KR102002671B1 - Methods for improving capability of stem cell using 2DG - Google Patents

Methods for improving capability of stem cell using 2DG Download PDF

Info

Publication number
KR102002671B1
KR102002671B1 KR1020160150267A KR20160150267A KR102002671B1 KR 102002671 B1 KR102002671 B1 KR 102002671B1 KR 1020160150267 A KR1020160150267 A KR 1020160150267A KR 20160150267 A KR20160150267 A KR 20160150267A KR 102002671 B1 KR102002671 B1 KR 102002671B1
Authority
KR
South Korea
Prior art keywords
stem cells
stem cell
glucose
deoxy
present
Prior art date
Application number
KR1020160150267A
Other languages
Korean (ko)
Other versions
KR20180053461A (en
Inventor
김동익
김애경
강동림
고하늘
김민희
한규현
Original Assignee
사회복지법인 삼성생명공익재단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 사회복지법인 삼성생명공익재단 filed Critical 사회복지법인 삼성생명공익재단
Priority to KR1020160150267A priority Critical patent/KR102002671B1/en
Priority to PCT/KR2017/010773 priority patent/WO2018088693A1/en
Publication of KR20180053461A publication Critical patent/KR20180053461A/en
Application granted granted Critical
Publication of KR102002671B1 publication Critical patent/KR102002671B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0652—Cells of skeletal and connective tissues; Mesenchyme
    • C12N5/0662—Stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/02—Atmosphere, e.g. low oxygen conditions
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2500/00—Specific components of cell culture medium
    • C12N2500/30—Organic components
    • C12N2500/34—Sugars

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Hematology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Rheumatology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명은, 저산소 조건하의 2-데옥시-D-글루코스(2DG)을 포함하는 줄기세포능 향상용 배지 조성물, 및 이의 용도에 관한 것이다. 본 발명에 의하면, 유전자 조작이나 바이러스 벡터 등을 사용하지 않으면서 배양환경 조절이라는 간편하고도 안전한 방법을 통하여, 줄기세포의 대사과정을 리프로그래밍함으로써 차세대 고효율 줄기세포를 대량 생산할 수 있다.
또한, 본 발명에 의하면, 줄기세포의 대사 과정을 선택적으로 조절할 수 있는 분자생물학적 기전, 대사조절 마커를 규명함으로써 고효율 줄기세포 개발에 대한 새로운 방법론을 제시할 수 있다.The present invention relates to a medium composition for improving stem cell function comprising 2-deoxy-D-glucose (2DG) under hypoxic conditions, and its use. According to the present invention, the next generation high-efficiency stem cells can be mass-produced by reprogramming the metabolic process of stem cells through a simple and safe method of controlling the culture environment without using gene manipulation or viral vectors.
In addition, according to the present invention, a new methodology for the development of high-efficiency stem cells can be presented by identifying the molecular biological mechanism and the metabolic regulation marker capable of selectively regulating the metabolic process of stem cells.

Description

2ＤＧ를 이용한 줄기세포 역량 향상 방법{Methods for improving capability of stem cell using 2DG}METHOD FOR IMPROVING STEM CELL CAPACITOR USING 2DG

본 발명은, 저산소 조건하의 2-데옥시-D-글루코스(2DG)를 포함하는 줄기세포능 향상용 배지 조성물, 및 이의 용도에 관한 것이다.The present invention relates to a medium composition for improving stem cell function comprising 2-deoxy-D-glucose (2DG) under hypoxic conditions, and its use.

중간엽 줄기세포는 그 다분화능과 함께, 조직의 재생, 치료 및 면역 반응에 관여하는 세포로 알려져 있어, 이와 같은 특성을 이용하여 제대혈, 골수 등로부터 중간엽 줄기세포를 분리배양하여 다양한 질환의 치료제로 개발하고자 하는 노력이 있어왔으나, 줄기세포를 계대배양함에 따라 노화가 진행되며 세포 분화가 일어나므로 줄기세포능(stemness)을 잃게 되는 문제가 있다.Since mesenchymal stem cells are known to be involved in the regeneration, treatment and immune response of tissues, as well as their pluripotency, mesenchymal stem cells are isolated and cultured from cord blood, bone marrow, etc., However, there is a problem in that stem cells are aged due to subculture and stem cells lose their stemness due to cell differentiation.

이러한 문제를 해결하여 줄기세포 효율을 증진시키기 위한 방안으로서, 바이러스 벡터를 이용한 유전자 조작이나 특정 단백질 과발현이 제안되어 왔으나 이는 안정성 문제로 인하여 임상 적용에는 한계가 있는 바, 1세대 줄기세포 연구를 통해 특정질환 치료를 위한 임상적용 가능성은 검증되었으나 낮은 효율과 효과기전 규명이 미흡하고 안전성 확보 또한 해결되지 않고 있다.Genetic manipulation using a viral vector or overexpression of a specific protein has been proposed as a method for improving stem cell efficiency by solving such a problem. However, since it is limited in clinical application due to stability problem, Clinical applicability for the treatment of the disease has been verified, but the efficiency and mechanism of the effect are insufficient and the safety is not solved.

이와 관련하여, 최근 분화세포(differentiated cell)에 비하여 배아줄기세포(ESC)와 유도만능줄기세포(iPS)에서 해당(glycolysis) 대사과정이 증가하고 산화적 인산화(oxidative phosphorylation) 대사과정이 감소되어 있음이 보고됨으로써, 대사과정을 조절하는 리프로그래밍(reprogramming)을 통해 줄기세포의 줄기세포능(stemness) 유지 및 세포 노화억제를 통한 고효율 줄기세포 개발 가능성이 제시되고 있으나, 이에 대한 분자생물학적 기전은 거의 밝혀지지 않았으며, 아직 효율적인 조절기술은 개발되지 못하고 있다.In this regard, glycolysis metabolic processes have increased and oxidative phosphorylation metabolism has decreased in embryonic stem cells (ESC) and induced pluripotent stem cells (iPS) compared to differentiated cells. The possibility of developing highly efficient stem cells through reprogramming regulating metabolic processes by stem cell maintenance and inhibition of cell senescence has been suggested, but the molecular biologic mechanism is almost unknown And no efficient control technology has yet been developed.

한편, 해당(glycolysis) 과정에서 생성되는 ATP는 2-3 mol/mol glucose에 불과하지만 이 과정을 통해 부수적으로 일어나는 핵산, 아미노산, 지방산 대사 등은 줄기세포능 유지 뿐만 아니라 분화과정에 필요한 빌딩블록(building block) 등을 만드는데 매우 중요한 대사과정으로 세포내 glycolysis 대사를 적정수준으로 촉진시키는 것은 임상적용이 가능한 줄기세포 개발에 중요한 요소가 될 수 있다.Meanwhile, the ATP produced in the glycolysis process is only 2-3 mol / mol glucose. However, nucleic acid, amino acid, and fatty acid metabolism that occur incidentally through this process are not only required to maintain stem cell function, building blocks, etc., and promoting the intracellular glycolysis metabolism to an appropriate level can be an important factor in the development of stem cells capable of clinical application.

또한, 산화적 인산화(oxidative phosphorylation) 과정을 통해 세포의 고유 기능 유지에 필요한 대부분의 ATP가 생성되나, 본 과정에서는 ROS(reactive oxygen species) 및 proapoptotic 단백질 등이 발생되므로 줄기세포능 유지에는 불리한 대사과정으로 알려져 있다. 따라서, 세포내 산화적 인산화 대사를 적정수준으로 억제시키는 것 역시 임상적용이 가능한 줄기세포 개발에 중요한 요소가 될 수 있다.In addition, oxidative phosphorylation produces most of the ATP required to maintain the intrinsic function of the cell. However, since reactive oxygen species (ROS) and proapoptotic proteins are generated in this process, metabolic processes . Therefore, suppression of intracellular oxidative phosphorylation at an appropriate level may also be an important factor in the development of stem cells capable of clinical application.

