMO의 약 50%를 이루고 있으며, 일반적인 우유는 이를 포함하고 있지 않아 현재 많은 관심을 받고 있다. 가장 풍부한 fucosylated HMO인 2′-fucosyllactose (Fuc-α1,2-Gal-β1,4-Glc; 2′-FL)와 3-fucosyllactose (Gal-β1,4-(Fuc-α1,3-)Glc; 3-FL)는 모유에 0.5-2 g/L 함유되어 있다. fucosylated HMOs은 위장관 뿐 아니라, 전신으로 순환되어 효과를 나타낸다. 이는 혈장과 소변에서 검출되는 것으로 알 수 있다. fucosylated HMOs는 면역 반응을 변화시키고 종양의 전이를 조절하며 정균 및 항균 효과를 직접적으로 나타내며 면역성에 대한 내성을 증가시킬 수 있다. 2'-FL과 3-FL은 성인과 영아 모두에게 건강상의 이점을 제공하기 때문에 FL은 영양제와 의약품 성분으로서 큰 주목을 받고 있다.Human milk oligosaccharides (HMOs) with more than 200 unique structures are present at significantly higher concentrations (5-15 g / L) than other mammalian milk (see Korean Patent No. 1731263). HMOs are prebiotics that inhibit the growth of intestinal microorganisms and enrich beneficial microorganisms. It also interferes with the binding of various pathogens, including viruses, bacteria, and protozoa, to glycoconjugate targets on the surface of epithelial cells. Of the over 200 HMOs, fucosylated oligosaccharides make up about 50% of the HMOs, and the general milk does not contain it and is receiving much attention now. The most abundant fucosylated HMO, 2'-fucosyllactose (Fuc-α1,2-Gal-β1,4-Glc; 2'-FL) and 3-fucosyllactose (Gal-β1,4- (Fuc-α1,3-) Glc; 3-FL) is contained in milk of 0.5-2 g / L. Fucosylated HMOs are circulating in the body as well as in the gastrointestinal tract. It can be detected in plasma and urine. Fucosylated HMOs can alter the immune response, regulate tumor metastasis, directly demonstrate bacteriostatic and antibacterial effects, and can increase immune tolerance. Since 2'-FL and 3-FL provide health benefits for both adults and infants, FL is receiving great attention as a nutritional and pharmaceutical ingredient.

2'-FL과 3-FL은 모유에서 추출할 수 있지만, 모유의 공급이 제한적이어서 그에 따른 비용이 매우 비싸다. 다른 동물의 모유는 FL을 매우 소량 포함하고 있기 때문에 이 또한 FL의 대규모 추출에는 적합하지 않다. FL을 화학적 및 효소적으로 합성하는 방법들은 고가의 물질 또는 위험한 기질 및 중간체가 관련되어 있기 때문에 산업적으로 실행 불가능하다. FL의 효소적 합성에는 guanosine 5'-diphosphate (GDP)-L-fucose (GDP-L-fucose)가 기질로 사용되는데, 이는 최종생산물보다 비싸다. 때문에 경제적으로 FL을 대량 생산 하기 위해서는 현재 설계된 세포 생 촉매 방법을 사용하는 것이 유일한 방법이다. 실제로, 유아용 분유에 함유된 유일하게 상업적으로 이용 가능한 2'-FL은 재조합 대장균에서 생산되었다. GDP-L-fucose는 대장균에서 colonic acid 생합성에 관여하므로, GDP-L-fucose에 대한 생합성 경로를 강화시키고 heterologous fucosyltransferase(FT)를 발현시키면 2'-FL 및 3-FL을 대장균에서 대량생산 할 수 있다. 2'-FL 및 3-FL의 생산은 균주의 대사 공학 및 FT의 개선을 통해 더욱 개선 될 수 있다.2'-FL and 3-FL can be extracted from breast milk, but the supply of breast milk is limited and the cost is very high. This is also not suitable for large-scale extraction of FL, since other animal breast milk contains very small amounts of FL. Methods of chemically and enzymatically synthesizing FL are industrially impractical because they involve expensive materials or dangerous substrates and intermediates. For the enzymatic synthesis of FL, guanosine 5'-diphosphate (GDP) -L-fucose (GDP-L-fucose) is used as a substrate, which is more expensive than the final product. Therefore, the only way to economically produce FL in large quantities is to use the currently designed cell biocatalytic method. In fact, the only commercially available 2'-FL contained in baby formula was produced in recombinant E. coli. Since GDP-L-fucose is involved in biosynthesis of colonic acid in E. coli, 2'-FL and 3-FL can be mass produced in E. coli by enhancing biosynthetic pathway to GDP-L-fucose and expressing heterologous fucosyltransferase (FT) have. The production of 2'-FL and 3-FL can be further improved through the metabolic engineering of the strain and the improvement of FT.

FT(fucosyltransferase)는 하기와 같이 GDP-L-fucose의 fucosyl residue를 lactose로 옮긴다. FT (fucosyltransferase) transfers the fucosyl residue of GDP-L-fucose to lactose as follows.

Figure 112018037987917-pat00001
Figure 112018037987917-pat00001

이들은 수용체 탄수화물의 부위 선택성에 따라 1,2-, 1,3 / 4- 및 1,6 선택 효소 군으로 분류된다. 진핵 생물의 FT는 대개 transmembrane domain을 가지며 그 활성은 번역 후 변형에 의존하기 때문에 원핵 생물에서의 사용이 제한적이다. Helicobacter pylori (H. pylori) 에서 첫 번째 FT가 발견 된 후 세균성 FT들은 transmembrane domain을 가지고 있지 않는 것으로 밝혀졌다. 하지만 세균성 FT의 활성은 대장균에서 여전히 낮아 2'-FL 또는 3-FL의 생산량이 매우 낮았다. 박테리아 FT들은 transmembrane domain을 가지고 있지 않지만, 대장균에서 용해성이 부족하게 발현되기 때문이다. 효소가 잘 발현 되더라도, 세포 pellet에서 주로 발견되었다. α-1,2-fucosyltransferase(1,2-FT)는 소수성 영역 또는 짧은 내부 transmembrane domain 같은 효소의 막 결합영역을 가지고 있기 때문에 빈약한 발현 또는 낮은 용해성을 나타낸다. 발현된 1,2-FT들의 용해도를 향상시키기 위해 다양한 융합 단백질을 효소의 N-말단에 첨가한 결과 효소마다 가용성 발현량이 다양하게 증가했으며, 증가된 1,2-FT의 가용성 발현으로 대장균 내에서 2'-FL의 생산이 증가하였다.They are classified into 1,2-, 1,3 / 4- and 1,6-selective enzymes depending on the site selectivity of the receptor carbohydrate. FT of eukaryotes usually has a transmembrane domain and their use is limited in prokaryotes because their activity depends on post-translational modifications. After the first FT was found in Helicobacter pylori ( H. pylori ), bacterial FTs did not have a transmembrane domain. However, the activity of bacterial FT was still low in E. coli, resulting in very low production of 2'-FL or 3-FL. Bacterial FTs do not have a transmembrane domain, but they are expressed insufficiently in E. coli. Although the enzyme is well expressed, it was mainly found in cell pellets. α-1,2-fucosyltransferase (1,2-FT) exhibits poor expression or poor solubility because it has a membrane-binding domain of an enzyme, such as a hydrophobic domain or a short internal transmembrane domain. In order to improve the solubility of the expressed 1,2-FTs, various fusion proteins were added to the N-terminus of the enzyme. As a result, the soluble expression levels of various enzymes were increased, and increased expression of 1,2- Production of 2'-FL increased.

그러나, α-1,3 / 4-fucosyltransferase (1,3 / 4-FT)의 발현이 낮거나 불용성 인 이유는 1,2-FT와는 다르다. 1,3 / 4-FTs의 길이는 300-480 아미노산 정도로 매우 다양하다. H. pylori, H. hepaticus 및 Bacillus fragilis와 같은 박테리아에서 유래 된 1,3 / 4-FT는 다양한 기질 특이성 및 부위 선택성을 나타낸다. H. pylori 1,3 / 4-FT와 다양한 융합단백질들과의 융합은 효소의 가용성 발현을 돕지는 못했지만, 효소의 C-말단 부분의 절단은 효소의 활성 및 가용성 발현을 가능하게 했다. 대부분의 1,3 / 4-FT는 C-말단 영역에서 일정 서열의 반복인 heptad repeats이 2-10개 확인된다. 이 heptad repeats은 줄기로 작용하여 효소의 이량체화를 유도한다. Heptad repeats에 이어진 C-말단 양친매성 나선은 membrane anchoring을 담당한다. 여러 연구에 따르면 heptad repeats 또는 막고정영역(양친매성나선)의 절단은 효소의 용해성 발현 수율을 증가시킨다고 한다. 모든 heptad repeats의 결실은 효소 활성을 거의 완전히 잃게 하지만, H. pylori 11639 1,3-FT는 단 한 번의 heptad repeats으로 완전한 활성을 나타내고, H. pylori UA948 1,3-FT는 단 한 번의 heptad repeats으로 부분적으로 활성을 나타낸다. 그 후 다른 연구에서는 H. pylori 11639 1,3-FT의 모든 heptad repeats이 제거되면 활성을 가지지 않게 된다는 것을 확인했다. 그러나, 이 연구에서는 heptad repeats이 반복되는 횟수에 따른 영향(0과 5 사이)은 테스트되지 않았다. 최근에 보고 된 가장 높은 가용성 발현 수율(150-200 mg/L)은 H. pylori 26695 1,3-FT의 C-말단 부위에서 52번째 아미노산이 절단 된 경우(Δ52 FutA)이다. Δ52 FutA는 막고정영역이 없는 상태이며, 하나의 heptad repeat만을 가지고 있고, A128N / H129E / Y132I / S46F를 조작하여 효소의 활성을 15배 향상시켰다. 이러한 결과는 1,3-FT는 하나의 heptad repeat만을 보유해도 활성을 가진다는 것을 나타낸다. However, the expression of α-1,3 / 4-fucosyltransferase (1,3 / 4-FT) is low or insoluble, which is different from 1,2-FT. The length of 1,3 / 4-FTs varies from 300-480 amino acids. 1,3 / 4-FT derived from bacteria such as H. pylori, H. hepaticus and Bacillus fragilis exhibit a variety of substrate specificity and site selectivity. Fusion of H. pylori 1,3 / 4-FT with various fusion proteins did not aid in solubility expression of the enzyme, but cleavage of the C-terminal portion of the enzyme made it possible to express the enzyme activity and solubility. In most of the 1,3 / 4-FT, 2-10 heptad repeats, a repeat of a constant sequence in the C-terminal region, are identified. This heptad repeats acts as a stem to induce dimerization of the enzyme. The C-terminal amphipathic helix following heptad repeats is responsible for membrane anchoring. Several studies have shown that cleavage of heptad repeats or membrane-bound regions (amphipathic helix) increases the solubility expression yield of the enzyme. The deletion of all heptad repeats almost completely lost the enzyme activity, but H. pylori 11639 1,3-FT showed complete activity with only one heptad repeats and H. pylori UA948 1,3-FT showed only one heptad repeats Lt; / RTI > Other studies have confirmed that the removal of all heptad repeats of H. pylori 11639 1,3-FT results in no activity. However, the effects of repeated heptad repeats (between 0 and 5) were not tested in this study. The highest reported solubility yield (150-200 mg / L) reported recently is when the 52nd amino acid in the C-terminal region of H. pylori 26695 1,3-FT is cleaved (Δ52 FutA). Δ52 FutA has no membrane anchoring domain, only one heptad repeat, and improved enzyme activity by 15 fold by manipulating A128N / H129E / Y132I / S46F. These results indicate that 1,3-FT is active even when only one heptad repeat is present.

이에, 본 발명자들은 C-말단 부위 절단은 1,3-FT의 가용성 발현을 증가시키므로 하나의 heptad repeats을 갖는 절단된 FT가 재조합 대장균에서 3-FL의 생산을 증가시킬 수 있을 것이라 생각하고, 3-FL 생산을 유도하는 완전한 대사 경로를 도입한 대장균을 이용하여 FT 변이체들의 세포 내 성능을 확인한 결과, 3-FL 생산은 기존의 예측과는 반대로 오히려 heptad repeat의 길이를 늘렸을 때 향상되는 것을 발견하였다. 본 발명에서는 이를 여러 1,3-FT 유전자를 이용하여, 체계적으로 길이를 늘이거나 줄인 효소를 발현하는 전세포촉매를 제조하고, 이들의 3-FL 생산을 확인하여 본 발명을 완성하였다.Thus, we believe that C-terminal truncation increases the soluble expression of 1,3-FT, so that truncated FT with one heptad repeats may increase the production of 3-FL in recombinant E. coli. In the intracellular performance of FT mutants using Escherichia coli that introduced a complete metabolic pathway inducing FL production, 3-FL production was found to be improved when the length of heptad repeats was increased, contrary to the conventional prediction Respectively. In the present invention, the present inventors have completed the present invention by confirming the production of 3-FL thereof by using various 1,3-FT genes to prepare a whole cell catalyst expressing enzymes that are systematically extended or reduced in length.

본 발명자들은 종래의 대장균을 이용한 3-푸코실락토오스의 생산에서 미생물 내 α-1,3-푸코실 전이효소의 활성이 매우 중요함을 인식하고, 세포 내 활성을 증대시키기 위한 방법을 개발하기 위해 세포 내 효소의 수용성 발현을 높이기 위하여 헵타드 반복(heptad repeat)의 수를 감소시키는 기존의 알려진 방법 및 세포 내 효소의 수용성 발현의 양이 적어지더라도 활성형 효소의 비율을 높일 수 있는 방법을 체계적으로 비교함으로써 α-1,3-푸코실 전이효소의 막고정영역(membrane anchoring region)은 결실시키고 헵타드 반복(heptad repeat)의 수는 오히려 증가시켜 대장균에 도입하였을 때, 대장균 내의 α-1,3-푸코실 전이효소의 활성이 증가하여 3-푸코실락토오스 생산량이 증가하는 것을 확인하였는바, 이에 기초하여 본 발명을 완성하였다.The present inventors have recognized that the activity of the? -1,3-fucosyltransferase in microorganisms is very important in the production of 3-fucosyllactose using conventional E. coli, and to develop a method for increasing intracellular activity In order to increase the expression of the water-soluble enzyme in the cell, the known method of reducing the number of heptad repeats and the method of increasing the proportion of the active enzyme even if the amount of the water- , The membrane anchoring region of the? -1,3-fucosyltransferase was deleted and the number of heptad repeats was increased, and when introduced into E. coli, The activity of 3-fucosyltransferase was increased and the yield of 3-fucosyllactose was increased. Based on this finding, the present invention was completed.

상기와 같은 목적을 달성하기 위하여, 본 발명은 (a) 막고정영역(membrane anchoring region)을 가지고 일정 헵타드 반복(heptad repeat) 수를 가지고 있는 α-1,3-푸코실 전이효소(1,3-fucosyltransferase; 1,3-FT)의 막고정영역을 결실(deletion)시키고, 헵타드 반복 수를 하나 이상 증가시키는 단계; 및In order to achieve the above-mentioned object, the present invention provides a method for producing an α-1,3-fucosyltransferase (1) having a membrane anchoring region and having a certain number of heptad repeats, 3-fucosyltransferase; 1,3-FT) and increasing one or more heptad repeat numbers; And

(b) 상기 (a)에서 엔지니어링한 α-1,3-푸코실 전이효소를 미생물에 도입하여 푸코실락토오스(fucosyllactose; FL)를 생산하는 단계;(b) introducing α-1,3-fucosyltransferase engineered in (a) into a microorganism to produce fucosyllactose (FL);

를 포함하는, 푸코실락토오스(fucosyllactose; FL)의 생산을 증가시키는 방법을 제공한다.To increase the production of fucosyllactose (FL).

본 발명의 일구현예로, 상기 (a)에서 α-1,3-푸코실 전이효소는 헬리코박터 파일로리(Helicobacter pylori)로부터 유래될 수 있다.In one embodiment of the present invention, the α-1,3-fucosyltransferase in (a) above can be derived from Helicobacter pylori.

본 발명의 다른 구현예로, 상기 엔지니어링한 α-1,3-푸코실 전이효소가 가지는 헵타드 반복(heptad repeat) 수는 5 내지 11개일 수 있다.In another embodiment of the present invention, the number of heptad repeats of the engineered α-1,3-fucosyltransferase may be 5 to 11.

본 발명의 또 다른 구현예로, 상기 (b)에서 푸코실락토오스(fucosyllactose; FL)는 3-푸코실락토오스(3-fucosyllactose; 3-FL)일 수 있다.In another embodiment of the present invention, in (b), fucosyllactose (FL) may be 3-fucosyllactose (3-FL).

또한, 본 발명은 α-1,3-푸코실 전이효소(1,3-fucosyltransferase; 1,3-FT)에 있어서,The present invention also relates to a method for producing 1,3-fucosyltransferase (1,3-FT)

막고정영역(membrane anchoring region)이 결실(deletion)되고, 헵타드 반복(heptad repeat) 수가 하나 이상 증가된 α-1,3-푸코실 전이효소(1,3-fucosyltransferase; 1,3-FT)를 제공한다.1,3-fucosyltransferase (1,3-FT) having a membrane anchoring region deletion and an increase in the number of heptad repeats by one or more, Lt; / RTI >

본 발명에 따른 헬리코박터 파일로리(Helicobacter pylori) 유래 α-1,3-푸코실 전이효소(α1,3-fucosyltransferase; 1,3-FT)의 c-terminal을 구성하고 있는 막고정영역(membrane anchoring region)을 결실시키고 헵타드 반복(heptad repeats)의 수를 증가시켜 대장균(Escherichia coli)에 도입하였을 때, 대장균 내의 α-1,3-푸코실 전이효소의 활성이 증가하여 3-푸코실락토오스 생산량이 증가하는 것을 확인하였는바, 본 발명의 3-푸코실락토오스 생산을 증가시키는 방법에 의해 생산량이 5~20배 증가된 3-푸코실락토오스를 얻을 수 있다.The membrane anchoring region constituting the c-terminal of the α-1,3-fucosyltransferase (1,3-FT) derived from Helicobacter pylori according to the present invention, And when the number of heptad repeats is increased and introduced into Escherichia coli, the activity of the? -1,3-fucosyltransferase in E. coli is increased to increase the yield of 3-fucosyllactose Fucosyllactose having an increased yield of 5 to 20 times by the method of increasing the production of 3-fucosyllactose according to the present invention.

도 1은 본 발명의 실시예 1에서 FT1 및 FT2 염기서열에서의 대장균에 대한 rare codon들을 웹사이트(http://people.mbi.ucla.edu/sumchan/caltor.html)를 사용하여 분석한 것을 나타낸 도면이다.
도 2는 본 발명의 실시예 1에서 코돈 최적화 전후의 FT1 및 FT2 유전자 서열을 나타낸 도면이다.
도 3은 본 발명의 실시예 1에서 엔지니어링된 대장균 ΔLM15세포에서의 GDP-L-fucose와 fucosyllactose (FL) 생합성을 포함하는 대사경로를 나타낸 도면이다.
도 4는 본 발명의 일구현예에 따른 헬리코박터 파일로리에서 유래한 1,3-FT의 구조를 나타낸 도면이다.
도 5는 본 발명의 일구현예에 따른 FT2 절단 변이체들의 구조 및 3-FL 생산량을 나타낸 것으로, (A)는 FT2의 전체적인 구조를 나타낸 도면이고, (B)는 c-말단영역 절단으로 만들어진 FT2의 4개의 변이체들의 구조를 간략하게 나타낸 도면이며, (C)는 E.coli BL21(DE3)을 이용하여 구축한 FT2 변이체들의 발현량을 SDS-PAGE로 확인한 결과를 나타낸 도면이고, (D)는 FT2 변이체들의 배양 72시간 후 생산된 3-FL의 양을 나타낸 도면이다.
도 6은 본 발명의 일구현예에 따른 FT2 변이체들의 배양 시간에 따른 3-FL, OD600, glycerol 농도, lactose 농도값을 나타낸 것으로, (A)는 FT2, (B)는 FT2-1, (C)는 FT2-2, (D)는 FT2-3, (E)는 FT2-4의 배양시간에 따른 각 농도를 나타낸 도면이다.
도 7은 본 발명의 일구현예에 따른 FT1 절단 변이체들의 구조 및 3-FL 생산량을 나타낸 것으로, (A)는 FT1의 전체적인 구조를 나타낸 도면이고, (B)는 c-말단영역 절단으로 만들어진 FT1의 4개의 변이체들의 구조를 간략하게 나타낸 도면이며, (C)는 E.coli BL21(DE3)을 이용하여 구축한 FT1 변이체들의 발현량을 SDS-PAGE로 확인한 결과를 나타낸 도면이고, (D)는 FT1 변이체들의 배양 72시간 후 생산된 3-FL의 양을 나타낸 도면이다.
도 8은 본 발명의 일구현예에 따른 FT1 변이체들의 배양 시간에 따른 3-FL, OD600, glycerol 농도, lactose 농도값을 나타낸 것으로, (A)는 FT1, (B)는 FT1-1, (C)는 FT1-2, (D)는 FT1-3, (E)는 FT1-4의 배양시간에 따른 각 농도를 나타낸 도면이다.
도 9는 본 발명의 일구현예에 따른 FT2와 pylT의 1,3-FT 유전자 서열을 비교한 것을 나타낸 도면이다.
도 10은 본 발명의 일구현예에 따른 pylT 절단 변이체들의 구조 및 3-FL 생산량을 나타낸 것으로, (A)는 pylT의 전체 구조를 간략하게 나타낸 도면이고, (B)는 E.coli BL21(DE3)을 이용하여 구축한 pylT 및 pylT-D의 발현량을 SDS-PAGE로 확인한 결과를 나타낸 도면이고, (C)는 pylT 및 pylT-D의 배양 72시간 후 생산된 3-FL의 양을 나타낸 도면이다.
도 11은 본 발명의 일구현예에 따른 pylT 및 pylT-D의 배양 시간에 따른 3-FL, OD600, glycerol 농도, lactose 농도값을 나타낸 것으로, (A)는 pylT, (B)는 pylT-D의 배양시간에 따른 각 농도를 나타낸 도면이다.
도 12는 본 발명의 일구현예에 따른 FT2 및 FT1의 헵타드 반복(heptad repeat)의 수를 증가시킨 변이체들의 구조 및 3-FL 생산량을 나타낸 것으로, (A)는 FT2의 헵타드 반복의 수를 증가시킨 변이체들의 구조를 간략하게 나타낸 도면이고, (B)는 FT2 변이체들의 배양 72시간 후 생산된 3-FL의 양을 나타낸 도면이며, (C)는 FT1의 헵타드 반복의 수를 증가시킨 변이체들의 구조를 나타낸 도면이고, (D)는 FT1 변이체들의 배양 72시간 후 생산된 3-FL의 양을 나타낸 도면이다.
도 13은 본 발명의 일구현예에 따른 FT2 및 FT1의 헵타드 반복의 수를 증가시킨 변이체들의 발현량 및 상기 변이체들의 배양 시간에 따른 3-FL, OD600, glycerol 농도, lactose 농도값을 나타낸 것으로, (A)는 E.coli BL21(DE3)을 이용하여 FT2 변이체들의 발현량을 SDS-PAGE로 확인한 결과를 나타낸 도면이고, (B)~(E)에서 (B)는 FT2-2, (C)는 FT2-H7-D, (D)는 FT2-H10-D, (E)는 FT2-H11-D의 배양시간에 따른 3-FL, OD600, glycerol 농도, lactose 농도값을 각각 나타낸 도면이다. 또한, (F)는 E.coli BL21(DE3)을 이용하여 FT1 변이체들의 발현량을 SDS-PAGE로 확인한 결과를 나타낸 도면이고, (G)~(H)에서 (G)는 FT1-H9, (H)는 FT1-H9-D의 배양시간에 따른 3-FL, OD600, glycerol 농도, lactose 농도값을 각각 나타낸 도면이다.
도 14는 본 발명의 일구현예에 따른 FTm 변이체의 구조 및 3-FL 생산량을 나타낸 것으로, (A)는 FTm 및 FTm 변이체의 전체 구조를 간략하게 나타낸 도면이고, (B)는 E.coli BL21(DE3)을 이용하여 FTm 및 FTm-H11-D의 발현량을 SDS-PAGE로 확인한 결과를 나타낸 도면이며, (C)는 FTm 및 FTm-H11-D의 배양 72시간 후 생산된 3-FL의 양을 나타낸 도면이다.
도 15는 본 발명의 일구현예에 따른 FT2-3 및 FTm의 1,3-FT 유전자 서열을 비교하여 나타낸 도면이다.
도 16은 본 발명의 일구현예에 따른 FT2-3 및 FTm의 발현량 및 배양 시간에 따른 3-FL, OD600, glycerol 농도, lactose 농도값을 나타낸 것으로, (A)는 E.coli BL21(DE3)을 이용하여 FT2-3 및 FTm의 발현량을 SDS-PAGE로 비교한 결과를 나타낸 도면이고, (B)~(C)는 각각 FTm-H11-D의 배양시간에 따른 3-FL, OD600, glycerol 농도, lactose 농도값을 나타낸 도면이다.
도 17은 본 발명의 일구현예에 따른 FT2, FT1, pylT, 및 FTm의 변이체들의 구조를 간략하게 나타낸 도면이다.1 shows the results of analysis of rare codons for E. coli in the FT1 and FT2 nucleotide sequences in Example 1 of the present invention using a website (http://people.mbi.ucla.edu/sumchan/caltor.html) Fig.
Fig. 2 is a diagram showing FT1 and FT2 gene sequences before and after codon optimization in Example 1 of the present invention. Fig.
3 is a diagram showing a metabolic pathway including GDP-L-fucose and fucosyllactose (FL) biosynthesis in E. coli DELTA LM15 cells engineered in Example 1 of the present invention.
4 is a view showing the structure of 1,3-FT derived from Helicobacter pylori according to an embodiment of the present invention.
FIG. 5 shows the structure and 3-FL production of FT2 truncations according to an embodiment of the present invention. FIG. 5A shows the overall structure of FT2, FIG. 5B shows FT2 (C) shows the results of SDS-PAGE analysis of the expression levels of FT2 variants constructed using E. coli BL21 (DE3), and (D) shows the results of SDS- FT2 < / RTI > variants after 72 hours of incubation.
FIG. 6 shows the values of 3-FL, OD 600 , glycerol, and lactose concentration of the FT2 variants according to one embodiment of the present invention. FIG. 6A shows FT2, FIG. C) shows FT2-2, (D) shows FT2-3, and (E) shows the respective concentrations according to the incubation time of FT2-4.
FIG. 7 shows the structure and 3-FL production amount of FT1 truncation mutants according to one embodiment of the present invention, wherein (A) shows the overall structure of FT1, (B) shows FT1 (C) shows the results of SDS-PAGE analysis of the expression levels of FT1 variants constructed using E. coli BL21 (DE3), and (D) shows the results of SDS- FT1 < / RTI >< RTI ID = 0.0 > variants. ≪ / RTI >
FIG. 8 shows the values of 3-FL, OD 600 , glycerol, and lactose according to the incubation time of FT1 variants according to an embodiment of the present invention. FIG. 8A shows FT1, B shows FT1-1, C) shows FT1-2, (D) shows FT1-3, and (E) shows the respective concentrations according to the incubation time of FT1-4.
FIG. 9 shows a comparison of 1,3-FT gene sequences of FT2 and pylT according to an embodiment of the present invention.
FIG. 10 shows the structure and 3-FL production amount of pylT truncation mutants according to one embodiment of the present invention, wherein (A) is a schematic view of the entire structure of pylT, (B) (C) shows the amount of 3-FL produced after 72 hours of incubation of pylT and pylT-D. Fig. 6C shows the amount of 3-FL produced after 72 hours of incubation of pylT and pylT-D to be.
FIG. 11 shows the values of 3-FL, OD 600 , glycerol, and lactose according to the incubation time of pylT and pylT-D according to an embodiment of the present invention, wherein (A) D of each culture according to the incubation time.
Figure 12 shows the structure and 3-FL production of mutants that increased the number of heptad repeats of FT2 and FT1 according to one embodiment of the present invention, wherein (A) is the number of heptad repeat of FT2 (B) shows the amount of 3-FL produced 72 hours after the incubation of the FT2 variants, and (C) shows the increase in the number of heptad repeats of FT1 (D) shows the amount of 3-FL produced after 72 hours of incubation of FT1 variants.
FIG. 13 shows the expression levels of mutants by increasing the number of heptad repeats of FT2 and FT1 according to an embodiment of the present invention and the values of 3-FL, OD 600 , glycerol, and lactose according to the incubation time of the mutants (A) shows the result of SDS-PAGE analysis of the expression level of FT2 variants using E. coli BL21 (DE3), (B) to (E) FL, OD 600 , glycerol concentration, and lactose concentration according to the incubation time of FT2-H11-D, respectively, in the case of FT2-H7-D, to be. (F) shows the results of SDS-PAGE analysis of the expression levels of FT1 variants using E. coli BL21 (DE3). In (G) to (H) H) shows the values of 3-FL, OD 600 , glycerol concentration, and lactose concentration according to the culture time of FT1-H9-D, respectively.
FIG. 14 shows the structure and 3-FL production amount of the FTm variant according to an embodiment of the present invention, wherein (A) is a schematic view showing the entire structure of the FTm and FTm variants, (B) (FTm-H11-D), the expression level of FTm and FTm-H11-D was determined by SDS-PAGE using the DE-3 (DE3) Fig.
FIG. 15 is a graph comparing the 1,3-FT gene sequences of FT2-3 and FTm according to an embodiment of the present invention.
16 shows the values of 3-FL, OD 600 , glycerol and lactose according to the amount of expression of FT2-3 and FTm and the incubation time according to an embodiment of the present invention. (A) (B) and (C) show the results of comparison of the expression amounts of FT2-3 and FTm by SDS-PAGE using 3-FL, DE3 according to the incubation time of FTm-H11-D, 600 , glycerol concentration, and lactose concentration.
FIG. 17 is a diagram illustrating a structure of mutants of FT2, FT1, pylT, and FTm according to an embodiment of the present invention.

본 발명은 다양한 변환을 가할 수 있고 여러 가지 실시예를 가질 수 있는 바, 특정 실시예들을 도면에 예시하고 상세한 설명에 상세하게 설명하고자 한다. 그러나, 이는 본 발명을 특정한 실시 형태에 대해 한정하려는 것이 아니며, 본 발명의 사상 및 기술 범위에 포함되는 모든 변환, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다. 본 발명을 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.BRIEF DESCRIPTION OF THE DRAWINGS The present invention is capable of various modifications and various embodiments, and specific embodiments are illustrated in the drawings and described in detail in the detailed description. It is to be understood, however, that the invention is not to be limited to the specific embodiments, but includes all modifications, equivalents, and alternatives falling within the spirit and scope of the invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Hereinafter, the present invention will be described in detail with reference to the accompanying drawings.

이하, 본 발명을 상세히 설명한다.Hereinafter, the present invention will be described in detail.

본 발명은 (a) 막고정영역(membrane anchoring region)을 가지고 일정 헵타드 반복(heptad repeat) 수를 가지고 있는 α-1,3-푸코실 전이효소(1,3-fucosyltransferase; 1,3-FT)의 막고정영역을 결실(deletion)시키고, 헵타드 반복 수를 하나 이상 증가시키는 단계; 및(A) 1,3-fucosyltransferase (1,3-FT) having a membrane anchoring region and having a certain number of heptad repeats Deletion of the membrane-immobilized region of the membrane, and increasing the number of repeats of the heptad by one or more; And

(b) 상기 (a)에서 엔지니어링한 α-1,3-푸코실 전이효소를 미생물에 도입하여 푸코실락토오스(fucosyllactose; FL)를 생산하는 단계;(b) introducing α-1,3-fucosyltransferase engineered in (a) into a microorganism to produce fucosyllactose (FL);

를 포함하는, 푸코실락토오스(fucosyllactose; FL)의 생산을 증가시키는 방법을 제공한다.To increase the production of fucosyllactose (FL).

본 발명에서, 상기 "푸코실락토오스(fucosyllactose; FL)"는 인간 모유에 함유된 Human milk oligosaccharides(HMOs)로서, 모유 유래 FL은 인체 내에서 두뇌발달 및 면역반응조절, prebiotics로서 Lactobacillus 및 Bifidobacteria와 같은 장내 유용한 미생물의 생장 촉진, 호흡기 병원균인 Pseudomonas aeruginosa과 Clostridium, Salmonella fyris의 수용체에 대한 인식물질이 되어 이들의 침입을 경쟁적으로 저해하여 생장을 막는 역할 등을 하며, 푸코실전이효소(fucosyltransferase; FT)의 작용에 의해 생산될 수 있다.In the present invention, the term "fucosyllactose (FL)" as used herein refers to human milk oligosaccharides (HMOs) contained in human breast milk. FL is derived from human milk such as Lactobacillus and Bifidobacteria as prebiotics Promoting the growth of beneficial microorganisms in the intestines, the respiratory pathogen Pseudomonas It is a recognition substance for receptors of aeruginosa , Clostridium, and Salmonella fyris , and competitively inhibits the invasion of these receptors, thereby preventing growth. Fucosylation can be produced by the action of an enzyme (fucosyltransferase; FT).

본 발명에서 상기 "헵타드 반복(heptad repeat)"은 7개의 아미노산의 반복 패턴으로 구성된 구조 모티프의 한 예로, 헵타드 반복의 위치는 일반적으로 소문자 a~g로 표시된다. In the present invention, the "heptad repeat" is an example of a structural motif composed of a repeating pattern of seven amino acids, and the position of the heptad repeat is generally represented by lowercase letters a to g.

본 발명에서 상기 "결실(deletion)"은 DNA 염기배열에서 일부가 소실되는 것을 말하며, 점돌연변이와는 달리 결실에 의한 돌연변이는 야생형으로 복귀변이하는 일이 없다.In the present invention, the term "deletion" refers to the disappearance of a part of DNA base sequence. Unlike the point mutation, mutation due to deletion does not return to the wild type.

본 발명의 상기 α-1,3-푸코실 전이효소는 헬리코박터 파일로리(Helicobacter pylori)로부터 유래될 수 있으나 이에 제한되지 않으며, activity를 가지는 catalytic region, 효소의 dimerization에 관여하는 coiled coil을 이루는 헵타드 반복(heptad repeat), positive&hydrophobic region으로 이루어져 있는 막고정영역(membrane anchoring region)으로 구성되어 있다. The α-1,3-fucosyltransferase of the present invention may be derived from Helicobacter pylori, but is not limited to, a catalytic region having activity, a heptad repeat of a coiled coil involved in enzyme dimerization (heptad repeat), and a membrane anchoring region consisting of positive and hydrophobic regions.

또한, 본 발명에서 막고정영역을 가지고 일정 헵타드 반복 수를 가지는 α-1,3-푸코실 전이효소의 막고정영역을 절단하여 결실시키고, 헵타드 반복 수를 하나 이상 증가시켜 5 내지 11개로 만드는 것이 3-FL 생산을 증가시키기 위해 바람직할 수 있으나, 상기 개수에 제한되는 것은 아니다.Further, in the present invention, the membrane-immobilized region of the? -1,3-fucosyltransferase having a constant heptad repeat number having a membrane-immobilized region is cleaved and deleted, and the heptad repeat number is increased by one or more to 5 to 11 It may be desirable to increase 3-FL production, but is not limited to this number.

또한, 본 발명의 상기 (b) 단계에서 푸코실락토오스(fucosyllactose; FL)를 생산하기 위해 막고정영역을 결실시키고 헵타드 반복 수를 증가시킨 α-1,3-푸코실 전이효소를 도입하는 미생물은 대장균(Escherichia coli)을 사용할 수 있으나 이에 제한되지 않으며, 이 때 상기 푸코실락토오스(fucosyllactose; FL)는 3-푸코실락토오스(3-fucosyllactose; 3-FL)일 수 있으나, 이에 제한되지 않는다.In order to produce fucosyllactose (FL) in the step (b) of the present invention, a microorganism which deletes the membrane-immobilized region and introduces an? -1,3-fucosyltransferase having an increased number of repeats of heptad Escherichia coli may be used but is not limited thereto. The fucosyllactose (FL) may be 3-fucosyllactose (3-FL), but is not limited thereto.

또한, 본 발명은 α-1,3-푸코실 전이효소(1,3-fucosyltransferase; 1,3-FT)에 있어서,The present invention also relates to a method for producing 1,3-fucosyltransferase (1,3-FT)

막고정영역(membrane anchoring region)이 결실(deletion)되고, 헵타드 반복(heptad repeat) 수가 하나 이상 증가된 α-1,3-푸코실 전이효소(1,3-fucosyltransferase; 1,3-FT)를 제공한다.1,3-fucosyltransferase (1,3-FT) having a membrane anchoring region deletion and an increase in the number of heptad repeats by one or more, Lt; / RTI >

본 발명의 일실험예에서는 FT2 변이체(FT2-1, FT2-2, FT2-3, FT2-4)들의 대장균세포에서의 발현량 및 3-FL 생산량을 확인하였다(실험예 1 및 도 5~6 참조).In one experimental example of the present invention, the amount of expression of FT2 variants (FT2-1, FT2-2, FT2-3, and FT2-4) in E. coli cells and the production of 3-FL were confirmed (Experimental Example 1 and FIGS. Reference).

본 발명의 다른 실험예에서는 FT1 변이체(FT1-1, FT1-2, FT1-3, FT1-4)들의 대장균 세포에서의 발현량 및 3-FL 생산량을 확인하였다(실험예 2 및 도 7~8 참조).In another experimental example of the present invention, the amount of expression of FT1 variants (FT1-1, FT1-2, FT1-3, and FT1-4) in E. coli cells and the production of 3-FL were confirmed (Experimental Example 2 and Figs. Reference).

본 발명의 또 다른 실험예에서는 pylT 변이체(pylT-D)의 대장균 세포에서의 발현량 및 3-FL 생산량을 확인하였다(실험예 3 및 도 10~11 참조).In another experiment example of the present invention, the amount of expression of pylT mutant (pylT-D) in E. coli cells and the yield of 3-FL were confirmed (see Experimental Example 3 and FIGS. 10 to 11).

본 발명의 또 다른 실험예에서는 FT2 및 FT1의 heptad repeat 수를 증가시킨 변이체들의 3-FL 생산량을 확인하였다(실험예 4 및 도 12~13 참조).In another experimental example of the present invention, 3-FL production of mutants with increased heptad repeat number of FT2 and FT1 was confirmed (see Experimental Example 4 and FIGS. 12 to 13).

본 발명의 또 다른 실험예에서는 FT2-3 및 FTm 변이체의 대장균 세포에서의 발현량 및 3-FL 생산량을 확인하였다(실험예 5 및 도 14, 16 참조).In another experimental example of the present invention, the amount of expression of FT2-3 and FTm variants in E. coli cells and the production of 3-FL were confirmed (see Experimental Example 5 and FIGS. 14 and 16).

이하, 본 발명의 바람직한 실시예 및 실험예를 첨부도면을 참조하여 상세히 설명하기로 한다. 다만, 이들 실시예 및 실험예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예 및 실험예에 의해 제한되는 것으로 해석되지는 않는다 할 것이다.Hereinafter, preferred embodiments and experimental examples of the present invention will be described in detail with reference to the accompanying drawings. However, these examples and experimental examples are for illustrating the present invention only, and the scope of the present invention shall not be construed as being limited by these examples and experimental examples.

실시예Example . 재료 및 방법. Materials and methods

실시예Example 1. 재료준비 1. Materials Preparation

본 발명의 실험에서 사용한 모든 strain, plasmid, oligonucleotide는 표 1에 명시하였다. All strains, plasmids, and oligonucleotides used in the experiments of the present invention are shown in Table 1.

Strain/plasmidStrain / plasmid Relevant descriptionRelevant description ReferenceReference E. coli TOP10E. coli TOP10 F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara leu) 7697 galU galK rpsL (StrR) endA1 nupG(Mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ (ara leu) 7697 galU galK rpsL (StrR) endA1 nupG ΔLM15ΔLM15 BL21star(DE3) ΔlacZYA Tn7::lacZ_M15BL21star (DE3) ΔlaczYA Tn7 :: lacZ_M15 (Chin et al.,2015a)(Chin et al., 2015a) pCOLADuet-1pCOLADuet-1 Two T7 promoters, ColA replicon, Kan R Two T7 promoters, ColA replicon, Kan R Novagen
Novagen
BCGWBCGW pETDuet-1 + manC-manB (NcoI/SacI) + gmd-
wcaG (NdeI/KpnI)pETDuet-1 + manC-manB (NcoI / SacI) + gmd-
wcaG (NdeI / KpnI) (Lee et al., 2009)(Lee et al., 2009) PylTPylT pCOLADuet-1 + wild type 1,3-FT (NdeI/KpnI)pCOLADuet-1 + wild type 1,3-FT (NdeI / KpnI) This studyThis study PylT-DPylT-D pCOLADuet-1 + mutant without membraneanchoring region of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant without membrane-annealing region of 1,3-FT (NdeI / KpnI) This studyThis study FT1FT1 pCOLADuet-1 + wild type 1,3-FT (NdeI/KpnI)pCOLADuet-1 + wild type 1,3-FT (NdeI / KpnI) This studyThis study FT1-1FT1-1 pCOLADuet-1 + mutant without half membraneanchoring region of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant without half membraneanchoring region of 1,3-FT (NdeI / KpnI) This studyThis study FT1-2FT1-2 pCOLADuet-1 + mutant without membraneanchoring region of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant without membrane-annealing region of 1,3-FT (NdeI / KpnI) This studyThis study FT1-3FT1-3 pCOLADuet-1 + mutant with 5 heptad repeats of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant with 5 heptad repeats of 1,3-FT (NdeI / KpnI) This studyThis study FT1-4FT1-4 pCOLADuet-1 + mutant with 2 heptad repeats of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant with 2 heptad repeats of 1,3-FT (NdeI / KpnI) This studyThis study FT1-H9FT1-H9 pCOLADuet-1 + mutant with 9 heptad repeats of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant with 9 heptad repeats of 1,3-FT (NdeI / KpnI) This studyThis study FT1-H9-DFT1-H9-D pCOLADuet-1 + mutant with 9 heptad repeats, without membrane-anchoring region of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant with 9 heptad repeats, without membrane-anchoring region of 1,3-FT (NdeI / KpnI) This studyThis study FT2FT2 pCOLADuet-1 + wild type of 1,3-FTs (NdeI/KpnI)pCOLADuet-1 + wild type of 1,3-FTs (NdeI / KpnI) This studyThis study FT2-1FT2-1 pCOLADuet-1 + mutant without half membraneanchoring region of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant without half membraneanchoring region of 1,3-FT (NdeI / KpnI) This studyThis study FT2-2FT2-2 pCOLADuet-1 + mutant without membraneanchoring region of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant without membrane-annealing region of 1,3-FT (NdeI / KpnI) This studyThis study FT2-3FT2-3 pCOLADuet-1 + mutant with 1 heptad repeats of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant with 1 heptad repeats of 1,3-FT (NdeI / KpnI) This studyThis study FT2-4FT2-4 pCOLADuet-1 + mutant with only catalytic region of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant with only catalytic region of 1,3-FT (NdeI / KpnI) This studyThis study FT2-H7-DFT2-H7-D pCOLADuet-1 + mutant with 7 heptad repeats of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant with 7 heptad repeats of 1,3-FT (NdeI / KpnI) This studyThis study FT2-H10-DFT2-H10-D pCOLADuet-1 + mutant with 10 heptad repeats of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant with 10 heptad repeats of 1,3-FT (NdeI / KpnI) This studyThis study FT2-H11-DFT2-H11-D pCOLADuet-1 + mutant with 11 heptad repeats of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + mutant with 11 heptad repeats of 1,3-FT (NdeI / KpnI) This studyThis study FTmFTm pCOLADuet-1 + engineered Δ52 FutA (NdeI/KpnI)pCOLADuet-1 + engineered Δ52 FutA (NdeI / KpnI) (Choi et al., 2016)(Choi et al., 2016) FTm-H11-DFTm-H11-D pCOLADuet-1 + engineered Δ52 FutA with heptad repeats of 1,3-FT (NdeI/KpnI)pCOLADuet-1 + engineered Δ52 FutA with heptad repeats of 1,3-FT (NdeI / KpnI) This studyThis study

3-FL 생산에 사용된 1,3-FT들(pylT, FT1, FT2)은 H. pylori 에서 유래한 enzyme이다(표 2 참조).The 1,3-FTs (pylT, FT1, FT2) used in 3-FL production are H. pylori- derived enzymes (see Table 2).

Figure 112018037987917-pat00002
Figure 112018037987917-pat00002

pylT, FT1, 및 FT2 효소들은 각각 순서대로 10개, 7개, 2개의 heptad repeat을 가지고 있다. 이 1,3-FT들은 대장균에 대한 많은 rare codon들을 가지고 있으므로 이 유전자에 대한 코돈 최적화를 진행한 후 bioneer Co.에서 합성하였고, 이를 도 1에 나타내었다. 코돈 최적화를 진행한 FT1과 FT2(도 2 참조)는 overlap cloner DNA cloning kit 또는 T4 DNA polymerase를 이용하여 pColADuet-1에 구축하였다.The pylT, FT1, and FT2 enzymes have 10, 7, and 2 heptad repeats, respectively. Since these 1,3-FTs contain many rare codons for E. coli, the codon optimization for this gene was performed and then synthesized in bioneer Co., which is shown in Fig. FT1 and FT2 (see FIG. 2) with codon optimization were constructed on pColADuet-1 using the overlap cloner DNA cloning kit or T4 DNA polymerase.

구축한 1,3-FT 유전자의 heptad repeats에 포함되어 있는 Tyr 잔기를 stop codon으로 변경하여 유전자를 절단하였다. 만들어진 FT2의 절단된 변이체들은 각각 27, 46, 53, 59번째 잔기를 절단한 것들로서, FT2-1, FT2-2, FT2-3, FT2-4라고 명명하였다. 마찬가지로, FT1의 25, 43, 57, 78번째 C-말단 잔기를 절단하여 절단된 변이체들을 만들어서 FT1-1, FT1-2, FT1-3, FT1-4라고 명명하였다. PylT의 막고정영역을 절단한 것도 동일하게, 표시된 부분의 codon을 stop codon으로 변경하였다.The gene was cleaved by changing the Tyr residue contained in the heptad repeats of the constructed 1,3-FT gene to stop codon. The truncated mutants of FT2 were designated as FT2-1, FT2-2, FT2-3, and FT2-4, respectively, as truncations at residues 27, 46, 53, and 59, respectively. Likewise, the 25, 43, 57, and 78th C-terminal residues of FT1 were cleaved to produce truncated mutants and named FT1-1, FT1-2, FT1-3, FT1-4. In the same manner as the cleavage of the membrane-immobilized region of PylT, the codon at the indicated portion was changed to stop codon.

그 다음, heptad repeat의 수가 1,3-FT들의 활성에 미치는 영향을 확인하기 위해 FT1과 FT2의 heptad repeat을 증진시켰다. 이 때 사용한 primer들은 표 3에 명시하였다. 구축된 plasmid는 DNA sequencing을 진행하여 확인하였다.Next, heptad repeats of FT1 and FT2 were promoted to confirm the effect of the number of heptad repeats on the activity of 1,3-FTs. The primers used in this study are shown in Table 3. The constructed plasmids were confirmed by DNA sequencing.

PrimerPrimer Sequence (5'→ 3')Sequence (5 '- > 3') FT1-1 FWFT1-1 FW ttgagccagaatacctgattcaaaatctaccgcttgagccagaatacctgattcaaaatctaccgc FT1-1 BWFT1-1 BW gcggtagattttgaatcaggtattctggctcaagcggtagattttgaatcaggtattctggctcaa FT1-2 FWFT1-2 FW gacttgagaattaattaagagcgccttctgcaagacttgagaattaattaagagcgccttctgcaa FT1-2 BWFT1-2 BW ttgcagaaggcgctcttaattaattctcaagtcttgcagaaggcgctcttaattaattctcaagtc FT1-3 FWFT1-3 FW gacttgcggatcaactaagatgatctgcgtatagacttgcggatcaactaagatgatctgcgtata FT1-3 BWFT1-3 BW tatacgcagatcatcttagttgatccgcaagtctatacgcagatcatcttagttgatccgcaagtc FT1-4 FWFT1-4 FW aatttgcgggtgaattaagatgatttgcgcgttaatttgcgggtgaattaagatgatttgcgcgtt FT1-4 BWFT1-4 BW aacgcgcaaatcatcttaattcacccgcaaattaacgcgcaaatcatcttaattcacccgcaaatt FT1-H9 FWFT1-H9 FW cttgagaattaattatgagcgccttctgcaacttgagaattaattatgagcgccttctgcaa FT1-H9 BWFT1-H9 BW ttgcagaaggcgctcataattaattctcaagttgcagaaggcgctcataattaattctcaag FT1-H9-D FWFT1-H9-D FW gatgatttgcgcgttaactatgatgacttgcgtgttaactatgatgatttgcgcgttaactatgatgacttgcgtgttaactat FT1-H9-D BWFT1-H9-D BW ataattcacccgcaaattatcatagttgatacgcagattatcaatggataattcacccgcaaattatcatagttgatacgcagattatcaatgg FT2-1 FWFT2-1 FW tctcaaaacaccacttgaaaaatctatcgcaaatctcaaaacaccacttgaaaaatctatcgcaaa FT2-1 BWFT2-1 BW tttgcgatagatttttcaagtggtgttttgagatttgcgatagatttttcaagtggtgttttgaga FT2-2 FWFT2-2 FW gatctccgtgtgaactaagaccggcttttacaggatctccgtgtgaactaagaccggcttttacag FT2-2 BWFT2-2 BW ctgtaaaagccggtcttagttcacacggagatcctgtaaaagccggtcttagttcacacggagatc FT2-3 FWFT2-3 FW gatctacgggttaattaagatgatctccgtgtggatctacgggttaattaagatgatctccgtgtg FT2-3 BWFT2-3 BW cacacggagatcatcttaattaacccgtagatccacacggagatcatcttaattaacccgtagatc FT2-4 FWFT2-4 FW cccctggtatccatttaagatctacgggttaatcccctggtatccatttaagatctacgggttaat FT2-4 BWFT2-4 BW attaacccgtagatcttaaatggataccaggggattaacccgtagatcttaaatggataccagggg FT2-H10-D I FWFT2-H10-D I FW cccctggtatccattgatgatttgagggttaattatcccctggtatccattgatgatttgagggttaattat FT2-H10-D I BWFT2-H10-D I BW aacccgtagatcgtcataattaaccctcaaatcatcataattaacccgtagatcgtcataattaaccctcaaatcatcataatt FT2-H10-D V FWFT2-H10-D V FW gacgatctacgggttaattacgatgatctccgacgatctacgggttaattacgatgatctcc FT2-H10-D V BWFT2-H10-D V BW aatggataccaggggcttgtgcagatcaatggataccaggggcttgtgcagatc FT2-H11-D I FWFT2-H11-D I FW ctccgtgtgaactatgataatctgcgtatcaactatgataattctccgtgtgaactatgataatctgcgtatcaactatgataatt FT2-H11-D I BWFT2-H11-D I BW ctgtaaaagccggtcttactttttaacccaacgcctgtaaaagccggtcttactttttaacccaacgc FT2-H11-D V FWFT2-H11-D V FW gaccggcttttacagaacgcttcgcgaccggcttttacagaacgcttcgc FT2-H11-D V BWFT2-H11-D V BW atagttcacacggagatcatcgtaattaacccgtaatagttcacacggagatcatcgtaattaacccgta FTm I FWFTm I FW gctgacgtcggtaccatgttccaacccctgttgctgacgtcggtaccatgttccaacccctgtt FTm I BWFTm I BW cggtttctttaccagactcgagttaattaacccgtagatcgtcacggtttctttaccagactcgagttaattaacccgtagatcgtca FTm V FWFTm V FW catggtaccgacgtcagcgatcgcgtggcatggtaccgacgtcagcgatcgcgtgg FTm V BWFTm V BW ctcgagtctggtaaagaaaccgctgctgcgaaatttgaacctcgagtctggtaaagaaaccgctgctgcgaaatttgaac FTm-H11-D I FWFTm-H11-D I FW tttatagaaagcgcttccatcgaaaaaatgtttatagaaagcgcttccatcgaaaaaatg FTm-H11-D I BWFTm-H11-D I BW ttgtgataaatcgtatcgttttctaaaatcgttttattgtgataaatcgtatcgttttctaaaatcgtttta FTm-H11-D V FWFTm-H11-D V FW cgatacgatttatcacaaattctctacatcattcatgtgggaatacgatacgatttatcacaaattctctacatcattcatgtgggaata FTm-H11-D V BWFTm-H11-D V BW agcgctttctataaaggcgtctaacaggggagcgctttcttaaaggcgtctaacagggg

구축된 효소 변이체들의 3-FL 생산량을 확인하기 위해 GDP-L-fucose를 발현하는 plasmid pBCGW와 함께 대장균 ΔLM15를 사용하였다(도 3 참조). pBCGW는 manB, manC, Gmd, WcaG를 과발현한다. 대장균 ΔLM15는 lactose를 세포 성장이 아닌 fucosyllactose를 생산에 사용할 수 있도록 사용 흐름을 변경한 것으로, 이전에 구축 된 것이다.Of the constructed enzyme variants To confirm 3-FL production, Escherichia coli DELTA LM15 was used with plasmid pBCGW expressing GDP-L-fucose (see FIG. 3). pBCGW overexpresses manB, manC, Gmd, and WcaG. Escherichia coli ΔLM15 was previously constructed by changing the use flow of lactose to use fucosyllactose, not cell growth.

실시예Example 2. 1,3-FT  2. 1,3-FT 변이체들의Mutant 발현 패턴 분석 방법 Analysis method of expression pattern

1,3-FT의 변이체들을 포함하는 pColADuet-1 plasmid를 대장균 BL21(DE3)에 형질전환 시켰다. 배양은 250ml 베플플라스크에서 kanamycin (50 μg/mL)을 포함하는 50ml LB배지를 이용하여 37 ℃에서 진행하였다. 교반 속도는 200 rpm으로 유지하였다. 광학 밀도 (OD600)가 0.4-0.6에 도달 할 때, isopropyl-β-D-1-thiogalactopyranoside (IPTG)를 최종 농도 0.1mM로 첨가하고, 온도 및 교반 속도를 각각 16℃ 및 200 rpm으로 유지시켰다. 하루 뒤, 세포를 원심 분리하여 모아서 PBS (pH 7.4)에 풀어준다. 세포들을 초음파 (얼음에서 1분 동안 1s ON / 3s OFF for) 처리하여 파쇄하고 전체 단백질을 모았다. 세포 용해물을 10,000g에서 10분간 원심 분리하여 가용성 부분과 불용성 부분(파편)으로 분리하였다. 10% SDS-PAGE를 이용하여 1,3-FT의 단백질들의 발현 정도를 확인하였다.A pColADuet-1 plasmid containing variants of 1,3-FT was transformed into E. coli BL21 (DE3). The culture was carried out at 37 ° C in 50 ml LB medium containing kanamycin (50 μg / ml) in a 250 ml beef flask. The stirring speed was maintained at 200 rpm. When the optical density (OD 600 ) reached 0.4-0.6, isopropyl-β-D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 0.1 mM and the temperature and stirring speed were maintained at 16 ° C. and 200 rpm, respectively . After one day, cells are centrifuged and pooled in PBS (pH 7.4). Cells were disrupted by sonication (1s ON / 3s OFF for 1 min on ice) and total protein was collected. The cell lysate was centrifuged at 10,000 g for 10 minutes to separate into soluble and insoluble fragments. The degree of expression of 1,3-FT proteins was confirmed using 10% SDS-PAGE.

실시예Example 3. 1,3-FT  3. 1,3-FT 변이체들의Mutant 배양 및 3-FL 생산량 분석 방법 Culture and 3-FL yield analysis method

발효는 250ml 베플플라스크에서 20 g/L 글리세롤과 항생제(50 μg/mL ampicillin, 50 μg/mL kanamycin)를 포함하고 있는 50ml defined medium를 이용하여 37 ℃에서 진행하였다. 교반 속도는 200 rpm으로 유지하였다. 광학 밀도 (OD600)가 0.4-0.6에 도달 할 때, 유전자 발현을 유도하는 T7 프로모터의 induction과 3-FL 생산을 위해 최종 농도 0.1mM의 isopropyl-β-D-1-thiogalactopyranoside (IPTG)와 5 g/L lactose를 넣은 후, 온도 및 교반 속도를 각각 25℃ 및 200 rpm으로 유지시켰다.Fermentation was carried out at 37 ° C in 50 ml defined medium containing 20 g / L glycerol and antibiotics (50 μg / mL ampicillin, 50 μg / mL kanamycin) in a 250 ml beef flask. The stirring speed was maintained at 200 rpm. Β-D-1-thiogalactopyranoside (IPTG) with a final concentration of 0.1 mM for induction of T7 promoter inducing gene expression and 3-FL production when optical density (OD 600 ) reached 0.4-0.6 g / L lactose, and the temperature and stirring speed were maintained at 25 ° C and 200 rpm, respectively.

그 이후에 0.1 mM IPTG를 첨가한 후, UV-가시 분광 광도계를 사용하여 600 nm에서 광학 밀도(OD)를 기록함으로써 12시간마다 세포 농도를 측정하였다. 세포 발효에 따른 락토오스, 글리세롤, 생산된 3-FL의 농도는 Rezex ROA-Organic Acid H+ 칼럼과 굴절률 인덱스 (RI) 검출기를 갖춘 high performance liquid chromatography (HPLC) 시스템을 이용하여 분석하였다. 분석은 0.01N H2SO4, 50℃ 에서 0.6 mL/min의 유속으로 수행하였다. 모든 실험은 3회이상 반복하였다.The cell concentration was then measured every 12 hours by adding 0.1 mM IPTG and then recording the optical density (OD) at 600 nm using a UV-visible spectrophotometer. The concentrations of lactose, glycerol, and 3-FL produced by cell fermentation were analyzed using a high performance liquid chromatography (HPLC) system equipped with a Rezex ROA-Organic Acid H + column and a refractive index (RI) detector. The analysis was carried out at a flow rate of 0.6 mL / min at 50 ° C in 0.01NH 2 SO 4 . All experiments were repeated three more times.

실험예Experimental Example 1. FT2  1. FT2 변이체들의Mutant 대장균 세포에서의 발현량 및 3-FL 생산량 확인 Expression level and 3-FL production in E. coli cells

1-1. 발현량 확인1-1. Check the expression level

도 5A에서 나타낸 바와 같이 H. pylori 26695에서 유래한 야생형 1,3-FT(FT2)는 2개의 heptad repeats과 막고정영역을 가지고 있다. 상기 FT2를 상기 실시예 1의 방법으로 절단하였고, 절단된 4개의 변이체들은 도 5B에 나타낸 바와 같이 heptad repeat안의 빨간색으로 표시된 codon을 stop codon으로 변경하여 구축하였다. FT2는 wild-type으로 절단이 이루어지지 않은 형태이고, FT2-1은 C-말단의 27번째 아미노산을 절단하여 막고정영역의 절반만 가지고 있는 형태, FT2-2는 46번째 잔기 변경으로 막고정영역 전체를 절단하여 heptad repeat 2개만을 가지고 있는 형태이며, FT2-3는 FT2-2에서 heptad repeat을 1개만 가지고 있는 형태, FT2-4 변이체는 heptad repeats까지 모두 절단된 형태이다. As shown in FIG. 5A, the wild type 1,3-FT (FT2) derived from H. pylori 26695 has two heptad repeats and a membrane anchor region. The FT2 was cleaved by the method of Example 1, and the four mutants cleaved were constructed by changing the red codon in heptad repeat to stop codon as shown in FIG. 5B. FT2 is a form in which the wild-type is not cleaved, FT2-1 has a half of the membrane-immobilized region by cutting the 27th amino acid at the C-terminus, FT2-2 is a form in which the membrane- FT2-3 has only one heptad repeat in FT2-2, and all of the FT2-4 variants have been truncated to heptad repeats.

또한, 상기 실시예 2의 방법으로 대장균 BL21(DE3) 세포에서 이들 돌연변이 변이체의 발현 패턴을 분석한 결과, 도 5C에 나타낸 바와 같이, FT2가 절단되면 가용성 발현이 상당히 증가했다. 가장 짧게 절단된 변이체인 FT2-4는 wild-type인 FT2에 비해 가용성 발현이 6.6배 증가했다. 막고정영역의 절단만으로도(FT2-2), 효소의 가용성 발현이 증가했다. In addition, analysis of expression patterns of these mutants in E. coli BL21 (DE3) cells by the method of Example 2 above showed that soluble expression was significantly increased when FT2 was cleaved, as shown in Fig. 5C. FT2-4, the shortest truncated mutant, increased soluble expression 6.6-fold compared to wild-type FT2. The cleavage of the membrane-immobilized region (FT2-2) increased the solubility of the enzyme.

1-2. 3-FL 생산량 확인 1-2. Check 3-FL production

상기 실시예 3의 방법으로 상기 실험예 1-1의 변이체들과 pBCGW를 대장균 ΔLM15에서 함께 발현한 결과, 3-FL 생산은 개선되지 않았으며, 도 5D 및 도6에 나타낸 바와 같이, 배양 72시간 후 생산된 3-FL은 모두 0.05g/L 미만이었다. 절단된 FT2 변이체들의 가용성 발현과 이들의 3-FL 생산 수율이 일치하지 않았기 때문에, heptad repeat을 더 함유하는 FT2의 변이체들을 구축하여 이에 대한 3-FL 생산 효과를 확인해보았다.As a result of expressing the mutants of Experimental Example 1-1 and pBCGW in Escherichia coli DELTA LM15 by the method of Example 3, 3-FL production was not improved, and as shown in FIG. 5D and FIG. 6, All of the 3-FLs produced were less than 0.05 g / L. Since the soluble expression of truncated FT2 variants and their 3-FL production yields were inconsistent, we constructed mutants of FT2 containing more heptad repeat and confirmed the 3-FL production effect on them.

실험예Experimental Example 2. FT1  2. FT1 변이체들의Mutant 대장균 세포에서의 발현량 및 3-FL 생산량 확인 Expression level and 3-FL production in E. coli cells

2-1. 발현량 확인2-1. Check the expression level

도 7A에 나타낸 바와 같이, FT1은 7개의 heptad repeat들을 가지며, 소수성 및 양전하를 띤 아미노산으로 구성된 막고정영역이 뒤따른다. 상기 FT1의 heptad repeat 및 막고정영역을 상기 실시예 1의 방법으로 체계적으로 절단하여, 도 7B에 나타낸 바와 같이, 4개의 절단 변이체를 구축하였다. FT1-1은 C-말단의 25번째 아미노산을 절단하여 막고정영역의 절반만 가지고 있는 형태, FT1-2는 막고정영역 전체를 절단하여 heptad repeat 7개만을 가지고 있는 형태이며, FT1-3는 57번째 잔기를 절단하여 heptad repeat만을 5개 가지고 있는 형태, FT1-4 변이체는 가장 짧은 변이체로서, heptad repeat을 2개만 가지고있는 형태이다. As shown in Fig. 7A, FT1 has seven heptad repeats followed by a membrane anchor region consisting of hydrophobic and positively charged amino acids. The heptad repeat of FT1 and the membrane-immobilized region were systematically cleaved by the method of Example 1 to construct four truncation mutants as shown in Fig. 7B. FT1-1 has only half of the membrane-immobilized region by cleaving the 25th amino acid at the C-terminus. FT1-2 has only 7 heptad repeats, and FT1-3 has 57 And the heptad repeat is the shortest variant. The FT1-4 variant is the shortest variant with only two heptad repeats.

또한, 상기 실시예 2의 방법으로 대장균 BL21(DE3) 세포에서 이들 돌연변이 변이체의 발현 패턴을 확인하였을 때, 도 7C에 나타낸 바와 같이, FT2에서 확인한 만큼의 가용성 발현량 증가는 확인할 수 없었지만, 단백질들은 모두 잘 발현되었다. Further, when the expression pattern of these mutants was confirmed in E. coli BL21 (DE3) cells by the method of Example 2, an increase in the soluble expression amount as confirmed by FT2 was not confirmed as shown in Fig. 7C, All were well expressed.

2-2. 3-FL 생산량 확인2-2. Check 3-FL production

상기 실시예 3의 방법으로 상기 실험예 2-1의 절단된 1,3-FT의 변이체를 가지고 있는 pCOLADuet-1을 3-FL 생산을 위한 완전한 대사 경로를 갖는 대장균, ΔLM15에 pBCGW와 함께 형질 전환 시켰을 때, 절단 정도에 따른 3-FL 생산이 확인되었으며, 도 7D 및 도 8에 나타낸 바와 같이, 배양 72시간 후 FT1-2를 발현하는 세포는 FT1을 발현하는 세포에 비해 3-FL을 4.7배 더 생산하였다. 그러나, 막고정영역의 절반을 제거한 변이체(FT1-1)에서는 3-FL 생산량이 개선되지 않았다. Heptad repeat을 절단한 변이체(FT1-3, FT1-4)는 FT1-2에 비해 3-FL 생산량이 감소했다. 이 결과로 3-FL은 효소가 막고정영역을 가지고 있지 않은 상태에서 heptad repeat을 길게 가지고 있을 때 더 잘 생산된다는 것을 알 수 있었다.PCOLADuet-1 having the truncated 1,3-FT variant of Experimental Example 2-1 was transformed into E. coli having a complete metabolic pathway for production of 3-FL, pLB15 with pBCGW As shown in FIG. 7D and FIG. 8, the cells expressing FT1-2 after 72 hours of culture showed a 4.7-fold increase in 3-FL compared to cells expressing FT1 . However, the 3-FL production was not improved in the mutant (FT1-1) in which half of the membrane-immobilized region was removed. The mutants (FT1-3, FT1-4) that cut Heptad repeat had a 3-FL production decrease compared to FT1-2. As a result, 3-FL was found to be better when the enzyme had a long heptad repeat without membrane-bound regions.

실험예Experimental Example 3.  3. pylTpylT 변이체들의Mutant 대장균 세포에서의 발현량 및 3-FL 생산량 확인 Expression level and 3-FL production in E. coli cells

3-1. 발현량 확인3-1. Check the expression level

PylT는 상기 FT2와 다른 종의 H. pylori 26695에서 유래한 FT로, 10개의 heptad repeat을 갖는 또 다른 1,3-FT이다. pylT의 촉매영역은 FT2의 촉매영역과 매우 유사하며, 96.2%가 일치하고 11개 잔기의 차이만 있다(도 9 참조). 상기 실시예 1의 방법으로 PylT의 42번째 아미노산을 변경시켜 막고정영역을 결실시켰으며, 이를 도 10A에 나타낸 바와 같이 pylT-D라고 명명하였다. PylT is an FT derived from H. pylori 26695 of the above-mentioned FT2, and another 1,3-FT having 10 heptad repeats. The catalytic domain of pylT is very similar to the catalytic domain of FT2, with 96.2% identity and only 11 differences (see FIG. 9). The 42th amino acid of PylT was changed by the method of Example 1 to delete the membrane-immobilized region, which was named pylT-D as shown in FIG. 10A.

상기 실시예 2의 방법으로 대장균 BL21(DE3) 세포에서 이들 돌연변이체의 발현 패턴을 확인한 결과, 도 10B에 나타낸 바와 같이, 단백질 발현이 막고정영역의 절단에 의해 향상되었지만, pylT의 가용성 발현은 변하지 않았다. As a result of confirming the expression patterns of these mutants in E. coli BL21 (DE3) cells by the method of Example 2, the protein expression was improved by cleavage of the membrane-immobilized region as shown in Fig. 10B, but the soluble expression of pylT was not changed I did.

3-2. 3-FL 생산량 확인3-2. Check 3-FL production

상기 실시예 3의 방법으로 상기 실험예 3-1의 변이체를 대장균 ΔLM15에 pBCGW와 함께 형질 전환 시켰을 때, 도 10C 및 도 11에 나타낸 바와 같이, 배양 72시간 후 3-FL 생산이 4.5배 향상되었다. FT1, FT2와는 달리 pylT의 가용성 발현은 3-FL 생산과 관계가 없었다. When the mutant of Experimental Example 3-1 was transformed with E. coli DELTA LM15 together with pBCGW by the method of Example 3, 3-FL production was improved 4.5-fold after 72 hours of culture as shown in FIGS. 10C and 11 . Unlike FT1 and FT2, soluble expression of pylT was not associated with 3-FL production.

실험예Experimental Example 4. FT2 및 FT1의  4. FT2 and FT1 heptadheptad repeat 수를 증가시킨  Increased number of repeats 변이체들의Mutant 3-FL 생산량확인 Check 3-FL production

상기 실시예 1의 방법으로 FT2의 막고정영역을 모두 절단한 후, FT2의 heptad repeat을 7, 10, 11개로 증가시킨 형태를 구축하여 이를 도 12A에 나타낸 바와 같이 FT2-H7-D, FT2-H10-D, FT2-H11-D라고 명명하였다. 12A, FT2-H7-D, FT2-H7-D, and FT2-H7-D were constructed by cutting all the membrane-immobilized regions of FT2 by the method of Example 1 and then increasing the heptad repeat of FT2 to 7, 10, H10-D and FT2-H11-D.

상기 실시예 3의 방법으로 상기 heptad repeat 수를 증가시킨 변이체들을 대장균 ΔLM15에 pBCGW와 함께 형질 전환 시켰을 때, 도 12B 및 도 13에 나타낸 바와 같이, 배양 72시간 후 3-FL 생산량이 FT2-2보다 모두 12 내지 20배 증가하였다. 특히, heptad repeat이 10개 증가한 경우(FT2-H10-D)에는 heptad repeat을 2개만 가지고 있는 같은 효소에서 3-FL이 0.03 g/L 생산된 것과는 달리, 3-FL이 0.5 g/L 생산되었다. 상기 실험예 1-1 및 1-2에서 FT2의 막고정영역을 절단한 변이체는 가용성 발현이 극적으로 증가했지만 3-FL 생산이 향상되지는 않았다.When the mutant with increased heptad repeat number was transformed with E. coli DELTA LM15 together with pBCGW by the method of Example 3, the production of 3-FL was found to be greater than that of FT2-2 after 72 hours of culture as shown in FIG. 12B and FIG. All increased by 12 to 20 times. In particular, when 10 heptad repeats (FT2-H10-D) were produced, 3-FL was produced at 0.5 g / L, compared to 3-FL at 0.03 g / L in the same enzyme with only two heptad repeats . In the above Experimental Examples 1-1 and 1-2, mutants cleaving the membrane-immobilized region of FT2 showed dramatic increase in soluble expression but did not improve 3-FL production.

그 후, 상기 실험예 2-1의 FT1과 FT1-2의 heptad repeat의 수를 9개로 증가시킨 형태를 구축하여 이를 도 12C에 나타낸 바와 같이 막고정영역을 포함하는 것을 FT1-H9, 막고정영역을 포함하지 않는 것을 FT1-H9-D라고 명명하였다.  Thereafter, the number of heptad repeats of FT1 and FT1-2 in Experimental Example 2-1 was increased to nine, and it was confirmed that FT1-H9, which includes a membrane-immobilized region as shown in FIG. 12C, Was named FT1-H9-D.

상기 실시예 3의 방법으로 상기 heptad repeat 수를 증가시킨 변이체들을 대장균 ΔLM15에 pBCGW와 함께 형질 전환 시켰을 때, 도 12D 및 도 13에 나타낸 바와 같이, 배양 72시간 후 FT1-2에 heptad repeat을 2개 추가한 FT1-H9-D는 3-FL 생산량이 0.43 g/L에서 0.58 g/L로 증가하였으나, 막고정영역을 가지고 있는 FT1-H9의 경우, heptad repeat 수가 증가했음에도 불구하고 3-FL 생산량은 증가하지 않았다.  When the mutant which increased the number of heptad repeats by the method of Example 3 was transformed with E. coli DELTA LM15 together with pBCGW, as shown in FIG. 12D and FIG. 13, two heptad repeats were added to FT1-2 In addition, 3-FL production increased from 0.43 g / L to 0.58 g / L in FT1-H9-D, whereas FT1-H9 with membrane immobilization increased 3-FL production Did not increase.

따라서, 1,3-FT의 막고정영역을 절단한 후 heptad repeat을 증가시키면 효소가 적절히 이합체화를 이루기 때문에 재조합 대장균 ΔLM15에서의 3-FL을 생산하기에 적합해진다는 것을 알 수 있었다. 또한, 3-FL 생산을 개선시키기 위해서는 5-11개의 heptad repeat이 적절한 것으로 확인되었다.Therefore, it was found that when the heptad repeat was increased after truncation of the membrane-immobilized region of 1,3-FT, the enzyme was properly duplexed, and thus it was suitable for producing 3-FL in E. coli DELTA LM15. In addition, 5-11 heptad repeats were found to be suitable for improving 3-FL production.

실험예Experimental Example 5. FT2-3 및  5. FT2-3 and FTmFTm 변이체의Mutant 대장균 세포에서의 발현량 및 3-FL 생산량 확인 Expression level and 3-FL production in E. coli cells

최근 H. pylori 26695 1,3-FT가 용해성과 촉매 효율을 향상시키기 위해 설계된 바 있다(Choi et al., 2016). 대장균 내에서 가용성 발현이 개선된 절단 변이체 Δ52 FutA가 상기 실험예 1-1의 FT2-3과 동일한 효소였기 때문에, FT2-3을 이용하여 야생형 Δ52 FutA보다 활성이 약 15배 향상된 변이체, Δ52 FutA A128N/H129E/Y132I/S46F를 동일하게 구축한 후 FTm이라고 명명하였고(도 14A 및 도 15 참조), 상기 실시예 1의 방법으로 FTm의 heptad repeat를 11개로 증가시킨 형태를 구축하여 이를 도 14A에 나타낸 바와 같이, FTm-H11-D 라고 명명하였다. Recently, H. pylori 26695 1,3-FT has been designed to improve solubility and catalytic efficiency (Choi et al., 2016). Since the truncated mutant? 52 FutA improved in solubility expression in E. coli was the same enzyme as FT2-3 in Experimental Example 1-1, the mutant having an activity of about 15-fold improved by about 15-fold than the wild-type? 52 FutA using FT2-3,? 52 FutA A128N / H129E / Y132I / S46F were constructed in the same manner and named FTm (see FIGS. 14A and 15), and a form in which FTm heptad repeat was increased to 11 by the method of Example 1 was constructed, As indicated, it was named FTm-H11-D.

상기 실시예 2의 방법 중 온도 조정을 25℃로 변경하는 대장균 BL21(DE3) 세포에서 Δ52 FutA와 Δ52 FutA A128N/H129E/Y132I/S46F에 대응하는 FT2-3와 FTm을 비교하였다. 그 결과, 도 16A에 나타낸 바와 같이, FTm은 FT2-3에 비해 가용성발현뿐 아니라 전체적인 발현량이 줄어들었지만, 이후 도 14B에 나타낸 바와 같이 heptad repeat의 증가(FTm-H11-D)로 전체적인 발현량이 증가하였다. Among the methods of Example 2, FT2-3 and FTm corresponding to Δ52 FutA and Δ52 FutA A128N / H129E / Y132I / S46F were compared in E. coli BL21 (DE3) cells whose temperature was changed to 25 ° C. As a result, as shown in FIG. 16A, FTm showed not only a soluble expression but also an overall expression amount as compared with FT2-3. However, as shown in FIG. 14B, the overall expression amount was increased by an increase in heptad repeat (FTm-H11-D) Respectively.

상기 실시예 3의 방법으로 상기 FTm 및 FTm-H11-D을 대장균 ΔLM15에 pBCGW와 함께 형질 전환 시키고, 16℃와 25℃에서 배양하였다. 그 결과, 도 14C, 도 16B 및 도 16C에 나타낸 바와 같이, 25℃에서 FTm는 대장균 내에서 3-FL을 생산하지 못했지만, FTm-H11-D는 3-FL을 0.26 g/L 생산하였다. 이와는 달리, 16℃에서는 두 세포에서 3-FL이 비슷하게 생산되었다(0.12, 0.06 g/L).FTm and FTm-H11-D were transformed into E. coli DELTA LM15 together with pBCGW by the method of Example 3, and cultured at 16 DEG C and 25 DEG C. As a result, as shown in Fig. 14C, Fig. 16B and Fig. 16C, FTm did not produce 3-FL in E. coli at 25 DEG C, whereas FTm-H11-D produced 0.26 g / L of 3-FL. In contrast, at 16 ° C, 3-FL was similarly produced in both cells (0.12, 0.06 g / L).

따라서, 상기 결과로부터 증가된 heptad repeat은 발효 조건을 더 넓혀주어, 높은 온도에서 1,3-FT 이량체들이 단량체화 되는 것을 막아주며, 1,3-FT의 heptad repeat 수를 감소시키는 것 보다 증가시키는 것이 대장균에서 효율적으로 3-FL을 생산한다는 것을 확인할 수 있었다.Thus, the heptad repeat increased the fermentation conditions, inhibiting the monomerization of 1,3-FT dimers at high temperatures, and increasing the number of 1,3-FT heptad repeats To produce 3-FL efficiently in Escherichia coli.

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

Claims (7)

(a) 막고정영역(membrane anchoring region)을 가지고 일정 헵타드 반복(heptad repeat) 수를 가지고 있는 α-1,3-푸코실 전이효소(1,3-fucosyltransferase; 1,3-FT)의 막고정영역을 결실(deletion)시키고, 헵타드 반복 수를 하나 이상 증가시켜 9 내지 11개로 만드는 단계; 및
(b) 상기 (a)에서 엔지니어링한 α-1,3-푸코실 전이효소를 미생물에 도입하여 푸코실락토오스(fucosyllactose; FL)를 생산하는 단계;
를 포함하는, 푸코실락토오스(fucosyllactose; FL)의 생산을 증가시키는 방법.
(a) A membrane of an α-1,3-fucosyltransferase (1,3-FT) having a membrane anchoring region and a certain number of heptad repeats Deleting the immobilized region and increasing the heptad repeat number by at least one to 9 to 11; And
(b) introducing α-1,3-fucosyltransferase engineered in (a) into a microorganism to produce fucosyllactose (FL);
Wherein the fucosyllactose (FL) is produced by a process comprising the steps of:
제1항에 있어서,
상기 (a)에서 α-1,3-푸코실 전이효소는 헬리코박터 파일로리(Helicobacter pylori)로부터 유래된 것을 특징으로 하는, 방법.
The method according to claim 1,
Wherein the? -1,3-fucosyl transferase in (a) is derived from Helicobacter pylori.
삭제delete 제1항에 있어서,
상기 (b)에서 푸코실락토오스(fucosyllactose; FL)는 3-푸코실락토오스(3-fucosyllactose; 3-FL)인 것을 특징으로 하는, 방법.
The method according to claim 1,
Wherein the fucosyllactose (FL) in (b) is 3-fucosyllactose (3-FL).
α-1,3-푸코실 전이효소(1,3-fucosyltransferase; 1,3-FT)에 있어서,
막고정영역(membrane anchoring region)이 결실(deletion)되고, 헵타드 반복(heptad repeat) 수를 9 내지 11개가 되도록 증가시킨 α-1,3-푸코실 전이효소(1,3-fucosyltransferase; 1,3-FT).
In the case of the 1,3-fucosyltransferase (1,3-FT)
1-fucosyltransferase (1, 3-fucosyltransferase) having a membrane anchoring region deleted and an increased number of heptad repeats to 9 to 11, 3-FT).
제5항에 있어서,
상기 α-1,3-푸코실 전이효소는 헬리코박터 파일로리(Helicobacter pylori)로부터 유래된 것을 특징으로 하는, α-1,3-푸코실 전이효소.
6. The method of claim 5,
The? -1,3-fucosyltransferase is characterized in that the? -1,3-fucosyltransferase is derived from Helicobacter pylori.
삭제delete
KR1020180044384A 2018-04-17 2018-04-17 A method for increasing production of 3-fucosyllactose KR102004478B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020180044384A KR102004478B1 (en) 2018-04-17 2018-04-17 A method for increasing production of 3-fucosyllactose

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020180044384A KR102004478B1 (en) 2018-04-17 2018-04-17 A method for increasing production of 3-fucosyllactose

Publications (1)

Publication Number Publication Date
KR102004478B1 true KR102004478B1 (en) 2019-07-26

Family

ID=67469753

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020180044384A KR102004478B1 (en) 2018-04-17 2018-04-17 A method for increasing production of 3-fucosyllactose

Country Status (1)

Country Link
KR (1) KR102004478B1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6962806B2 (en) * 1997-06-06 2005-11-08 The Governers Of The University Of Alberta α-1,3 fucosyltransferases and expression systems for making and expressing them

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6962806B2 (en) * 1997-06-06 2005-11-08 The Governers Of The University Of Alberta α-1,3 fucosyltransferases and expression systems for making and expressing them
US7166449B2 (en) * 1997-06-06 2007-01-23 The Governors Of The University Of Alberta α1,3-fucosyltransferase

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Biochemistry, Vol. 45, pp. 8108-8116 (2006.)* *
Biotechnology and Bioengineering, Vol. 113, pp. 1666-1675 (2016.02.04.) *

Similar Documents

Publication Publication Date Title
JP6771644B2 (en) Method for producing N-acetyl-D-glucosamine and / or D-glucosamine salt by microbial fermentation
JP2020188761A (en) Alpha (1,2) fucosyltransferase syngenes for use in the production of fucosylated oligosaccharides
Kämpf et al. In vivo production of a novel glycoconjugate vaccine against Shigella flexneri 2a in recombinant Escherichia coli: identification of stimulating factors for in vivo glycosylation
EP2100967B1 (en) Method for producing lacto-n-biose i or galacto-n-biose
Iqbal et al. Characterization of a heterodimeric GH2 β-galactosidase from Lactobacillus sakei Lb790 and formation of prebiotic galacto-oligosaccharides
JP2023511523A (en) HMO production
JP6165872B2 (en) Monosaccharide production method
JP2023511527A (en) HMO production
KR20210099599A (en) Synthesis of fucosylated oligosaccharide LNFP-V
Monchois et al. Effect of Leuconostoc mesenteroides NRRL B-512F dextransucrase carboxy-terminal deletions on dextran and oligosaccharide synthesis
JP2021506337A (en) Sialyltransferase and its use
JP2023511522A (en) HMO production
US20160032344A1 (en) Polysialic acid, blood group antigens and glycoprotein expression in prokaryotes
US7901912B1 (en) Method of producing uridine 5′-diphospho-N-acetylgalactosamine
WO2021164673A1 (en) Bifunctional c-glycoside glycosyltransferases and application thereof
JP2007181452A (en) Dextran-producing enzyme gene, dextran-producing enzyme and method for producing the same, and method for producing dextran
EP2948546B1 (en) A method of production of rare disaccharides
KR102004478B1 (en) A method for increasing production of 3-fucosyllactose
KR101794971B1 (en) Method for the mass production of 3-fucosyllactose
JP6033632B2 (en) Method for producing acidic β-glucosyl disaccharide using cellobionate phosphorylase
CN116802286A (en) Bacterial strain for producing DFL
KR20210034527A (en) Tag protein for increasing solubility and thermal stability of target protein and fusion protein containing the same
NL2030021B1 (en) L-ARABINOSE ISOMERASE (L-Al) DERIVED FROM LACTOCOCCUS LACTIS (L. LACTIS), AND USE THEREOF IN PREPARATION OF RARE SUGAR
KR101219685B1 (en) L-Arabinose production in a packed-bed bioreactor containing immobilized alpha-L-arabinofuranosidase and endo-1,5-alpha-L-arabinanase
JP2023511525A (en) A New Major Facilitator Superfamily (MFS) Protein in HMO Production (Fred)

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant