KR102003594B1 - Composition for diagnosing inflammatory reaction-mediated angiogenesis disease - Google Patents

Abstract

The present invention relates to a composition for the diagnosis of a neovascularization disease, a kit, a pharmaceutical composition for preventing or treating a neovascularization disease, and a method for measuring the occurrence of a neovascularization disease. When a composition for the diagnosis of a neovascularization disease according to the present invention, a kit, a pharmaceutical composition for the prevention or treatment of a neovascularization disease and a method for measuring the occurrence of a neovascularization disease are used, a clearer diagnosis And may be useful for the prevention or treatment of the above-described neovascular diseases. The composition for the diagnosis of a neovascularization disease according to the present invention, the kit, the pharmaceutical composition for the prevention or treatment of a neovascularization disease, and the method for measuring the incidence of a neovascularization disease include a neovascularization- Which is useful for gene therapy or cell therapy research.

Description

TECHNICAL FIELD [0001] The present invention relates to a composition for diagnosing inflammatory mediator angiogenesis diseases,

The present invention relates to a composition for diagnosing inflammatory mediator angiogenic diseases.

The term "angiogenesis" refers to a process in which new blood vessels are formed from existing blood vessels and includes the growth of metastasis, , And ulcers [Carmeliet et al., Nature, 407, p249, 2000]. That is, new blood vessel formation is generally used to mean that new blood vessels form from an already existing blood vessel system.

These renal angiogenesis is a common feature of angiogenic microvascular germination accompanied by endothelial cell proliferation accompanied by DNA synthesis, while extensive germination requires mainly endothelial cell migration. Neovascularization is an intrinsic process mediated by a variety of angiogenic factors and inhibitors. The active agents for endothelial cell proliferation and migration are mainly receptor tyrosine kinase ligands such as vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), platelet derived growth factor (PDGF) and epidermal growth factor (EGF) (LPA) (Bergers et al. (2003) Nature Reviews 3, p. 401-110). EGF upregulates VEGF, FGF and interleukin-8 (IL-8), while LPA upregulates VEGF levels. The first described angiogenesis inhibitor is probospondin-1, which modulates endothelial cell proliferation and motility. Notably, many inhibitors, such as statins, are derived from larger molecules that have no effect on angiogenesis (for example angiostatin (a fragment of plasminogen that binds to ATP synthase and annexin III) as well as endostatin , Tombstatin and canastatin (a fragment of collagen that binds to integrins)]. Generally, the level of active agent and inhibitor indicates whether the endothelial cells are in a resting or angiogenic state. Changes in angiogenesis balance are thought to mediate angiogenic transformation.

In addition, several signaling pathways are involved in the process of angiogenesis. For example, VEGF plays a pivotal role in angiogenesis and angiogenesis; Among all angiogenic factors, VEGF is most frequently associated with tumor progression and metastasis. Preliminary evidence suggests that overexpression of various isoforms may have different effects on tumors.

Anti-angiogenic therapy primarily targets vascular endothelial cells activated, for example, in tumors. Anti-angiogenic therapy can be achieved directly by preventing endothelial cells from reacting to the environment through the inhibition of integrins as described above.

On the other hand, the abnormalities of the vascular endothelial cells are closely related to the inflammatory reaction. In other words, the inflammatory reaction caused by the pathogen introduced from the outside stimulates vascular endothelial cells, and if such stimulation continues, the function of vascular endothelial cells is impaired. The vascular endothelial dysfunction is an inflammatory reaction caused by pathogenic bacteria, and is known to be a typical cause of pathogenic neovascularization. CD40 protein is one of proteins closely related to the inflammatory reaction.

Previous studies have shown that inflammatory markers increase CD40 protein expression in macrophages. However, due to differences in the function of each cell, studies on the specific mechanism of the CD40 protein in the inflammatory reaction by the inflammation-inducing factor are hardly known.

Patent Document 1 proposes a technique for investigating the relationship between CD40 protein and renal blood vessel formation.

Patent Document 1 discloses a method for producing in vitro manipulated immune cells that conditionally express interleukin-12 (IL-12) and one or more immunomodulators under the control of a gene expression regulating system in the presence of an activating ligand, For example.

More specifically, Patent Document 1 discloses a composition for treating a tumor comprising two or more populations of immune cells or therapeutic-assisted cells as in vitro engineered cells, wherein a population of in vitro engineered cells in the composition Each comprising a vector comprising a polynucleotide encoding a gene switch, wherein the polynucleotide encodes a ligand-dependent transcription factor comprising (1) a group H (Group H) nuclear receptor ligand binding domain, And (2) a polynucleotide encoding an immunomodulator coupled to a promoter activated by said ligand-dependent transcription factor, wherein each of said population of in vitro engineered cells in the composition comprises Lt; RTI ID = 0.0 > in vitro < / RTI > Wherein said immune cells are selected from the group consisting of dendritic cells, macrophages, neutrophils, mast cells, eosinophils, basophils, natural killer cells and lymphocytes, IL-2, IL-3, IL-4, IL-5, IL-7, IL-7, 8, IL-9, IL-10R DN or a subunit thereof, IL-15, IL-18, IL-21, IL-23, IL- (MIP-1a), CCL5 (RANTES), CCL7 (MCP3), XCL1 (lymphotactin), CXCL1 (MGSA-alpha), CCR7, CCL19 (MIP-3b), CXCL9 , CXCL12 (SDF-1), CCL21 (6Ckine), OX40L, 4-1BBL, CD40, CD70, GITRL, LIGHT, b-Defensin, HMGB1, Flt3L, IFN-beta, TNF-alpha, dnFADD, BCG , TGF-alpha, TGFbRII DN, ICOS-L and S100. It relates.

However, the techniques disclosed in the above patent documents relate to manipulated cells expressing a plurality of immunomodulators and their use, and it is not intended to elucidate the specific mechanism of the immunomodulators, so that the CD40 protein induces inflammation-induced neovascularization It is difficult to know clearly what role it plays in regulating action and it has been difficult to apply it to the field to prevent or prevent neovascularization diseases.

Therefore, there is a need for a technique for diagnosing renal angiogenesis diseases using the CD40 protein as a marker, which can provide a more reliable diagnosis.

Patent Document 1: U.S. Published Patent Application No. 2016-0089398

The present inventors have developed a novel biomarker for the diagnosis of new blood vessels for the purpose of solving the problems of the above-mentioned conventional techniques. As a result of these efforts, the CD40 protein in vascular endothelial cells has undergone a signal- PPARγ is involved in the signal transduction process with the CD40 protein and the specific miRNA, and specific substances also inhibit the expression of CD40 protein by inhibiting the expression of the CD40 protein. Preventive or preventive diseases, it has been confirmed that various substances including the CD40 protein can be applied to a composition for diagnosing a neovascularization disease, and the present invention has been completed.

It is an object of the present invention to provide a composition for diagnosing a neovascularization disease comprising an agent for measuring the level of CD40 protein in a cell.

It is another object of the present invention to provide a kit for diagnosing renal vasculogenesis diseases, which comprises a composition for diagnosing a renal vascular disease disease comprising an agent for measuring the level of CD40 protein in a cell.

It is another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of renal vascular disease comprising CD40 protein as an active ingredient.

It is another object of the present invention to provide a method for measuring the incidence of renal vascular disease including measuring the level of CD40 protein in a biological sample.

As one embodiment for achieving the above object,

The present invention provides a composition for diagnosing a neovascularization disease comprising an agent for measuring the level of CD40 protein in a cell.

In addition, the present invention provides a composition for diagnosing a neovascularization disease, wherein the cell is a vascular endothelial cell.

Also, the present invention provides a composition for diagnosing renal vascular disease, wherein the agent for measuring the level of the protein comprises the expression promoter or the expression inhibitor of the CD40 protein.

In addition, the present invention provides a composition for diagnosing a neovascularization disease, wherein the expression inhibitor inhibits signal transduction between the CD40 protein and a target miRNA in which signal transduction with the CD40 protein is performed, thereby inhibiting neovascularization.

Also, the present invention provides a composition for diagnosing a neovascularization disease, wherein the target miRNA is miRNA-424 or miRNA-503.

Also, the present invention provides a composition for diagnosing neovascularization disease, wherein the expression of miRNA-424 or miRNA-503 is regulated by peroxisome proliferator-activated receptor gamma (PPARγ) do.

In addition, the present invention is characterized in that the regulation comprises the binding of the peroxisome proliferator-activated receptor gamma (PPARγ) to the promoter region of miRNA-424 or miRNA-503. There is provided a composition for diagnosing a disease.

In addition, the present invention provides a composition for diagnosing neovascularization diseases, wherein the expression inhibitor is pioglitazone.

In addition, the present invention provides a kit for diagnosing a neovascularization disease comprising a composition for diagnosing a neovascularization disease comprising an agent for measuring the level of CD40 protein in the cell.

Also, the present invention provides a kit for diagnosing renal vessel disease, wherein the kit is an RT-PCR kit, a DNA chip kit or a protein chip kit.

The present invention also provides a pharmaceutical composition for preventing or treating a neovascularization disease comprising CD40 protein as an active ingredient.

The present invention also relates to the use of the novel angiogenic diseases for the treatment and prophylaxis of cancers, tumors, ischemia, infertility, diabetic foot ulcer, ischemic stroke, ulcer, atherosclerosis, myocardial infarction, angina pectoris, ischemic heart failure, Cerebral vascular dementia. The present invention also provides a pharmaceutical composition for preventing or treating neovascularization diseases.

The present invention also provides a method for measuring the occurrence of a neovascularization disease comprising measuring the level of CD40 protein in a biological sample.

Also, the present invention provides a method for measuring the occurrence of a neovascularization disease, wherein the biological sample is a vascular endothelial cell.

The present invention further provides a method for measuring the incidence of neovascularization diseases, which comprises the step of measuring the mRNA level of CD40 before expression of the CD40 protein.

The present invention further provides a method for measuring the incidence of neovascularization diseases, which comprises the step of injecting the CD40 protein expression promoter or expression inhibitor into the biological sample.

Also, the present invention provides a method for measuring the incidence of renal vascular disease, wherein the expression inhibitor is pioglitazone.

When a composition for the diagnosis of a neovascularization disease according to the present invention, a kit, a pharmaceutical composition for the prevention or treatment of a neovascularization disease and a method for measuring the occurrence of a neovascularization disease are used, a clearer diagnosis And may be useful for the prevention or treatment of the above-described neovascular diseases. The composition for the diagnosis of a neovascularization disease according to the present invention, the kit, the pharmaceutical composition for the prevention or treatment of a neovascularization disease, and the method for measuring the incidence of a neovascularization disease include a neovascularization- Which is useful for gene therapy or cell therapy research.

The accompanying drawings are included to provide a further understanding of the invention to those skilled in the art, and the technical spirit of the invention is not limited thereto.
Fig. 1 shows the results of Example 1 according to the present invention. Fig.
2 is a diagram showing the results of Example 2 according to the present invention.
3 is a diagram showing the results of Example 3 according to the present invention.
4 is a diagram showing the results of Example 4 according to the present invention.
5 is a diagram showing the results of Example 5 according to the present invention.
6 is a diagram showing the results of Example 6 according to the present invention.

Hereinafter, the present invention will be described in more detail.

The present invention relates to a composition for diagnosing a neovascularization disease comprising an agent for measuring the level of CD40 protein in a cell.

The term "CD40 " as used herein means a cell surface protein belonging to the tumor necrosis factor receptor (TNFR) system. It is known that signal transduction by CD40 plays an important role in bioimmune response. In particular, it has been reported that B lymphocytes ultimately regulate transcription and contribute to cell differentiation, development, and activation. May include a CD40 protein or CD40 protein receptor, as described herein, which may be encoded or encoded by the CD40 gene.

As used herein, the term "diagnosis " means identifying the presence or characteristic of a pathological condition. In the present invention, the "diagnosis" can be interpreted as observing and confirming whether or not a new blood vessel-forming disease occurs.

Also, the present invention provides a composition for diagnosing a neovascularization disease, wherein the cell is a vascular endothelial cell.

As used herein, the term "vascular endothelial cell" refers to a cell that covers the inner wall of the entire blood vessel with a monolayer, and more preferably, human umbilical vein endothelial cells (HUVECs) Which is located between the circulating blood and the internal tissue and acts as a boundary to separate the two from each other.

Vascular endothelial cells provide resistance to thrombus formation and provide various functions in cell growth including blood vessel permeability, tone, fibrinolysis, coagulation, inflammation and immune response. It controls.

Dysfunction of vascular endothelial cells is generally accompanied by vascular sclerosis, hypercholesterolemia, homocystinemia, hyperglycemia, hypertension, smoking, inflammation or natural aging. All of which involve vascular endothelial dysfunction.

Also, the present invention provides a composition for diagnosing renal vascular disease, wherein the agent for measuring the level of the CD40 protein comprises the CD40 protein expression promoter or the expression inhibitor.

As used herein, the term "agent for measuring the level of protein" means a preparation used for measuring the level of a target protein contained in a sample, preferably western blotting, enzyme linked immunosorbent assay, radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assays, complement An antibody used in a method such as Complement Fixation Assay, FACS and protein chip assay.

The term "antibody" in the present specification means a proteinaceous molecule capable of specifically binding to an antigenic site of a protein or peptide molecule. The antibody can be obtained by cloning each gene into an expression vector according to a conventional method, A protein encoded by the marker gene can be obtained and can be produced from the obtained protein by a conventional method. The form of the antibody is not particularly limited, and any polyclonal antibody, monoclonal antibody or antigen-binding antibody thereof may be included in the antibody of the present invention, and any immunoglobulin antibody may be included, Specific antibodies of the invention. In addition, the antibody comprises a functional fragment of an antibody molecule as well as a complete form having two full-length light chains and two full-length heavy chains.

Refers to a fragment having at least an antigen-binding function, and may be, for example, Fab, F (ab ') 2, F (ab') 2 and Fv.

The present invention also provides a composition for diagnosing neovascularization disease, wherein the expression inhibitor inhibits signal transduction between the CD40 protein and a target miRNA that is in signal transduction with the CD40 protein, thereby inhibiting neovascularization.

The target miRNA may be miRNA-424 or miRNA-503, and CD40 protein expression can be regulated by signal transduction with the CD40 protein. For example, the expression of the CD40 protein may be decreased when the target miRNA is increased, and conversely, when the target miRNA is decreased, the expression of the CD40 protein may be increased.

Expression of miRNA-424 or miRNA-503 can be regulated by peroxisome proliferator-activated receptor gamma (PPARy).

The expression of miRNA-424 or miRNA-503 can be regulated depending on whether the peroxisome proliferator-activated receptor gamma binds to the promoter region of miRNA-424 or miRNA-503 described above.

For example, when the peroxisome proliferator-activated receptor gamma is bound to the promoter region of miRNA-424 or miRNA-503, the expression of miRNA-424 or miRNA-503 is increased and the peroxisome proliferator Expression of miRNA-424 or miRNA-503 may be decreased if activated receptor gamma is not bound to the promoter region of miRNA-424 or miRNA-503.

In addition, the agent for inhibiting the expression of the CD40 protein is not particularly limited, but may be, for example, pioglitazone.

The present invention also provides a composition for diagnosing neovascularization disease, comprising an expression inhibitor capable of inhibiting expression of the CD40 protein at an mRNA level before expression of the CD40 protein, if necessary, do.

As used herein, the term "capable of inhibiting at the mRNA level" may mean suppressing the level of the mRNA transcribed from the target gene in order to confirm the expression of the target gene contained in the sample. Zero is preferably selected from the group consisting of RT-PCR, competitive RT-PCR, real-time RT-PCR, RNase protection assay (RPA), Northern blotting ), A DNA chip analysis method, and the like. However, the probe or primer can be specifically bound to a target gene, but is not particularly limited thereto.

As used herein, the term "primer " means a nucleic acid sequence having the same meaning as a conventional primer, for example, with a short 3 'free hydroxyl group and includes a complementary template Is a term referring to a short nucleic acid sequence that can form a base pair and serves as a starting point for template strand duplication. Such a primer can initiate DNA synthesis in the presence of a reagent for polymerization (i. E., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at a suitable buffer solution and temperature.

As used herein, the term "probe" may have the same meaning as a probe in the conventional sense, for example, RNA or DNA corresponding to a few bases or hundreds of bases that can achieve specific binding with a gene or mRNA And may be prepared in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like, May be labeled for detection.

The present invention also provides a kit for diagnosing renal vascular disease comprising the composition for diagnosing a renal vessel disease.

In addition, the present invention provides a kit for diagnosing neovascularization disease, wherein the kit is an RT-PCR kit, a DNA chip kit, or a protein chip kit.

The kit of the present invention can be used for diagnosing neovascularization diseases by measuring the level of CD40 protein from a sample of a patient suspected of having a neovascularization disease and confirming the onset of neovascularization disease, Alternatively, one or more other component compositions, solutions or devices suitable for the assay method may be included, as well as primers, probes or antibodies for measuring the level of the CD40 protein.

As used herein, the term "sample " refers to a direct subject that is isolated from a patient with renal angiogenesis and that measures the level of expression of CD40 protein, including, but not limited to, a tissue sample of a patient with renal angiogenesis .

The kit of the present invention may be a kit for analyzing a protein chip for measuring CD40 protein, which is not particularly limited, but may be labeled with a substrate, a suitable buffer solution, a chromogenic enzyme or a fluorescent substance for immunological detection of the antibody Secondary antibodies, chromogenic substrates, and the like.

The substrate is not particularly limited, but a nitrocellulose membrane, a 96-well plate synthesized with polyvinyl resin, a 96-well plate synthesized with a polystyrene resin, and a glass slide glass can be used, and the coloring enzyme is not particularly limited The fluorescent substance may be FITC, RITC or the like, and the coloring substrate liquid is not particularly limited, but ABTS (2, 3, 4, 5, 2-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) or OPD (o-phenylenediamine), TMB (tetramethylbenzidine).

The present invention also provides a pharmaceutical composition for preventing or treating a neovascularization disease comprising CD40 protein as an active ingredient.

The pharmaceutical composition for preventing or treating a neovascularization disease of the present invention may further comprise a pharmaceutically acceptable additive. Examples of the pharmaceutically acceptable additives include starch, gelatinized starch, microcrystalline cellulose, lactose, povidone Corn starch, corn starch, powdered cellulose, hydroxypropylcellulose, opaques, starch glycolate sodium, carnauba wax, synthetic aluminum silicate, calcium phosphate, calcium phosphate, calcium hydrogen phosphate, lactose, mannitol, , Stearic acid, magnesium stearate, aluminum stearate, calcium stearate, white sugar, dextrose, sorbitol and talc. The pharmaceutically acceptable additives that can be used in the present invention preferably include 0.1 part by weight to 90 parts by weight of the composition, but are not limited thereto.

That is, the pharmaceutical composition for the prevention or treatment of neovascularization diseases of the present invention may be administered in various formulations of oral or parenteral administration at the time of actual clinical administration. In the case of formulation, a filler, an extender, a binder, Disintegrating agents, disintegrating agents, surfactants, and the like. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, water, Sucrose, Lactose, Gelatin, or the like. In addition to simple excipients, lubricants such as magnesium stearate talc may also be used. Examples of the liquid preparation for oral use include suspensions, solutions, emulsions and syrups, and various excipients such as wetting agents, sweetening agents, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are simple diluents commonly used . Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. Examples of suppository bases include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like.

The pharmaceutical compositions for the prevention or treatment of neovascularization diseases according to the present invention may be administered orally or parenterally according to the intended method. For parenteral administration, parenteral administration or intraperitoneal injection, intramuscular injection, subcutaneous injection, intravenous injection , Intramuscular injection, or intra-thoracic injection injection method. The dosage varies depending on the patient's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and disease severity.

The dosage of the pharmaceutical composition for the prevention or treatment of neovascularization diseases of the present invention varies depending on the patient's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate and disease severity , The daily dose is 0.0001 to 100 mg / kg, preferably 0.001 mg / kg to 10 mg / kg, based on the amount of the peel extract or fraction thereof, and may be administered once to six times a day.

The pharmaceutical composition for the prevention or treatment of neovascularization diseases of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy and biological response modifiers.

The present invention also relates to the use of a compound of formula I or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the treatment and / or prophylaxis of cancer, tumor, ischemia, infertility, diabetic foot ulcer, ischemic stroke, ulcer, arteriosclerosis, myocardial infarction, angina, ischemic heart failure, Cerebral vascular dementia. The present invention also provides a pharmaceutical composition for preventing or treating neovascularization diseases.

The kind of the neovascularization disease is not limited by the above-mentioned.

The present invention also provides a method for measuring the occurrence of a neovascularization disease comprising measuring the level of CD40 protein in a biological sample.

The method for measuring the incidence of renal vascular disease according to the present invention is a method for measuring the incidence of renal vascular disease using the composition for diagnosing renal vascular disease according to the present invention, The description will be omitted.

The present invention further provides a method for measuring the incidence of neovascularization diseases, which comprises the step of measuring the mRNA level of CD40 before expression of the CD40 protein.

The present invention further provides a method for measuring the incidence of neovascularization diseases, which comprises the step of injecting the CD40 protein expression promoter or expression inhibitor into the biological sample.

Also, the present invention provides a method for measuring the incidence of renal vascular disease, wherein the expression inhibitor is pioglitazone.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

[Experimental Method]

1. Animal experiments

Mirc24fl / fl and Cdh5-CreERT2 were used as C57 / BL6 mice in the experiments for the present invention. All of the mice used in the experiment were dissolved in 1 mg of tamoxifen in corn oil, injected continuously for 5 days into the abdominal cavity, and then allowed to rest for 14 days.

2. Cell culture and transfection

HUVEC was cultured in a 5% CO ₂ incubator at 37 ° C, and EBM-2 supplemented with EGM2 and 1% penicillin-streptomycin was used as the medium. The HUVECs used in the experiments used cells that were between 70 and 90% of the area between 3 and 7 passages. HeLa cells were cultured in DMEM supplemented with 10% FBS (fetal bovine serum) and 1% penicillin-streptomycin. SiRNA, miRNA mimic (analog) in HUVEC, and inhibitors were taken 72 hours after transfection using lipofectamine RNAiMAX product. HeLa plasmid and miRNA mimic were transfected using Lipofectamine 2000. Pioglitazone was used at 10 uM.

3. Gene Expression Analysis

Total RNA was extracted using the miRNeasy RNA isolation kit and reverse transcribed using the TaqMan miRNA reverse transcription kit. Real-time PCR of miRNA was performed using TaqMan Universal Master Mix II, no UNG product, and miR-424 and miR-503 were detected with Taqman probe. Data were normalized using small ribonucleic acid 19 as a control. The extracted mRNA was reverse transcribed with the qPCRBIO cDNA Synthesis Kit product and real-time PCR was performed using qPCRBIO SyGreen Mix Hi-ROX product, in which ribosome 18S was used as a control.

4. Western blot

HUVEC was dissolved in RIPA buffer containing protease and phosphatase inhibitor, and then the protein was extracted by centrifugation at 13,000 RPM for 15 minutes at 4 ° C. Protein quantification was performed using the Pierce BCA Protein assay kit, and the same amount of protein was transferred to a polyvinyl-difluoride (PVDF) membrane by SDS-polyacrylamide gel electrophoresis. The primary antibodies used were CD40 (1: 3000, BD Bioscience), GAPDH (1: 5000, Cell signaling), PPARγ (1: 5000, Santa Cruz) and HRP- ) And a chemiluminescence detection method were used to detect the amount of protein.

5. Lucifer Reyes Reporter Essay

A portion of the human CD40 3'UTR (738p) containing the seed sequence predicted to bind miR-424/503 with the 3 'UTR Luciferase reporter assay was cloned into the NotI and XhoI sites of the psiCHECK-2 vector. The CD40 seed sequence TGCTGCT was mutated to TGTCGCT (Mutant # 1) and CGCGGCG (Mutant # 2) using the QuikChange II Site-Directed Mutagenesis Kit (Agilent). HeLa was transfected with Luciferase reporter vector and miR-424,503 mimic, negative control miRNA using lipofectamine 2000 (Invitrogen). After 48 hours, the cells were lysed and luciferase activity was measured by Dual-Luciferase Reporter Assay kit (Promega). Human miR-424/503 promoter Luciferase, PPAR Reaction Element (PPRE) promoter Luciferase vector was from Bruce Spiegelman (Addgene plasmid # 1015). The miR-424/503 promoter and renilla, PPARy, and RXRalpha vectors were transfected into HUVEC. Luciferase activity was measured by the Dual-Luciferase Reporter Assay kit (Promega).

6. Vascular endothelial cell angiogenesis assay (tube formation)

HUVEC was placed in a 6-well plate and siRNA or miRNA was transfected using RNAi MAX (Invitrogen). The next day, 24 well plates were coated with 250 ul of Matrigel matrix (product with less growth factor and no phenol red) and placed at 37 占 폚 for 30 minutes. Meanwhile, the transfected cells were removed and 3 x 10 ⁴ cells per well of a 24-well plate were placed on a Matrigel matrix. LPS (Sigma, 1 μg / ml) and pioglitazone (10 μM) were treated. Each experiment was observed under a microscope for 8 hours to 9 hours, and tube formation length of vascular endothelial cells was determined using WimTube (ibidi).

7. Cell migration assay

HUVECs were plated in 12-well plates at 2 × 10 ⁵ per well and scraped with the p200 pipette tip the next day. HUVEC was cultured in starvation media containing 1% fetal calf serum and treated with LPS (1 μg / ml) and Pioglitazone (10 μM). The distance traveled by the cell was measured with a camera microscope and taken every fixed time. The travel distance was calculated using ImageJ.

8. Fibrin gel bead assay

Cytodex 3 microcarriers (Amersham Pharmacia Biotech) were inflated in PBS for 3 hours and then sterilized with a high pressure steam sterilizer. HUVEC was detached and mixed with 1 ml of EGM-2 medium at a ratio of 1 Cytodex 3 microcarrier per 400 cells. The cells were then incubated for 4 hours at 37 ° C in a 5% CO ₂ incubator with shaking every 20 minutes. Then, 5 ml of EGM-2 was added thereto and the mixture was allowed to stand for one day at 37 ° C and 5% CO ₂ . The next day, the beads were washed 2 times with EGM-2 and then resuspended in 2 mg / ml fibrinogen (Sigma-Aldrich) solution containing 0.15units / ml aprotinin (Sigma-Aldrich). At this time, 150 beads per 1 ml were included. 500ul of fibrinogen / bead solution was added to the well with 0.625 unit thrombin (Sigma-Aldrich), allowed to stand at room temperature for 5 minutes, and then placed in a 5% CO ₂ incubator at 37 ° C for 15 minutes. During this time, the fibroblasts were uncoated and uncoated on EGM-2 medium and placed on the Clot containing 20,000 cells per well. The medium was changed once every two days and the average sprout length was analyzed using ImageJ.

9. Chromatin Immunoprecipitation.

HUVEC was cultured on a 100 mm plate for 24 hours, and then treated with 1% formaldehyde for 15 minutes to allow native protein and DNA to bind. Simple ChIP Plus Enzymatic Chromatin IP kit (Cell Signaling) was used. Extracted chromatin was divided into equal amounts and immunosulated by PPARγ antibody or rabbit IgG control. We confirmed the binding of PPARγ to the miR-424/503 promoter through a sequential polymerase chain reaction of the immunoprecipitated DNA. The primers of the chain polymerase reaction were # 1: FWD: GAGGTGGCTTTTTAGGGGT REV: CGAGCCATCATGTCAGAAGT; # 2: FWD: AGAGGCGTATTCTTTGGCTC and REV: TCCCTTCCAGATTGCTCTTG; # 3: FWD: TCCAAGAGCAATCTGGAAGG REV: TCTCCCAACATTTTGTTCCA. The PCR reaction was confirmed by electrophoresis and visualized by SYBRsafe (Invitrogen).

10. Lentivirus production

In order to induce CD40 overexpression, lentivirus carrying CD40 was purchased from Origene. Lenti-X HTX Packaging system (Clontech) and Lenti-X Concentrator were used to make lentiviral particles to be used for intracellular transduction.

11. Matrigel plug angiogenesis assay.

(8-10 mg of protein / ml, Corning, 356231) was added to a final concentration of 10 μg / ml of LPS (Sigma Aldrich, L2630) and a final concentration of 20 U / ml of Heparin (Sigma Aldrich, H3393) I mixed it as much as possible. 0.5 ml was injected into the left and right groin subcutaneous fat of Mirc24fl / fl or Mirc24fl / fl mir24fl / fl; Cdh5-CreERT2 female rats from 5 months to 6 months. Seven days after injection, the plugs were fixed in 4% PFA for 2 hours at room temperature. And placed in 30% sucrose and placed in Tissue Tec OCT (Sakura). The Matrigel plug was cut into 10μm using a Leica CM1950 cryotome and subjected to immunohistochemistry or fluorescence immunoassay.

12. Immunohistochemistry and fluorescence immunoassay

The anti-CD31 (BD Pharmigen, 553370), anti-smooth muscle actin conjugated to anti-CD31 antibody was blocked with blocking buffer (1% BSA, 10% goat serum, 1X PBS) (R & D Systems, AF440) and incubated at 4 < 0 > C for one day. The next day, the cells were stained with Alexa Fluor secondary goat antibodies for 1 hour at room temperature and stained with DAPI (Thermo Scientific) for nuclear staining. Images were observed with a 10 × objective using a Zeiss confocal microscope. 2plugs per mouse and 5 images per plug were randomly selected. H & E staining was performed using a conventional method and photographed with an optical microscope (Nikon Eclipse 80i).

13. Statistical Analysis

All experiments were performed at least 3 times, and GraphPad Prism 5.0 software was used for analysis. The unpaired two-tailed Student's t-test was used to compare only two groups, but one-way analysis of variance followed by Bonferroni's multiple comparison test was used. The correlation between the groups was determined by the Pearson correlation coefficient and the two-tailed Fisher's exact test was used to compare the degree of angiogenesis in the mice of other genotypes in the Matrigel plug assay.

In the following, the data obtained by the experiments performed by the above experimental method, that is, the results shown in Figs. 1 to 6, will be analyzed.

[ Example  1] CD40 < / RTI > of inflammatory inducers in vascular endothelial cells miR -424 and miR -503 correlation

It was observed that the expression of CD40 mRNA and protein significantly increased in a time-dependent manner when HUVEC was treated with LPS (1 μg / mL) or TNFα (10 ng / mL) (see a and b in FIG. 1) We examined whether CD40 expression by the reaction is miRNA dependent. The expression of CD40 protein was significantly increased when argonaute 2 (AGO2) or DICER, an important protein of the RNA-induced silencing complex (RISC) complex in HUVEC, was knocked down (see c in FIG. 1). This can be seen as a result of suggesting that existing CD40 expression is miRNA dependent. Next, target prediction software algorithms (TargetScan, PicTar, and microRNA.org) were used to determine which miRNAs are involved in the regulation of CD40 expression in vascular endothelial cells. miR-424 and miR-503 had a highly conserved seed sequence and were predicted to bind to the 3 'untranslated region (UTR) of CD40 (see d in Figure 1). These two miRNAs are highly expressed in vascular endothelial cells and are known to play an important role in maintaining homeostasis of blood vessels. Therefore, we examined whether the inflammation-inducing factor affects vascular endothelial miR-424 and miR-503 expression. The expression of miR-424 and miR-503 pri-miRNA and mature miRNA was significantly decreased in LPS and TNFα stimulation. This means that these miRNAs are suppressed at the transcription level in the vascular endothelial cell context for the inflammatory response (see e, f in Figure 1)

[Example 2] Relationship between CD40 and miR-424 and miR-503

In order to investigate the relationship between miR-424/503 and CD40, overexpression of miR-424 and miR-503 significantly reduced both mRNA and protein expression of CD40, but when suppressed using anti-miRNA, (See a and b in Fig. 2). In order to investigate whether miR-424 and miR-503 directly regulate CD40 expression by 3'UTR, wild type 3'UTR reporter vector and miR-424, miR-503 mimic (simian) at the same time, the reporter activity was significantly decreased. However, reporter activity was not changed by the miR-424, miR-503 analog when the two kinds of CD40 3'UTR mutant vectors were transfected (see d in FIG. 1 and c in FIG. 2). These results indicate that miR-424 and miR-503 directly regulate CD40 expression.

[Example 3] Change in CD40 inhibition in vascular endothelial cells

Because of the angiogenic response caused by inflammatory stimuli, vascular endothelial cell vascularization and cell migration have been shown to induce vascular endothelial vasculogenesis by LPS. CD40 knockdown (See a in Fig. 3). In addition, CD40 knockdown significantly inhibited LPS-induced HUVEC cell migration (see b in Figure 3). These results indicate that the CD40 signal plays an important role in regulating the angiogenic process. In order to investigate whether miR-424 and miR-503 directly regulate CD40, we examined whether miR-424 and miR-503 overexpression mediates CD40 expression induced by inflammation inducing factors. As a result, And that the expression of CD40 protein was significantly reduced by transfection with miR-424 and miR-503 derivatives before treatment with TNFα (see c in FIG. 3). In addition, LPS-induced vascular endothelial cell migration and angiogenesis were also significantly decreased upon overexpression of miR-424 and miR-503 (see d and e in FIG. 3). The following sprouting bead angiogenesis assay was performed and it was confirmed that germination of LPS-induced vascular endothelial cells was inhibited in cells overexpressing miR-424 and miR-503 (see f in FIG. 3). In addition, the effects of miR-424 and miR-503 on vascular endothelial cell vascularization and cell migration were examined to see if CD40 overexpression could be reversed. As a result, miR-424 and miR-503 over- (See g and h in FIG. 3). These results demonstrate that the miR-424/503-CD40 signaling pathway plays an important role in inflammation-induced angiogenesis.

[Example 4] Relationship between pioglitazone and CD40 expression

To investigate the molecular mechanisms by which PPARγ affects the angiogenesis induced by inflammation-inducing factors, the effects of PPARγ agonist pioglitazone on miR-424 and miR-503 expression were examined. HUVEC Treated with pioglitazone significantly increased miR-424 and miR-503 expression (see FIG. 4a). In addition, miR-424 and miR-503 expression was restored upon treatment with LPS and pioglitazone (see b in FIG. 4). In addition, it was found that CD40 expression was decreased for pioglitazone stimulation (c, d in FIG. 4). In addition, LPS-induced CD40 expression was restored by pioglitazone (see e in Figure 4). Next, pioglitazone was used to investigate whether HUVEC affects LPS-induced vasculogenesis and cell migration. As a result, pioglitazone decreased the LPS-induced angiogenesis in HUVEC to the extent that the vasculogenesis (see f in FIG. 4) (See g in FIG. 4), and germination assay (see h in FIG. 4). These results indicate that pioglitazone is involved in the miR-424/503-CD40 signaling axis, restoring LPS-induced angiogenesis.

[ Example  5] PPARγ  And miR -424 and miR Relationship with Expression of -503

In order to examine the relationship between PPARγ and miR-424/503, an inferred region of the miR-424/503 promoter using in silico was used to predict the two regions presumed to be PPARγ binding sites 5 a). First, to examine how PPARγ knockdown affects miR-424/503 and CD40 expression, all of the pri, mature miR-424, and miR-503 were reduced by PPARγ knockdown (see FIG. In addition, it was confirmed that CD40 expression was significantly increased by PPARγ knockdown. This result supports that PPAR gamma is involved in the modulation of CD40 expression by miR-424/503 (c in FIG. 5). Chromatin immunoprecipitation (ChIP) experiments confirmed that PPARγ binds to the predicted binding site in the region predicted by the miR-424/503 promoter (see d in FIG. 5). Next, the miR-424/503 promoter-based luciferase reporter vector was used to overexpress PPARγ and retinoid X receptor alpha (RXRα) to confirm that luciferase reporter activity was induced (see e in FIG. 5). In addition, the luciferase activity increased by PPARy and RXRa overexpression in HUVEC was further increased by pioglitazone treatment (see e in FIG. 5). In order to investigate whether LPS and TNFα regulate miR-424 and miR-503 expression in a PPARγ-dependent manner, LPS stimulation with minimal PPAR responsive element (PPRE) luciferase reporter vector induced luciferase reporter activity Showed a tendency to decrease and when the pioglitazone was treated in the same way, the reporter activity was significantly decreased (see f in FIG. 5). In addition, when TNFa stimulation was treated alone or simultaneously with pioglitazone, all of the PPRE luciferase reporter activity was significantly reduced (see g in FIG. 5). Furthermore, when HUVEC was treated with LPS or TNFα, mRNA and protein expression of PPARγ decreased significantly. These results suggest that the reduction of PPARy expression in vascular endothelial cells may be an important mechanism of miR-424 and miR-503 reduced by inflammatory inducers (see h to k in FIG. 5). These results suggest that PPARγ is an important regulator of miR-424 and miR-503 expression in endothelial cell inflammatory responses.

[ Example  6] Vascular endothelial cell specificity in animal experiments miR -322, miR -503 Elimination of the Mouse Increases LPS-Induced Angiogenesis

In order to observe the results in vivo, miR-332 (mouse-like gene of miR-424) and miR-503 were specifically removed from vascular endothelial cells. Mice with LoxP sites around the MiRNA cluster 24 (clusters containing miR-332, miR-503, miR-351) and mice bearing tamoxifen inducible Cdh5 Cre drivers were crossed. The adult Mirc24ECKO mice injected with tamoxifen did not show phenotypic changes until 12 weeks after injection. Matrigel plugs containing LPS were subcutaneously injected and confirmed vascularization 7 days later. Mirc24ECKO mice were found to have more blood vessels formed in the rat mitral plugs exposed to LPS. This was confirmed by the H & E staining (see b in Figure 6) and the increase in the number of CD31 + / SMA + blood vessels (see Fig. 6b) C and d in Fig. 6). In addition, it was confirmed that CD40 expression was increased in vascular endothelial cells infiltrating the matrigel (see e in FIG. 6). F in FIG. 6 is a schematic representation of the relevant mechanism.

It will be understood by those of ordinary skill in the art that the foregoing description of the embodiments is for illustrative purposes and that those skilled in the art can easily modify the invention without departing from the spirit or essential characteristics thereof. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive. For example, each component described as a single entity may be distributed and implemented, and components described as being distributed may also be implemented in a combined form.

The scope of the present invention is defined by the appended claims rather than the detailed description, and all changes or modifications derived from the meaning and scope of the claims and their equivalents should be construed as being included within the scope of the present invention.

Claims (17)

A composition for diagnosing a neovascularization disease comprising an agent for measuring the level of CD40 protein in a cell,
Wherein the agent for measuring the level of the protein comprises the expression inhibitor of the CD40 protein,
Wherein the expression inhibitor inhibits a signal transduction process between the CD40 protein and the target miRNA in which signal transduction with the CD40 protein is performed, thereby inhibiting neovascularization.
The composition according to claim 1, wherein the cell is a vascular endothelial cell.
delete delete 2. The composition for diagnosing neovascularization diseases according to claim 1, wherein the target miRNA is miRNA-424 or miRNA-503.
6. The composition for diagnosing neovascularization diseases according to claim 5, wherein the expression of miRNA-424 or miRNA-503 is regulated by peroxisome proliferator-activated receptor gamma (PPARγ).
7. The method according to claim 6, wherein the regulation comprises binding of the peroxisome proliferator-activated receptor gamma (PPARy) to the promoter region of miRNA-424 or miRNA-503 A composition for diagnosing angiogenic diseases.
The composition according to claim 1, wherein the expression inhibitor is pioglitazone.
A kit for the diagnosis of neovascularization diseases comprising the composition according to any one of claims 1 to 2 and 5 to 8.
10. The kit for diagnosing neovascularization diseases according to claim 9, wherein the kit is an RT-PCR kit, a DNA chip kit or a protein chip kit.
A pharmaceutical composition for preventing or treating a neovascularization disease comprising CD40 protein as an active ingredient,
Wherein the CD40 protein further comprises the CD40 protein expression inhibitor,
Wherein the expression inhibitor inhibits the signal transduction between the CD40 protein and the target miRNA to be signal-transduced with the CD40 protein, thereby inhibiting renal blood vessel formation.
12. The method of claim 11, wherein the renal vessel disease is selected from the group consisting of cancer, tumor, ischemia, infertility, diabetic foot ulcer, ischemic stroke, ulcer, atherosclerosis, myocardial infarction, angina pectoris, ischemic heart failure, And cerebrovascular dementia. The pharmaceutical composition for preventing or treating neovascularization diseases according to claim 1,
Measuring the level of CD40 protein in the biological sample; And
And introducing the CD40 protein expression inhibitor into the biological sample.
14. The method according to claim 13, wherein the biological sample is a vascular endothelial cell.
14. The method according to claim 13, further comprising the step of measuring mRNA level of CD40 before expression of the CD40 protein.
delete 14. The method according to claim 13, wherein the expression inhibitor is pioglitazone.

Images