이와 같이, 생체 미세환경의 영향을 받는 에너지 대사과정은 줄기세포의 기능 유지 및 향상에 중요한 인자이나, 이에 대한 연구는 미흡한 실정이다.Thus, the energy metabolism that is influenced by the biological microenvironment is an important factor for the maintenance and improvement of stem cell function, but the research on it is insufficient.

이에, 본 발명자는 줄기세포의 대사과정 리프로그래밍을 통하여 노화를 억제하고 줄기세포능을 향상시킬 수 있는 방법에 대하여 예의 연구한 결과, 세포 배양환경의 산소농도를 조절함과 동시에 특정 물질을 처리시, 해당과정 증가 및 산화적 인산화 억제를 통하여 전반적인 대사능 및 증식 효율이 향상되고 혈관신생인자의 발현량이 증대됨을 발견함으로써 본 발명을 완성하게 되었다.Accordingly, the present inventors have intensively studied a method capable of inhibiting senescence and improving stem cell function through reprogramming of metabolic processes of stem cells. As a result, it has been found that, when controlling the oxygen concentration in the cell culture environment, , Increase of the process and inhibition of oxidative phosphorylation, the overall metabolic and proliferative efficiency is improved and the expression amount of angiogenic factor is increased, thereby completing the present invention.

따라서, 본 발명은, 저산소 조건하의 2-데옥시-D-글루코스(2DG)을 포함하는, 줄기세포능 향상용 배지 조성물, 및 이의 용도를 제공하는 것을 목적으로 한다.Accordingly, it is an object of the present invention to provide a medium composition for improving stem cell function comprising 2-deoxy-D-glucose (2DG) under hypoxic conditions, and its use.

그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

본 발명은, 저산소 조건하의 2-데옥시-D-글루코스(2DG)를 포함하는, 줄기세포능 향상용 배지 조성물을 제공한다.The present invention provides a medium composition for improving stem cell function comprising 2-deoxy-D-glucose (2DG) under hypoxic conditions.

본 발명의 일 구체예로서, 상기 저산소 조건은 산소분압이 1∼10%인 것을 특징으로 한다.In one embodiment of the present invention, the hypoxic condition is characterized by an oxygen partial pressure of 1 to 10%.

본 발명의 또 다른 구체예로서, 상기 2-데옥시-D-글루코스(2DG)는 배지에 1μM∼10mM의 농도로 포함되어 있는 것을 특징으로 한다.In another embodiment of the present invention, the 2-deoxy-D-glucose (2DG) is contained in the medium at a concentration of 1 μM to 10 mM.

본 발명의 또 다른 구체예로서, 상기 배지는 10% 소태아혈청(FBS) 및 1% 페니실린이 첨가된 DMEM(Dulbecco's modified Eagle's medium) 배지인 것을 특징으로 한다.In another embodiment of the present invention, the medium is a DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin.

본 발명의 또 다른 구체예로서, 상기 줄기세포는 배아줄기세포 또는 성체줄기세포인 것을 특징으로 한다.In another embodiment of the present invention, the stem cells are embryonic stem cells or adult stem cells.

본 발명의 또 다른 구체예로서, 상기 성체줄기세포는 제대, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막 및 태반으로 구성된 군에서 선택되는 1종 이상의 조직으로부터 유래된 중간엽 줄기세포인 것을 특징으로 한다.In another embodiment of the present invention, the adult stem cells are mesenchymal stem cells derived from at least one tissue selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta .

본 발명의 또 다른 구체예로서, 상기 줄기세포능은 Nanog, Oct4 또는 KLF4의 발현이 증가되는 것임을 특징으로 한다.In another embodiment of the present invention, the stem cell function is characterized by an increase in the expression of Nanog, Oct4 or KLF4.

본 발명의 또 다른 구체예로서, 상기 줄기세포능은 세포노화가 억제되고, 세포증식능 및 단백질 항상성이 향상되는 것임을 특징으로 한다.In another embodiment of the present invention, the stem cell function is characterized in that cell senescence is inhibited, and cell proliferation and protein homeostasis are improved.

또한, 본 발명은 상기 배지 조성물에 줄기세포를 배양하는 단계를 포함하는, 줄기세포능 향상방법을 제공한다.In addition, the present invention provides a method for enhancing stem cell function, comprising culturing stem cells in the medium composition.

또한, 본 발명은 상기 방법에 의해 얻어진, 줄기세포능이 향상된 줄기세포를 제공한다.In addition, the present invention provides a stem cell obtained by the above method, wherein the stem cell ability is improved.

본 발명의 일 구체예로서, 상기 줄기세포는 제대, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막 및 태반으로 구성된 군에서 선택되는 1종 이상의 조직으로부터 유래된 중간엽 줄기세포인 것을 특징으로 한다.In one embodiment of the present invention, the stem cell is a mesenchymal stem cell derived from at least one tissue selected from the group consisting of cord, cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta do.

또한, 본 발명은 상기 줄기세포를 포함하는, 허혈 치료용 세포 치료제를 제공한다.In addition, the present invention provides a cell therapy agent for treating ischemia comprising the stem cell.

본 발명의 일 구체예로서, 상기 세포 치료제는 혈관신생능을 향상시키는 것을 특징으로 한다.In one embodiment of the present invention, the cell therapeutic agent is characterized by improving angiogenesis.

또한, 본 발명은 상기 줄기세포를 포함하는, 암 치료용 세포 치료제를 제공한다.In addition, the present invention provides a cell therapy agent for treating cancer, which comprises the stem cell.

또한, 본 발명은 상기 줄기세포에서 분비되는, 허혈성 질환 치료제를 제공한다.The present invention also provides a therapeutic agent for ischemic diseases secreted from the stem cells.

또한, 본 발명은 상기 줄기세포에서 분비되는, 항암 치료제를 제공한다.In addition, the present invention provides an anticancer therapeutic agent secreted from the stem cells.

또한, 본 발명은 상기 줄기세포를 이용한, 암, 허혈성 질환의 치료방법을 제공한다.In addition, the present invention provides a method for treating cancer and ischemic diseases using the stem cells.

또한, 본 발명은 상기 줄기세포의 암, 허혈성 질환의 치료용도를 제공한다.In addition, the present invention provides a therapeutic use of cancer, ischemic diseases of the stem cell.

본 발명에 의하면, 유전자 조작이나 바이러스 벡터 등을 사용하지 않으면서 배양환경 조절이라는 간편하고도 안전한 방법을 통하여, 줄기세포의 대사과정을 리프로그래밍함으로써 차세대 고효율 줄기세포를 대량 생산할 수 있다.According to the present invention, the next generation high-efficiency stem cells can be mass-produced by reprogramming the metabolic process of stem cells through a simple and safe method of controlling the culture environment without using gene manipulation or viral vectors.

또한, 본 발명에 의하면, 줄기세포의 대사 과정을 선택적으로 조절할 수 있는 분자생물학적 기전, 대사조절 마커를 규명함으로써 고효율 줄기세포 개발에 대한 새로운 방법론을 제시할 수 있다.In addition, according to the present invention, a new methodology for the development of high-efficiency stem cells can be presented by identifying the molecular biological mechanism and the metabolic regulation marker capable of selectively regulating the metabolic process of stem cells.

도 1은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 단백질 항상성 유지능에 미치는 영향을 확인한 결과이다.
도 2는, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 줄기세포능에 미치는 영향을 확인한 결과이다.
도 3은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 세포사멸능에 미치는 영향을 확인한 결과이다.
도 4는, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 세포증식능에 미치는 영향을 확인한 결과이다.
도 5는, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 glycolysis에 미치는 영향을 확인한 결과이다.
도 6은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 TCA cycle에 미치는 영향을 확인한 결과이다.
도 7은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 glutaminolysis에 미치는 영향을 확인한 결과이다.
도 8은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 PPP(Pentose Phosphate Pathway)에 미치는 영향을 확인한 결과이다.
도 9는, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 지질대사에 미치는 영향을 확인한 결과이다.
도 10은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리시 angiogenesis 마커인 AAMP, bFGF, EGFR, COX1, KDR, Tie2, VEGF의 발현에 미치는 영향을 확인한 결과이다.
도 11은, 줄기세포에 2-데옥시-D-글루코스(2DG)를 저산소 조건하에서 처리한 후 FACS 분석을 통하여, 줄기세포의 성상에 변화가 없음을 확인한 결과이다.FIG. 1 shows the results of confirming the effect of 2-deoxy-D-glucose (2DG) on the stem cells to maintain the protein homeostasis ability under hypoxic conditions.
Fig. 2 shows the results of confirming the effect of 2-deoxy-D-glucose (2DG) on stem cell performance in the treatment of stem cells under hypoxic conditions.
Fig. 3 shows the results of confirming the effect of 2-deoxy-D-glucose (2DG) on the cell apoptosis in treating stem cells under hypoxic conditions.
FIG. 4 shows the results of confirming the effect of 2-deoxy-D-glucose (2DG) on the cell proliferative activity upon treatment under hypoxic conditions in stem cells.
FIG. 5 shows the results of confirming the effect of 2-deoxy-D-glucose (2DG) on glycolysis in the treatment of stem cells under hypoxic conditions.
Fig. 6 shows the results of examining the effect of 2-deoxy-D-glucose (2DG) on the TCA cycle when the stem cells were treated under hypoxic condition.
FIG. 7 shows the results of confirming the effect of 2-deoxy-D-glucose (2DG) on glutaminolysis in a stem cell under hypoxic conditions.
FIG. 8 shows the results of confirming the effect of 2-deoxy-D-glucose (2DG) on PPP (Pentose Phosphate Pathway) in the treatment of stem cells under hypoxic conditions.
FIG. 9 shows the results of confirming the effect of 2-deoxy-D-glucose (2DG) on lipid metabolism in a stem cell under hypoxic conditions.
10 shows the results of examining the effect of 2-deoxy-D-glucose (2DG) on the expression of angiogenesis markers AAMP, bFGF, EGFR, COX1, KDR, Tie2 and VEGF in a stem cell under hypoxic conditions.
Fig. 11 shows the results of FACS analysis of the stem cells after treatment of 2-deoxy-D-glucose (2DG) under hypoxic conditions, showing no change in the characteristics of the stem cells.

본 발명은, 저산소 조건하의 2-데옥시-D-글루코스(2DG)를 포함하는, 줄기세포능 향상용 배지 조성물을 제공한다.The present invention provides a medium composition for improving stem cell function comprising 2-deoxy-D-glucose (2DG) under hypoxic conditions.

본 발명에서 저산소 조건은 정상 산소조건(normoxia condition)인 20% 산소분압에 비하여 낮은 산소분압을 갖는 것이면 제한이 없으며, 예를 들면 산소 분압이 1∼10%인 것이 바람직하며, 1%인 것이 더욱 바람직하다.In the present invention, the hypoxic condition is not limited as long as it has a lower oxygen partial pressure than the 20% oxygen partial pressure, which is a normoxia condition. For example, the oxygen partial pressure is preferably 1 to 10%, more preferably 1% desirable.

본 발명에서 2-데옥시-D-글루코스(2DG)는 하기의 화학식을 가지며, 글루코스의 2-히드록실기가 수소기로 치환된 화합물이다. 종래, 2DG 화합물은 세포성장을 저해하는 기능으로 인하여 암 치료제로서의 용도가 알려져 있으나, 줄기세포능을 향상시킬 수 있음은 본 발명에서 최초로 밝힌 것이다.In the present invention, 2-deoxy-D-glucose (2DG) has the following chemical formula and is a compound in which the 2-hydroxyl group of glucose is substituted with a hydrogen group. It has been known for the first time that the 2DG compound is known to be useful as a cancer treatment agent due to its ability to inhibit cell growth, but it can improve stem cell function.

[화학식][Chemical Formula]

Figure 112016110427297-pat00001
Figure 112016110427297-pat00001

본 발명에서 배지에 포함되는 2-데옥시-D-글루코스의 농도에 제한은 없으며, 예를 들면 1μM∼10mM의 농도로 포함되는 것이 바람직하며, 200μM인 것이 더욱 바람직하다.In the present invention, the concentration of 2-deoxy-D-glucose contained in the medium is not limited, and is preferably contained in a concentration of, for example, 1 μM to 10 mM, more preferably 200 μM.

본 발명에서는, 종래 정상산소 조건하에서 glycolysis 억제제로 알려진 2DG가, 저산소 조건하에서는 반대로 유전자/단백질 레벨에서 glycolysis를 증가시킴을 확인하였으며, 이는 저산소 환경이라는 조건이 2DG의 역할을 바꾸어 대사과정을 재프로그램화하는 것으로 여겨진다. 즉, 세포는 prooxidants에 의한 세포 손상을 차단하기 위해 항산화 시스템을 갖추고 있는데, 2DG가 이러한 항산화 시스템을 극대화하는 것으로 예상된다.In the present invention, it has been confirmed that 2DG, known as glycolysis inhibitor under normal oxygen conditions, increases glycolysis at the gene / protein level on the contrary under hypoxic conditions, which suggests that the condition of hypoxic environment changes the role of 2DG to reprogram metabolism . In other words, cells have an antioxidant system to block cellular damage by prooxidants, and 2DG is expected to maximize this antioxidant system.

본 발명에서 세포 배양에 이용되는 배지에 제한은 없으며, 예를 들면 10% 소태아혈청(FBS) 및 1% 페니실린이 첨가된 DMEM(Dulbecco's modified Eagle's medium) 배지인 것이 바람직하다.In the present invention, the medium used for cell culture is not limited, and for example, DMEM (Dulbecco's modified Eagle's medium) medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin is preferable.

본 발명에서 '줄기세포'란 미분화된 세포로서 자기 복제 능력을 가지면서 두 개 이상의 서로 다른 종류의 세포로 분화하는 능력을 갖는 세포를 말한다. 본 발명의 줄기세포는 자가 또는 동종 유래 줄기세포일 수 있으며, 인간 및 비인간 포유류를 포함한 임의 유형의 동물 유래일 수 있고, 상기 줄기세포가 성체로부터 유래된 것이든 배아로부터 유래된 것이든 이에 한정되지 않는다.In the present invention, 'stem cell' refers to a cell having the ability to self-replicate as an undifferentiated cell and capable of differentiating into two or more different types of cells. The stem cells of the present invention may be autologous or allogeneic stem cells, and may be derived from any type of animal, including human and non-human mammals, whether stem cells derived from an adult or stem cells derived from an embryo Do not.

본 발명의 줄기세포는 배아 줄기세포 또는 성체 줄기세포를 포함하며, 바람직하게는 성체 줄기세포이다. 상기 성체 줄기세포는 중간엽 줄기세포, 인간 조직 유래 중간엽 기질세포(mesenchymal stromal cell), 인간 조직 유래 중간엽 줄기세포, 다분화능 줄기세포 또는 양막상피세포일 수 있으며, 바람직하게는 중간엽 줄기세포이나, 이에 한정되지 않는다. 상기 중간엽 줄기세포는 제대, 제대혈, 골수, 지방, 근육, 신경, 피부, 양막 및 태반 등으로부터 유래된 중간엽 줄기세포일 수 있으나, 이에 한정되지 않는다. The stem cells of the present invention include embryonic stem cells or adult stem cells, preferably adult stem cells. The adult stem cells may be mesenchymal stem cells, mesenchymal stromal cells derived from human tissues, mesenchymal stem cells derived from human tissues, multipotential stem cells or amniotic epithelial cells, preferably mesenchymal stem cells But is not limited thereto. The mesenchymal stem cells may be mesenchymal stem cells derived from umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane and placenta, but are not limited thereto.

본 발명에서, '태반-유래 줄기세포(placenta-derived stem cells)'라 함은 태반으로부터 분리된 줄기세포를 모두 포함하며, 바람직하게는 체외로 분리된 인간의 태반으로부터 분리된 4종류의 줄기세포, 즉 (1) 양막 상피세포(human amniotic epithelial cells, hAEC), (2) 양막에서 유래한 중간엽 줄기세포(human amniotic mesenchymal stromal cells 또는 human amniotic mesenchymal stem cells, hAMSC), 3) 융모막 중간엽 줄기세포(human chorionic mesenchymal stromal cells 또는 human chorionic mesenchymal stem cells, hCMSC), 및 (4) 융모 영양막 세포(human chorionic trophoblastic cells, hCTC)를 포함한다.In the present invention, the term 'placenta-derived stem cells' includes all of the stem cells isolated from the placenta, preferably four kinds of stem cells isolated from the human placenta isolated from the in vitro (2) amniotic membrane-derived mesenchymal stromal cells or human amniotic mesenchymal stem cells (hAMSCs), (3) chorionic mesenchymal stem cells (hAMSCs), (3) human amniotic epithelial cells Cells (human chorionic mesenchymal stromal cells or human chorionic mesenchymal stem cells, hCMSC), and (4) human chorionic trophoblastic cells (hCTC).

본 발명에서 줄기세포능의 향상이란, 줄기세포 마커인 Nanog, Oct4 또는 KLF4 유전자 등의 발현이 증가됨을 의미하는 것이다. 이들 유전자는 배아줄기세포에서 많이 발현하는 줄기세포의 전분화능, 즉 줄기세포 특성을 유지하는데 중요한 역할을 하는 유전자로 알려져 있다.In the present invention, improvement of stem cell function means that the expression of the stem cell marker Nanog, Oct4 or KLF4 gene is increased. These genes are known to play important roles in maintaining the pluripotency of stem cells, that is, stem cell characteristics, which are expressed in embryonic stem cells.

또한, 본 발명은 상기 배지 조성물에 줄기세포를 배양하는 단계를 포함하는 줄기세포능 향상방법, 및 이에 의해 얻어진 줄기세포능이 향상된 줄기세포를 제공한다.Also, the present invention provides a method for enhancing stem cell function comprising culturing stem cells in the above-mentioned medium composition, and a stem cell enhanced stem cell obtained thereby.

또한, 본 발명은 상기 줄기세포를 포함하는, 허혈성 질환(ischemic disease) 치료용 세포 치료제를 제공한다. 본 발명의 세포 치료제에 의하면 혈관신생 유도 인자들의 발현이 증가된 줄기세포를 유효성분으로 하므로, 혈관신생능(angiogenesis)을 향상시킴으로써 허혈성 질환의 치료에 유용하게 이용될 수 있다.The present invention also provides a cell therapy agent for the treatment of ischemic diseases, which comprises the above stem cells. According to the cell treatment agent of the present invention, stem cells having increased expression of angiogenesis inducers are used as active ingredients, and thus they can be usefully used for the treatment of ischemic diseases by improving angiogenesis.

또한, 본 발명은 상기 줄기세포를 포함하는, 암 치료용 세포 치료제를 제공한다. 저산소 환경에서 2DG를 처리한 줄기세포는, 세포 사멸 인자의 발현이 증가되고, KLF4와 같은 tumor suppressor 인자의 발현이 증가될 뿐만 아니라, TCA cycle 의 증가로 ROS가 증가되는 바, 이를 이용하여 저산소 환경을 만드는 암 질환의 치료에 유용하게 이용될 수 있을 것이다.In addition, the present invention provides a cell therapy agent for treating cancer, which comprises the stem cell. In a hypoxic environment, stem cells treated with 2DG have an increased expression of apoptotic factors, an increase in expression of tumor suppressor factors such as KLF4, and an increase in ROS due to an increase in TCA cycle, Which can be useful for the treatment of cancer diseases.

이하, 본 발명의 이해를 돕기 위하여 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, embodiments are described to help understand the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the examples.

[[ 실시예Example ]]

실시예Example 1: 세포배양 1: Cell culture

인간 태반 유래 중간엽 줄기세포(HUC-MSC) 2×105를 배양접시에 씨딩한 후 저산소 조건(1% 산소분압)하에서 2-deoxy-D-glucose(2DG) 200μM을 처리하여 3일동안 배양하고, 세포를 수집하여 공지의 방법으로 total RNA을 추출하여 이후의 qRT-PCR 실험에 이용하였다.2 × 10 5 of human placenta-derived mesenchymal stem cells (HUC-MSC) were seeded in a culture dish and treated with 200 μM of 2-deoxy-D-glucose (2DG) under hypoxic condition (1% oxygen partial pressure) The cells were collected, and total RNA was extracted by known methods and used for subsequent qRT-PCR experiments.

실시예Example 2: 단백질 항상성  2: protein homeostasis 유지능Maintainability 확인 Confirm

실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 RNA에 HSP90, HSP70, HSP60, HSP40, HSP20, HSF1, EGFR 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다. Total RNA was isolated from the cells collected by the method of Example 1, and gene expression was confirmed by qRT-PCR using the HSP90, HSP70, HSP60, HSP40, HSP20, HSF1 and EGFR primers to the separated RNA Respectively.

그 결과, 도 1에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 정상 산소군(Nor) 및 저산소 2DG 비처리군(Hy)에 비하여 단백질 항상성 유지를 위한 유전자들(HSP90, HSP70, HSP60, HSP40, HSP20, HSF1, EGFR)의 발현이 증가함을 확인하였다. As a result, as shown in Fig. 1, in the group (2DG) treated with 2-deoxy-D-glucose under a hypoxic environment, (HSP90, HSP70, HSP60, HSP40, HSP20, HSF1, and EGFR) were increased.

이러한 결과는, 세포의 불안정 단백질 또는 손상이나 노화로 인해 mis-folding된 단백질들의 파괴 또는 바른 folding 유도로 세포의 안정성이 향상되었음을 의미한다.These results indicate that cell stability is improved by destabilizing or misfolding misfolded proteins due to unstable proteins or damage or aging of cells, and inducing proper folding.

실시예Example 3:  3: 줄기세포능Stem cell ability (( stemnessstemness ) 향상 확인) Confirm improvement

실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 하기의 Nanog, Oct4, Klf4 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다. Total RNA was isolated from the cells collected by cell culture according to the method of Example 1, and gene expression was confirmed by qRT-PCR using the following Nanog, Oct4, and Klf4 primers in the separated total RNA.

　GeneGene Forward PrimerForward Primer Reverse PrimerReverse Primer NANOGNANOG AGTCCCAAAGGCAAACAACCCACTTCAGTCCCAAAGGCAAACAACCCACTTC TGCTGGAGGCTGAGGTATTTCTGTCTCTGCTGGAGGCTGAGGTATTTCTGTCTC OCT4OCT4 CTGGGTTGATCCTCGGACCTCTGGGTTGATCCTCGGACCT CACAGAACTCATACGGCGGGCACAGAACTCATACGGCGGG KLF4KLF4 TCTCAAGGCAGACCTGCGAATCTCAAGGCAGACCTGCGAA TAGTGCCTGGTCAGTTCATCTAGTGCCTGGTCAGTTCATC

그 결과, 도 2에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 Nanog, Oct4, Klf4와 같은 줄기세포능(stemness)을 확인할 수 있는 마커 유전자들의 발현이 높게 증가함을 확인하였으며, 특히 tumor suppressor로 작용하는 KLF4의 발현이 134.5배나 증가함을 확인하였다.As a result, as shown in Fig. 2, in the group treated with 2-deoxy-D-glucose under hypoxic conditions (2DG), stem cells such as Nanog, Oct4 and Klf4 It was confirmed that the expression of the marker genes that can be identified is highly increased and the expression of KLF4, which is a tumor suppressor, is increased by 134.5 times.

실시예Example 4:  4: 세포사멸능Cytotoxicity (( apoptosisapoptosis ) 증가 확인) Increase confirmation

실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 하기의 p53, p21, p16 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다.Total RNA was isolated from the collected cells by cell culture in the method of Example 1, and gene expression was confirmed by qRT-PCR using the following p53, p21 and p16 primers in the separated total RNA.

　GeneGene Forward PrimerForward Primer Reverse PrimerReverse Primer P16P16 TTATTTGAGCTTTGGTTCTGTTATTTGAGCTTTGGTTCTG CCGGCTTTCGTAGTTTTCATCCGGCTTTCGTAGTTTTCAT P21P21 GCCTGGACTGTTTTCTCTCGGCCTGGACTGTTTTCTCTCG ATTCAGATGTGGGAGGAGATTCAGATGTGGGAGGAG P53P53 GGGTTAGTTTACAATCAGCCGGGTTAGTTTACAATCAGCC GGGCCTTGAAGTTAGAGAAAGGGCCTTGAAGTTAGAGAAA

그 결과, 도 3에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 대표적인 아폽토시스(apoptosis) 인자인 p53, p21, p16의 발현이 현저히 증가하여 세포 사멸이 증가함을 확인하였다.As a result, as shown in FIG. 3, expression of p53, p21 and p16, which are typical apoptosis factors, in the group treated with 2-deoxy-D-glucose under hypoxic conditions (2DG) Was significantly increased and cell death was increased.

실시예Example 5:  5: 세포증식능Cell proliferation ability (proliferation) 감소 확인(proliferation) reduction confirmation

인간 태반 유래 중간엽 줄기세포(HUC-MSC) 2×105를 배양접시에 씨딩한 후 저산소 조건(1% 산소분압)과 정산산소 조건(20% 산소분압)하에서 2-deoxy-D-glucose(2DG) 200μM을 처리하여 3일동안 배양하고, 1% Trypsin EDTA를 처리하여 세포수를 확인하였다.2 × 10 5 of human placenta-derived mesenchymal stem cells (HUC-MSC) were seeded in a culture dish and cultured in 2-deoxy-D-glucose (1% oxygen partial pressure) 2DG), cultured for 3 days, and treated with 1% Trypsin EDTA to confirm the number of cells.

그 결과, 도 4에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 증식율이 현저히 감소함을 확인하였다.As a result, as shown in FIG. 4, it was confirmed that the proliferation rate was significantly reduced in the group (2DG) treated with 2-deoxy-D-glucose under the hypoxic environment as compared with the control group (Nor, Hy).

실시예Example 6:  6: 대사능Metabolic ability 향상 확인 Confirm improvement

6-1. 6-1. glycolysisglycolysis

실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 glycolysis 인자인 하기 PGK1, PKM2, MCT4, MCT1 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다.Total RNA was isolated from the collected cells by the method of Example 1, and gene expression was confirmed by qRT-PCR using the following PGK1, PKM2, MCT4 and MCT1 primers, which are glycolysis factors, in the separated total RNA .

GeneGene Forward PrimerForward Primer Reverse PrimerReverse Primer PGK1PGK1 GAAGCGGGTCGTTATGAGGAAGCGGGTCGTTATGAG GCCTTAATCCTCTGGTTGTTGCCTTAATCCTCTGGTTGTT PKM2PKM2 TCGGAGGTTTGATGAAATTCGGAGGTTTGATGAAAT TCTCCAGCATCTGAGTAGTCTCCAGCATCTGAGTAG MCT4MCT4 CGTGGAGCTGCAAACAACTGCGTGGAGCTGCAAACAACTG GCTCTGGCTACCAGGTGAAAGCTCTGGCTACCAGGTGAAA MCT1MCT1 CTTTGCGGCTTCCGTTGTTGCTTTGCGGCTTCCGTTGTTG GGGTCCAACAAGGTCCATCAGGGTCCAACAAGGTCCATCA

PGK1 : phosphoglycerate kinase 1PGK1: phosphoglycerate kinase 1

PKM2 : pyruvate kinase M2PKM2: pyruvate kinase M2

MCT4 : monocarboxylate transporter 4MCT4: monocarboxylate transporter 4

MCT1 : monocarboxylate transporter 1MCT1: monocarboxylate transporter 1

그 결과, 도 5에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 glycolysis에 관여하는 상기 단백질들의 발현이 증가됨을 확인하였다.As a result, as shown in FIG. 5, it was confirmed that the expression of the proteins involved in glycolysis was increased in the group (2DG) treated with 2-deoxy-D-glucose under a hypoxic environment as compared with the control group (Nor, Hy).

6-2. 6-2. TCATCA cycle cycle

실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 하기 PDHA, IDH1, IDH2, IDH3 alpha, MDH, SDHA 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다. Total RNA was isolated from the collected cells by the method of Example 1 and gene expression was quantified by qRT-PCR using the following PDHA, IDH1, IDH2, IDH3 alpha, MDH and SDHA primers in the separated total RNA Respectively.

GeneGene Forward PrimerForward Primer Reverse PrimerReverse Primer PDHAPDHA CAGCAATCTTGCCAGTGTGGCAGCAATCTTGCCAGTGTGG ACTGATTGGCACCACGAACTACTGATTGGCACCACGAACT IDH1IDH1 GTTAGCCCACAGAGCAAAGCTGTTAGCCCACAGAGCAAAGCT GTAGTCAGAACGTTGCACATTGGGTAGTCAGAACGTTGCACATTGG IDH2IDH2 GTGGAGCCATGACCAAGGAGTGGAGCCATGACCAAGGA TGCTCTTGATGGTGTCGAGGTGCTCTTGATGGTGTCGAGG IDH3AIDH3A TGAGTATGCCCGGAACAACCTGAGTATGCCCGGAACAACC AAAGCCCATCTGACATCCGCAAAGCCCATCTGACATCCGC MDHMDH ATCTGCGTCATTGCCAATATCTGCGTCATTGCCAAT GTACACTCCATGCTTCTTGAGTACACTCCATGCTTCTTGA SDHASDHA TCGGAACTGCGACTCAGCATTCGGAACTGCGACTCAGCAT ACCTTCTTGCAACACGCTTCCACCTTCTTGCAACACGCTTCC

PDHA : pyruvate dehydrogenase alpha 1PDHA: pyruvate dehydrogenase alpha 1

IDH1 : isocitrate dehydrogenase 1IDH1: isocitrate dehydrogenase 1

IDH2 : isocitrate dehydrogenase 2IDH2: isocitrate dehydrogenase 2

IDH3α : isocitrate dehydrogenase 3αIDH3α: isocitrate dehydrogenase 3α

MDH : malate dehydrogenaseMDH: malate dehydrogenase

SDHA : succinate dehydrogenase alpha 1SDHA: succinate dehydrogenase alpha 1

그 결과, 도 6에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 TCA cycle에 관여하는 상기 단백질들의 발현이 증가됨을 확인하였다.As a result, as shown in FIG. 6, it was confirmed that the expression of the proteins involved in the TCA cycle was increased in the group (2DG) treated with 2-deoxy-D-glucose under a hypoxic environment compared to the control group (Nor, Hy) .

6-3. 글루타민 분해(6-3. Glutamine degradation ( glutaminolysisglutaminolysis ))

실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 하기 GDH(glutamate dehydrogenase), GLUD1(glutamate dehydrogenase 1), Glutaminase1, Glutamine synthase 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다.Total RNA was isolated from the collected cells by the method of Example 1 and qRT-PCR was performed using the following GDH (glutamate dehydrogenase), GLUD1 (glutamate dehydrogenase 1), Glutaminase 1 and Glutamine synthase primer, And the expression of the gene was confirmed.

Gene　   Gene Forward PrimerForward Primer Reverse PrimerReverse Primer GDHGDH ACAATGAAGCTGGTGTGACCACAATGAAGCTGGTGTGACC AAGACTGCACAGCCAGATGGAAGACTGCACAGCCAGATGG GLUD 1GLUD 1 TGGTGGAACTATTCCCATTGTACCTGGTGGAACTATTCCCATTGTACC CTGTTCTCAGGTCCAATCCCAGCTGTTCTCAGGTCCAATCCCAG Glutaminase1Glutaminase 1 GCTGTGCTCCATTGAAGTGACTGCTGTGCTCCATTGAAGTGACT TTGGGCAGAAACCACCATTAGTTGGGCAGAAACCACCATTAG Glutamine synthaseGlutamine synthase TTGCAAGTCATCCTGCAAAGTTGCAAGTCATCCTGCAAAG TGATCCTAAGCCCATTCCTGTGATCCTAAGCCCATTCCTG

그 결과, 도 7에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 glutaminolysis에 관여하는 상기 단백질들의 발현량이 증가됨을 확인하였다.As a result, as shown in FIG. 7, the expression level of the proteins involved in glutaminolysis was increased in the group (2DG) treated with 2-deoxy-D-glucose under a hypoxic environment as compared with the control group (Nor, Hy).

6-4. PPP (5탄당 6-4. PPP 인산회로Phosphate circuit ))

실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 하기 PHGDH, TKT, TALDO1 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다. Total RNA was isolated from the cells collected by cell culture according to the method of Example 1, and gene expression was confirmed by qRT-PCR using the following PHGDH, TKT and TALDO1 primers to the separated total RNA.

Gene　　    Gene Forward PrimerForward Primer Reverse PrimerReverse Primer PHGDHPHGDH TGTCCTACCAGACTTCACTGGTGTGTCCTACCAGACTTCACTGGTG GAAGGCTTCAGTCACATGCTGGAAGGCTTCAGTCACATGCTG TKTTKT GCTGTGTCCAGTGCAGTAGTGCTGTGTCCAGTGCAGTAGT TTGGTACCCGGTTAACTGCCTTGGTACCCGGTTAACTGCC TALDO1TALDO1 AGACGCAAGGCTCTCCTTTGAGACGCAAGGCTCTCCTTTG ATTCGGTCCTTGCTGATCCCATTCGGTCCTTGCTGATCCC

PHGDH : Phosphoglycerate dehydrogenase PHGDH: Phosphoglycerate dehydrogenase

TKT : TransketolaseTKT: Transketolase

TALDO1 : Transaldolase 1TALDO1: Transaldolase 1

그 결과, 도 8에 나타낸 바와 같이, 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 PPP(Pentose Phosphate Pathway)에 관여하는 상기 단백질들의 발현이 현저히 증가됨을 확인하였다.As a result, as shown in Fig. 8, in the group (2DG) treated with 2-deoxy-D-glucose under a hypoxic environment, the expression of the proteins involved in PPP (Pentose Phosphate Pathway) Respectively.

6-5. 지질 대사6-5. Lipid metabolism

실시예 1의 방법으로 세포 배양하여 수집한 세포에서 total RNA를 분리하고, 분리된 total RNA에 하기 CPT1, FABP1, ACACA, FABP1, FASN, LPL, HMGCR, LCAT 프라이머를 이용하여, qRT-PCR을 통하여 유전자 발현을 확인하였다. Total RNA was isolated from the collected cells by the method of Example 1 and qRT-PCR was performed using the following CPT1, FABP1, ACACA, FABP1, FASN, LPL, HMGCR and LCAT primers Gene expression was confirmed.

Gene　  Gene Forward PrimerForward Primer Reverse PrimerReverse Primer CPT1CPT1 TCTACCATGATGGGCGGCTGCTTCTACCATGATGGGCGGCTGCT CGTCTGGGCTCGTGCGACATTTCGTCTGGGCTCGTGCGACATTT FABP1FABP1 TAGCCCACGTTGCTGGAGGTCCTAGCCCACGTTGCTGGAGGTCC TCTTCTTCTGCATGCCTGCGGATCTTCTTCTGCATGCCTGCGGA ACACAACACA CAAGCCATGTTAAGGCGCTGCAAGCCATGTTAAGGCGCTG CTGCGGATTTGCTTGAGGACCTGCGGATTTGCTTGAGGAC FABP1FABP1 TCTTCTTCTGCATGCCTGCGCCTCTTCTTCTGCATGCCTGCGCC TAGCCCACGTTGCTGGAGGTGATAGCCCACGTTGCTGGAGGTGA FASNFASN GGACAGAGCAACTACGGCTTGGACAGAGCAACTACGGCTT GTGCTCATCGTCTCCACCAAGTGCTCATCGTCTCCACCAA LPLLPL GTGGACTGGCTGTCACGGGCGTGGACTGGCTGTCACGGGC GCCAGCAGCATGGGCTCCAAGCCAGCAGCATGGGCTCCAA HMGCRHMGCR TGAGGGCTCCTTCCGCTCCGTGAGGGCTCCTTCCGCTCCG ACTAGAGGCCACCGAACCCCGACTAGAGGCCACCGAACCCCG LCATLCAT CCCCTGGATGTTTCCCTCTCCCCCTGGATGTTTCCCTCTC AGAAGCGTTGGAAGTCACGGAGAAGCGTTGGAAGTCACGG

CPT1 : Carnitine palmitoyltransferases 1CPT1: Carnitine palmitoyltransferases 1

FABP1 : Fatty acid binding protein 1FABP1: Fatty acid binding protein 1

ACACA : Acetyl-CoA carboxylase alphaACACA: Acetyl-CoA carboxylase alpha

FABP1 : Fatty acid binding protein 1FABP1: Fatty acid binding protein 1

FASN : Fatty acid synthaseFASN: Fatty acid synthase

LPL : Lipoprotein lipaseLPL: Lipoprotein lipase

HMGCR : 3-hydroxy-3-methylglutaryl-CoA reductaseHMGCR: 3-hydroxy-3-methylglutaryl-CoA reductase

LCAT : Lecithin-cholesterol acyltransferaseLCAT: Lecithin-cholesterol acyltransferase

그 결과, 도 9에 나타낸 바와 같이, 저산소 환경하에서 저산소 환경하에서 2-deoxy-D-glucose를 처리한 그룹(2DG)에서는 대조군(Nor, Hy)에 비하여 지질 대사에 관여하는 단백질들의 발현이 현저히 증가됨을 확인하였다.As a result, as shown in FIG. 9, in the group treated with 2-deoxy-D-glucose under hypoxic conditions under hypoxic conditions, the expression of proteins involved in lipid metabolism was significantly increased in the group (2DG) Respectively.

이상의 결과들로부터, 2DG는 정상산소 환경(O2: 20-21%)에서는 알려진 것과 같이 glycolysis를 억제시키나, 저산소 환경(O2: 1%)에서는 glycolysis 증가, stemness 향상, tumor suppression 증가, 단백질 항상성 증가를 유도하며, 전반적인 대사(metabolism) 향상을 유도함을 알 수 있다.These results suggest that 2DG inhibits glycolysis in the normal oxygen environment (O 2 : 20-21%), but in the hypoxic environment (O 2 : 1%), glycolysis increases, stemness improves, tumor suppression increases, , And induce an overall improvement in metabolism.

실시예Example 7:  7: 혈관신생능Angiogenesis (( angiogenesisangiogenesis ) 향상 검증) Enhanced Verification

인간 태반 유래 중간엽 줄기세포(HUC-MSC) 2×105를 배양접시에 씨딩한 후 저산소 조건(1% 산소분압)과 정산산소 조건(20% 산소분압)하에서 2-deoxy-D-glucose(2DG) 200μM을 처리하여 3일동안 배양하고 total RNA를 분리하여, qRT-PCR로 angiogensis 인자들(AAMP, bFGF, EGFR, COX1, KDR, Tie2, VEGF)의 발현변화를 확인하였다. 2 × 10 5 of human placenta-derived mesenchymal stem cells (HUC-MSC) were seeded in a culture dish and cultured in 2-deoxy-D-glucose (1% oxygen partial pressure) (AMP, bFGF, EGFR, COX1, KDR, Tie2, and VEGF) were detected by qRT-PCR.

이때 사용한 프라이머는 다음과 같다.The following primers were used.

　Gene　Gene Forward PrimerForward Primer Reverse PrimerReverse Primer AAMPAAMP CTTAGGCATCAGTGTCAGCACCTTAGGCATCAGTGTCAGCAC CCGGTAGTCAGTAAGCAGGCCCGGTAGTCAGTAAGCAGGC bFGFbFGF CCCTCTCAGAGACCTACGTTCCCCTCTCAGAGACCTACGTTC TCAGCGCCGTTTGAGTCCTCAGCGCCGTTTGAGTCC HGFHGF CTATGATGGCCTATTACGAGTGGCTATGATGGCCTATTACGAGTGG CTCACATGGTCCTGATCCAATCCTCACATGGTCCTGATCCAATC EGFREGFR TGTGCCCACTACATTGACGGTGTGCCCACTACATTGACGG TAGGCCCATTCGTTGGACAGTAGGCCCATTCGTTGGACAG COX1COX1 GCGTTGGAGTTCTACCCTGGAGCGTTGGAGTTCTACCCTGGA GGCAGACCAGCTTCTTCAGTGGGCAGACCAGCTTCTTCAGTG KDRKDR CGGTCAACAAAGTCGGGAGACGGTCAACAAAGTCGGGAGA CAGTGCACCACAAAGACACGCAGTGCACCACAAAGACACG Tie2Tie2 ACCTGCCTGACTGTGCTGTTGACCTGCCTGACTGTGCTGTTG GTTGAACTGCACAGCTGGTTCTGTTGAACTGCACAGCTGGTTCT VEGFVEGF CTACCTCCACCATGCCAAGTGCTACCTCCACCATGCCAAGTG GCGCTGATAGACATCCATGAACGCGCTGATAGACATCCATGAAC

AAMP : Angio-Associated Migratory cell ProteinAAMP: Angio-Associated Migratory cell Protein

bFGF : basic Fibroblast Growth FactorbFGF: basic Fibroblast Growth Factor

EGFR : Epidermal Growth Factor Receptor EGFR: Epidermal Growth Factor Receptor

COX1 : Cyclooxygenase 1COX1: Cyclooxygenase 1

KDR : Kinase Insert domain receptorKDR: Kinase Insert domain receptor

Tie2 : Endothelial specific receptor tyrosine kinase 2Tie2: Endothelial specific receptor tyrosine kinase 2

VEGF : Vascular Endothelial Growth FactorVEGF: Vascular Endothelial Growth Factor

그 결과, 도 10에 나타낸 바와 같이, angiogensis 인자들인 AAMP, bFGF, EGFR, COX1, KDR, Tie2, VEGF의 발현이 증가됨을 확인하였다.As a result, as shown in FIG. 10, the expression of angiogenesis factors AAMP, bFGF, EGFR, COX1, KDR, Tie2, and VEGF was increased.

실시예 8: 줄기세포의 특징 분석Example 8 Characterization of Stem Cells

인간 태반 유래 중간엽 줄기세포(HUC-MSC) 2×105를 배양접시에 씨딩한 후 저산소 조건(1% 산소분압)하에서 2-deoxy-D-glucose(2DG) 200μM을 처리하여 3일동안 배양하고, 세포를 수집하여 줄기세포 positive(+) 마커인 CD105, CD73와 netative(-) 마커인 CD34, CD45를 염색하여 FACS 분석하였다.2 × 10 5 of human placenta-derived mesenchymal stem cells (HUC-MSC) were seeded in a culture dish and treated with 200 μM of 2-deoxy-D-glucose (2DG) under hypoxic condition (1% oxygen partial pressure) The cells were collected and analyzed for FACS by staining for CD105, CD73, which are positive stem cells positive markers, and CD34 and CD45, which are netative (-) markers.

그 결과, 도 11에 나타낸 바와 같이, 2DG를 처리하여도 줄기세포의 성상에 변화가 없음을 학인하였다.As a result, as shown in Fig. 11, it was confirmed that even when 2DG was processed, there was no change in the characteristics of stem cells.

전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해되어야 한다.It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

Claims (16)

2-데옥시-D-글루코스(2DG)를 포함하는, 중간엽줄기세포의 줄기세포성 (stemness) 증진용 배지 조성물로서,
상기 배지 조성물은 산소 분압 1~10% 조건하에서 배양 시 사용되는 것을 특징으로 하는, 배지 조성물.A stem cell growth promoting medium composition comprising 2-deoxy-D-glucose (2DG)
Wherein the culture medium composition is used for culturing under conditions of 1 to 10% oxygen partial pressure. 삭제delete 제 1 항에 있어서, 상기 2-데옥시-D-글루코스는 배지에 1μM∼10mM의 농도로 포함되어 있는 것을 특징으로 하는, 배지 조성물.The medium composition according to claim 1, wherein the 2-deoxy-D-glucose is contained in the medium at a concentration of 1 μM to 10 mM. 제1항에 있어서, 상기 배지는 10중량% 소태아혈청(FBS) 및 1중량% 페니실린이 첨가된 DMEM(Dulbecco's modified Eagle's medium) 배지인 것을 특징으로 하는, 배지 조성물.The culture medium according to claim 1, wherein the culture medium is DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin. 삭제delete 삭제delete 제1항에 있어서, 상기 조성물은 Nanog, Oct4 또는 KLF4의 발현을 증가시키는 것을 특징으로 하는, 배지 조성물.2. The composition of claim 1, wherein the composition increases the expression of Nanog, Oct4 or KLF4. 삭제delete 산소 분압 1~10% 조건에서 2-데옥시-D-글루코스(2DG)를 포함하는 배지 조성물에 세포를 배양하는 단계를 포함하는, 줄기세포성(stemness)이 증진된 중간엽줄기세포 제조 방법.And culturing the cells in a medium composition containing 2-deoxy-D-glucose (2DG) under conditions of oxygen partial pressure of 1 to 10%. 제9항의 방법에 의해 제조된, 줄기세포성(stemness)이 증진된 중간엽줄기세포.A mesenchymal stem cell having enhanced stemness, produced by the method of claim 9. 제10항에 있어서, 상기 중간엽줄기세포는 제대, 제대혈, 골수, 지방, 근육, 피부, 양막 및 태반으로 구성된 군에서 선택되는 1종 이상의 조직으로부터 유래된 것을 특징으로 하는, 중간엽줄기세포.[Claim 11] The mesenchymal stem cell according to claim 10, wherein the mesenchymal stem cell is derived from at least one tissue selected from the group consisting of umbilical cord, umbilical cord blood, bone marrow, fat, muscle, skin, amniotic membrane and placenta. 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete
KR1020160150267A 2016-11-11 2016-11-11 Methods for improving capability of stem cell using 2DG KR102002671B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020160150267A KR102002671B1 (en) 2016-11-11 2016-11-11 Methods for improving capability of stem cell using 2DG
PCT/KR2017/010773 WO2018088693A1 (en) 2016-11-11 2017-09-28 Method for enhancing potency of stem cells by using 2dg

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160150267A KR102002671B1 (en) 2016-11-11 2016-11-11 Methods for improving capability of stem cell using 2DG

Publications (2)

Publication Number Publication Date
KR20180053461A KR20180053461A (en) 2018-05-23
KR102002671B1 true KR102002671B1 (en) 2019-07-23

Family

ID=62109598

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160150267A KR102002671B1 (en) 2016-11-11 2016-11-11 Methods for improving capability of stem cell using 2DG

Country Status (2)

Country Link
KR (1) KR102002671B1 (en)
WO (1) WO2018088693A1 (en)

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210042039A (en) * 2019-10-08 2021-04-16 주식회사 진켐 Compositions for enhancing stemness and uses thereof
US20240108658A1 (en) * 2021-06-23 2024-04-04 Soochow University Synergistic stem cell-based medication for treating myocardial infarction and related application
CN113425731B (en) * 2021-06-23 2022-09-23 苏州大学 Medicine for treating myocardial infarction by synergistic stem cells and application thereof
CN113855650B (en) * 2021-09-23 2022-12-30 苏州大学 Immune metabolism myocardial infarction patch and preparation method and application thereof
CN115521907A (en) * 2022-08-25 2022-12-27 王意忠 Method for culturing mesenchymal stem cells

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013082241A2 (en) 2011-12-02 2013-06-06 Fate Therapeutics, Inc. Improved methods of treating ischemia

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011087299A2 (en) * 2010-01-13 2011-07-21 주식회사 강스템홀딩스 Pharmaceutical composition for the treatment of cancer, containing an extracellular matrix of mesenchymal stem cells derived from umbilical cord blood as an active ingredient
KR20130013435A (en) * 2011-07-28 2013-02-06 차의과학대학교 산학협력단 Process for the proliferation of placenta-derived stem cells

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013082241A2 (en) 2011-12-02 2013-06-06 Fate Therapeutics, Inc. Improved methods of treating ischemia

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Cytotechnology, (전자공개)2014.05.06, 제67권, 1073-1084 페이지
Stem Cells, 2013, 제31권, 2779-2788 페이지

Also Published As

Publication number Publication date
WO2018088693A1 (en) 2018-05-17
KR20180053461A (en) 2018-05-23

Similar Documents

Publication Publication Date Title
KR102002671B1 (en) Methods for improving capability of stem cell using 2DG
Yang et al. Ascorbic acid inhibits senescence in mesenchymal stem cells through ROS and AKT/mTOR signaling
Li et al. Exosomal miR-301 derived from mesenchymal stem cells protects myocardial infarction by inhibiting myocardial autophagy
Choi et al. In situ normoxia enhances survival and proliferation rate of human adipose tissue-derived stromal cells without increasing the risk of tumourigenesis
Ferrer-Lorente et al. Systems biology approach to identify alterations in the stem cell reservoir of subcutaneous adipose tissue in a rat model of diabetes: effects on differentiation potential and function
Cheng et al. High glucose-induced reactive oxygen species generation promotes stemness in human adipose-derived stem cells
Stern-Straeter et al. Evaluation of the effects of different culture media on the myogenic differentiation potential of adipose tissue-or bone marrow-derived human mesenchymal stem cells
Damien et al. Regenerative therapy and immune modulation using umbilical cord blood–derived cells
Choudhery et al. Effect of mild heat stress on the proliferative and differentiative ability of human mesenchymal stromal cells
Shi et al. MiRNA-486 regulates angiogenic activity and survival of mesenchymal stem cells under hypoxia through modulating Akt signal
Safwani et al. Hypoxia enhances the viability, growth and chondrogenic potential of cryopreserved human adipose-derived stem cells
Chen et al. Promotion of the induction of cell pluripotency through metabolic remodeling by thyroid hormone triiodothyronine-activated PI3K/AKT signal pathway
Al-Habib et al. Small molecules affect human dental pulp stem cell properties via multiple signaling pathways
Søndergaard et al. Senescence and quiescence in adipose-derived stromal cells: effects of human platelet lysate, fetal bovine serum and hypoxia
Andreeva et al. Recombinant HSP70 and mild heat shock stimulate growth of aged mesenchymal stem cells
Yin et al. Genetically modified human placenta‑derived mesenchymal stem cells with FGF‑2 and PDGF‑BB enhance neovascularization in a model of hindlimb ischemia
Fan et al. Oct4 and Sox2 overexpression improves the proliferation and differentiation of bone mesenchymal stem cells in Xiaomeishan porcine
Chen et al. Co-expression of Akt1 and Wnt11 promotes the proliferation and cardiac differentiation of mesenchymal stem cells and attenuates hypoxia/reoxygenation-induced cardiomyocyte apoptosis
MenTara et al. p21cιp/WAF is a key regulator of long‐term radiation damage in mesenchyme‐derived tissues
Zeng et al. DLX2 activates Wnt1 transcription and mediates Wnt/β-catenin signal to promote osteogenic differentiation of hBMSCs
JP2022020814A (en) Agents for maintaining and activating stem cell properties as well as external preparations for skin and cosmetics containing the same
Musorina et al. Characterization of a nonimmortalized mesenchymal stem cell line isolated from human epicardial adipose tissue
KR20120002134A (en) Method for dedifferentiations of adipose tissue stromal cells
Yadav et al. Buffalo (Bubalus bubalis) fetal skin derived fibroblast cells exhibit characteristics of stem cells
Han et al. Effect of ectopic OCT4 expression on canine adipose tissue‐derived mesenchymal stem cell proliferation

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant