KR101993510B1 - Composition comprising Geranic acid or as active ingredients for Preventing or treating muscle disease - Google Patents

Abstract

The present invention relates to a composition for preventing or treating muscle disorders or improving muscle function comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

Description

TECHNICAL FIELD The present invention relates to a composition for preventing or treating muscular diseases comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention relates to a composition for preventing or treating muscle diseases, which comprises geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

In Korea, the elderly population accounted for 7.2% of the total population in 2000 and entered the aging society. By 2050, it is expected to enter the aging society (more than 20%). The muscle mass of a person decreases with age (10-15% at 50-70 years of age, and 30% at 70-80 years of age), resulting in a weakening of muscle strength and myofunction. This is followed by sarcopenia, Quot; Elderly myopenia leads to dysfunctional and gait disturbances and is a major cause of restricting the independent life of the elderly. In addition, myopenia reduces basal metabolic rate, increases insulin resistance, promotes the development of type 2 diabetes, and increases the risk of hypertension and cardiovascular disease by 3-5 times. Currently, there are no approved drugs for the treatment of myopinia. Drug repositioning techniques are being developed to apply myostatin inhibitors or other existing FDA-approved drugs to myopenia.

Muscles are divided into skeletal muscle, cardiac muscle, and visceral muscle, of which skeletal muscle is the most abundant in the human body, accounting for 40-45% of body weight. The skeletal muscle attaches to the bone through the tendon and acts to create movement or force of the bone. One muscle is made up of a number of muscle fibers, and the muscle fibers are made of numerous myofibers composed of actin and myosin. When actin and myosin overlap each other, muscle length is shortened or lengthened, causing overall muscle contraction and relaxation. An increase in myofibrillar size means an increase in muscle fiber thickness, resulting in an increase in muscle mass.

The types of muscle fibers constituting the muscles are mainly classified into Type I, Type IIA and Type IIB depending on the metabolic process that causes ATP and the rate of contraction. Type I muscle fiber is slow and has a large number of myoglobin and mitochondria and is suitable for sustained and low intensity aerobic activity. Type I muscle fibers are reddish, so they are also called red muscles, and the soleus is a typical example. On the other hand, 'Type IIB muscle fiber' has a very short contraction rate and is very short, but it is used for high intensity anaerobic exercise and has a low content of myoglobin and a white color. 'Type IIA muscle fiber' has the intermediate characteristics of the two muscle fibers mentioned above. As the age increases, not only does the composition of Type I and II muscle fibers vary, but also all types of muscle fibers decrease.

The skeletal muscle has characteristics that are regenerated and maintained according to the environment, but these characteristics disappear with aging, and as a result, as the aging progresses, the muscular volume decreases and the muscular strength is also lost. The signaling pathway involved in muscle growth and regeneration is signaling to regulate protein synthesis mediated by insulin like growth factor 1 (IGF-1) / AKT. Activation of IGF-1 receptor (IGF-1R) in muscle cell membranes increases AKT phosphorylation through IRS1 and PI3K phosphorylation and activates mTORC phosphorylation. Activation of mTORC increases phosphorylation of ribosomal protein S6 kinase beta-1 (p70S6K1), thereby increasing mRNA translation, increasing eukaryotic translation initiation factor 4 (eIF4G) activity, and inducing eukaryotic translation initiation factor 4E binding protein 1 < / RTI > (4E-BP1) protein. eIF4G and 4E-BP1 are involved in the formation of an eIF4F complex, that is, eIF4G binds eIF4A and eIF4E to form an eIF4F complex, while 4E-BP1 is phosphorylated to inhibit eIF4E binding and increase free eIF4E . The latter combines with other translation initiation factors (eIF4G and eIF4A) to form an eIF4F complex and the resulting eIF4F complex stabilizes the ribosome structure, facilitating translation initiation, ultimately increasing protein synthesis (Bodine et al., Akt / mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo, Nature cell biology, 3, 1014-1019, 2001).

In addition, AKT phosphorylation enhances eIF2B expression through glycogen synthase kinase 3 (GSK3), which promotes muscle fiber growth and suppresses muscle loss by suppressing expression of forkhead box O (FOXO), a proteolytic transcription factor. Muscle relaxation is regulated by signaling mediated by TGF-β family receptors including myostatin, transforming growth factor beta (TGF-β), and activin. The binding of the ligand to the TGF-β type II receptor phosphorylates the type I receptor, while the latter phosphorylates the smad 2/3 complex and ultimately activates FOXO. The latter increases the gene expression of muscle-specific ubiquitin-ligase, muscle RING-finger protein-1 (MURF1), Muscle Atrophy F-Box (MAFbx) / atrogin-1, which attaches ubiquitin to the lysine site of the target protein Promotes protein degradation, and ultimately leads to muscle loss. (Gumucio et al., Atrogin-1, MuRF-1, and sarcopenia, Endocrine, 43, 12-21, 2013).

Therefore, the present inventors have conducted research to develop a food material which is effective for enhancing muscles and muscle loss by inhibiting the degradation of muscle proteins and promoting their synthesis in natural products with low side effects.

The present invention is intended to provide a pharmaceutical composition for preventing or treating muscle diseases comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

The present invention provides a pharmaceutical composition for preventing or treating muscle diseases comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The composition may increase the expression of p-4E-BP1 or p-p70S6K1 protein.

The composition may reduce the expression of MuRF1 (Muscle Ring-Finger Protein) or MaFbx (Muscle atrophy F-box).

The muscle disorder may be a muscle disorder caused by muscle weakness, muscle weakness, muscle wasting or muscle regression.

The muscular diseases include atony, muscular atrophy, muscular dystrophy, myasthenia gravis, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis, amyotrophic lateral sclerosis, , Rigid spinsesyndrome, Charcot-Marie-Tooth disease, and sarcopenia. ≪ RTI ID = 0.0 >

The present invention provides a pharmaceutical composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention provides a health functional food composition for improving muscle function comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention provides a health functional food composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention provides a composition for preventing or treating muscle diseases, which comprises geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention provides a composition for promoting muscle differentiation, muscle regeneration or muscle strengthening for animal feed comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention provides a cosmetic composition for improving muscle function comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention relates to a composition for the prevention or treatment of muscular diseases or a composition for improving muscle function comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient, wherein the geranic acid is used for muscle protein synthesis And the expression of the protein associated with an increase in muscle mass can be increased and the expression of the enzyme involved in the muscle protein degradation can be suppressed from the level of the mRNA. Therefore, muscle fatigue, muscle regeneration in muscular disease caused by muscle weakness or muscle regeneration, , Muscle strength can be increased by increasing the muscle strength and can be used for preventing or treating muscle diseases, muscle differentiation, muscle regeneration, increasing muscle mass, or improving muscle function.

Fig. 1 shows changes in the thickness of myotubes in mouse myoblasts. (A) is the visualization of gyemsa-wright stained canaliculus by microscopic observation, (B) is the result of measuring the diameter of canaliculus cells, and each value is the mean of standard deviation of three determinations in three independent wells to be. P <0.05 indicates statistical significance
Fig. 2 shows changes in expression of molecules involved in proteolysis and synthesis in mouse muscle myoblasts treated with geranic acid. (A) shows the protein levels of p-4E-BP1, Total 4E-BP1, p-p70S6K1 and Total p70S6K1, and (B) shows the gene expression levels of MaFbx and MuRF1. Each value is the mean ± standard error of three determinations in three independent wells. P <0.05 indicates statistical significance.

The inventors of the present invention have completed the present invention by confirming that geranic acid, a monoterpene compound, inhibits the degradation of muscle proteins and promotes the synthesis, thereby improving muscle strength and muscle loss.

In the present invention, "muscle" refers to the tendons, muscles, and tendons comprehensively, and "muscular function" refers to the ability to exert its force by contraction of muscles. In order to overcome resistance, Muscular endurance which is the ability to indicate how long or how many times the muscle can repeat contraction and relaxation on a given weight, and ability to exert a strong force in a short period of time. These muscle functions are hosted by the liver, proportional to muscle mass, and "muscle function improvement" means better improvement of muscle function.

Hereinafter, the present invention will be described in detail.

Pharmaceutical compositions for preventing or treating muscle disorders

The present invention provides a pharmaceutical composition for preventing or treating muscle diseases comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

Specifically, the geranic acid is a monoterpene-based compound which is colorless or light yellowish-yellow oil-based liquid, which is not dissolved in water but dissolved in alcohol or propylene glycol, and industrially used for taste and aroma , the structural formula is C ₁₀ H ₁₆ O _2, molecular weight 168 g / mol. (2E) -3,7-Dimethyl-2,6-octadienoic acid [(2E) -3,7-dimethyl-2,6-octadienoic acid] And has a stereoisomer of nerolic acid.

[Chemical Formula 1]

Also, it may contain geranic acid hydrate, geranic acid derivative and the like within the range having the same effect as geranic acid, and may also include a solvent compound or a stereoisomer thereof.

The method for obtaining geranic acid is not particularly limited, and may be separated from plants containing geranic acid, chemically synthesized using known production methods, or commercially available.

The composition according to the present invention can increase the expression of p-4E-BP1 or p-p70S6K1 protein.

In addition, the composition according to the present invention can reduce the expression of MuRF1 (Muscle Ring-Finger Protein) or MaFbx (Muscle atrophy F-box). Specifically, p70S6K1, 4E-BP1, and eIF members are representative molecules involved in protein synthesis, and these three molecules are regulated by higher mTORCs. Activation of mTORc phosphorylates p70S6K1 and activated p70S6K1 phosphorylates the 40S ribosomal protein S6 to increase mRNA translation. Activation of mTORC also increases the activity of eIF4G and phosphorylates 4E-BP1, both of which are involved in the formation of the eIF4F complex. In other words, eIF4G binds eIF4A and eIF4E to form an eIF4F complex, while 4E-BP1 is phosphorylated, which inhibits binding to eIF4E and increases free eIF4E. The latter combines with other translation initiation factors (eIF4G and eIF4A) to form the eIF4F complex, which stabilizes the ribosome structure, thereby facilitating translation initiation and ultimately increasing protein synthesis. MAFbx / Atrogin-1 and MuRF1 are muscle-specific ubiquitin-ligase, which is a typical protein that attaches ubiquitin to the lysine site of the target protein to promote protein degradation and induce muscle loss. The composition of the present invention is MuRF1 Ring-Finger Protein) or MaFbx (Muscle atrophy F-box), thereby reducing muscle loss.

In the present invention, the term " muscle disorder "is a disease reported in the art as a muscle disorder caused by muscle weakness, muscle loss, muscle wasting or muscle degeneration. Specifically, the muscle disorder is atony, The present invention relates to a method for the treatment of muscular atrophy, muscular dystrophy, myasthenia, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis, rigid spinsesyndrome, But is not limited to, at least one selected from the group consisting of Charcot-Marie-Tooth disease and sarcopenia. In addition, the muscle wasting or degeneration is caused by total factors, acquired factors, aging, etc., and muscle wasting is characterized by gradual loss of muscle mass, weakness and degeneration of muscles, particularly skeletal muscle or veterinary muscle and heart muscle.

The content of geranic acid is preferably in the range of 0.1 μM to 1000 μM, but is not limited thereto. When the concentration of geranic acid is less than the above range, there is a problem that the protein synthesis and degradation activity is decreased in muscle cells, and it is difficult to exert muscular disease prevention or therapeutic effect. When geranic acid exceeds the above concentration range, There may be concerns about toxicity, including

The pharmaceutical composition for preventing or treating muscle diseases according to the present invention may be in the form of oral, granule, tablet, capsule, suspension, emulsion, syrup, aerosol or other oral preparation, external preparation, And may contain suitable carriers, excipients or diluents conventionally used in the manufacture of pharmaceutical compositions for formulation.

The carrier or the excipient or diluent includes lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like.

In the case of formulation, a diluent or excipient such as a commonly used filler, a weight agent, a binder, a wetting agent, a disintegrant or a surfactant may be used.

Solid preparations for oral administration can be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. in geranic acid. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

Examples of the liquid preparation for oral administration include suspensions, solutions, emulsions, syrups and the like. In addition to water and liquid paraffin which are commonly used diluents, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous agents, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. As a base for suppositories, witepsol, macrogol, tween 61, cacao paper, laurin, glycerol gelatin and the like can be used.

The preferred dosage of the pharmaceutical composition for preventing or treating muscle disorders according to the present invention varies depending on the condition of the patient, the body weight, the degree of the disease, the drug form, the administration route and the period, but can be appropriately selected by those skilled in the art. However, for a desired effect, the dose may be 0.0001 to 2,000 mg / kg, preferably 0.001 to 2,000 mg / kg per day. The administration may be carried out once a day or divided into several doses. However, the scope of the present invention is not limited by the dosage.

The pharmaceutical composition for preventing or treating muscle disorders according to the present invention can be administered to mammals such as rats, mice, livestock, and humans in various routes. All modes of administration can be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intra-uterine or intracerebroventricular injections.

A pharmaceutical composition for promoting muscle differentiation, muscle regeneration or muscle strengthening

There is provided a pharmaceutical composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient. The specific contents of geranic acid are as described above.

Muscle growth can be caused by an increase in fiber size and / or an increase in fiber number. The muscle growth can be measured by A) an increase in wet weight, B) an increase in protein content, C) an increase in the number of myofibers, and D) an increase in myofiber diameter. The increase in muscle fiber growth can be defined as the increase in diameter when the diameter is defined as the short axis of the section ellipsoid. A useful therapeutic agent is one that is at least 10% more muscle-degenerated than the previously similarly treated control animal (i. E., An animal having degenerated muscle tissue not treated with a muscle growth compound) The diameter is increased by 10% or more, more preferably by 50% or more, and most preferably by 100% or more. Compounds that increase growth by increasing the number of muscle fibers are useful as therapeutic agents when it increases the number of muscle fibers in the diseased tissue by at least 1%, more preferably by at least 20%, and most preferably by at least 50%. These percent values are determined relative to baseline levels in untreated, non-diseased, comparable mammals, or in non-adulterated muscles, when the compound is administered and locally acting.

Muscle regeneration is the process by which new muscle fibers are formed from myoblasts. Useful therapeutic agents for regeneration increase the number of new fibers by at least about 1%, more preferably at least 20%, and most preferably at least 50%, as described above.

Differentiation of muscle cells implies induction of a muscle developmental program that specifies the components of muscle fibers, such as contractile organs (myopirbil). A useful therapeutic agent for differentiation is an amount of at least about 10%, more preferably at least 50%, and most preferably at least 100%, of the amount of all muscle fiber components in the diseased tissue, as compared to an equivalent tissue in a similarly treated control animal .

In particular, according to one embodiment of the present invention, when myoxia reduced by dexamethasone was treated with geranic acid, myotubes of the mouse myoblasts were significantly increased. In other words, the geranic acid of the present invention increases the thickness of myotube in mouse myoblasts, thereby suppressing muscle loss and promoting muscle growth.

In addition, when geranic acid was treated with dexamethasone-reduced mouse myoblasts, not only the expression of p-4E-BP1 and p-p70S6K proteins related to protein synthesis was significantly increased, but also the protein Mu] M and Mafbx / atrogin [beta]. That is, geranic acid of the present invention can increase the amount of muscle by increasing the phosphorylation of 4E-BP1 and p70S6K proteins in mouse myoblasts and inhibiting MuRF1 and Mafbx / atrogin1 gene expression.

Health functional food composition for improving muscle function

The present invention provides a health functional food composition for improving muscle function comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient. The specific contents of geranic acid are as described above.

In the health functional food for improving muscle function according to the present invention, when geranic acid is used as an additive for a health functional food, it can be added as it is or used together with other food or food ingredients, . The amount of the active ingredient to be mixed may be suitably determined according to each use purpose such as prevention, health, or treatment.

Formulations of health functional foods may be in the form of powders, granules, pills, tablets, capsules, as well as in the form of ordinary foods or beverages.

There is no particular limitation on the type of the food, and examples of the food to which the above substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, , Various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and may include foods in a conventional sense.

Generally, the geranic acid may be added in an amount of not more than 15 parts by weight, preferably not more than 10 parts by weight, based on 100 parts by weight of the raw material. However, in the case of long-term consumption intended for health and hygiene purposes or for health control purposes, the amount may be less than the above range. Further, since the present invention uses fractions from natural products, there is no problem in terms of safety, Or more.

The beverage in the health functional food according to the present invention may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. The above-mentioned natural carbohydrates may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. Examples of sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.

In addition to the above, the functional food for improving muscle function according to the present invention may contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloid thickening agents, , Preservatives, glycerin, alcohols, and carbonated beverages. In addition, the composition for improving sleep of the present invention may contain flesh for the production of natural fruit juice, fruit juice drink and vegetable drink. These components may be used independently or in combination. The ratio of such additives is not limited, but is generally selected in the range of 0.01 to 0.1 parts by weight based on 100 parts by weight of the health functional food of the present invention.

Health functional food composition for promoting muscle differentiation, muscle regeneration or muscle strengthening

There is provided a health functional food composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient. The specific contents of geranic acid are as described above.

Composition for livestock feed for prevention or treatment of muscle diseases

There is provided a composition for animal feed for preventing or treating muscle diseases comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient. The specific contents of geranic acid are as described above.

The livestock is preferably one species selected from the group consisting of cattle, pigs, chickens, ducks, goats, sheep and horses, but is not limited thereto.

The feed composition may include a feed additive. The feed additive of the present invention corresponds to an auxiliary feed in the feed control method.

The term "feed" as used herein in the context of the present invention may mean any natural or artificial diet, single meal, or the like ingredients for feeding, ingesting, digesting or suitable for the animal.

The kind of the feed is not particularly limited, and feeds conventionally used in the art can be used. Non-limiting examples of such feeds include vegetable feeds such as cereals, muscle roots, food processing busines logistics, algae, fibers, pharmaceutical buses, oils, fats, pastes or grain by-products; Animal feeds such as proteins, inorganic substances, fats, oils, fats, oils, monocellular proteins, animal plankton or foods. These may be used alone or in combination of two or more.

The feed additive may additionally contain a carrier that is acceptable to the unit animal. In the present invention, the feed additive may be added as it is or a known carrier, stabilizer and the like may be added. Various nutrients such as vitamins, amino acids and minerals, antioxidants and other additives may be added as needed, Powders, granules, pellets, suspensions, and the like. When the feed additive of the present invention is supplied, it can be supplied to the unit animal singly or mixed with the feed.

Composition for livestock feed for promoting muscle differentiation, muscle regeneration or muscle strengthening

There is provided a composition for promoting muscle differentiation, muscle regeneration or muscle strengthening for animal feed comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient. The specific contents of geranic acid are as described above.

For improving muscular function Cosmetics  Composition

The present invention provides a cosmetic composition for improving muscle function comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient. The specific contents of geranic acid are as described above.

The cosmetic composition of the present invention contains geranic acid as an active ingredient and together with dermatologically acceptable excipients, basic cosmetic composition (cleanser, pack, body oil such as lotion, cream, essence, cleansing foam and cleansing water) (Such as foundation, lipstick, mascara, make-up base), hair product composition (shampoo, rinse, hair conditioner, hair gel) and soap.

Such excipients include, but are not limited to, emollients, skin penetration enhancers, colorants, perfumes, emulsifiers, thickeners and solvents. In addition, it may further contain flavors, pigments, bactericides, antioxidants, preservatives, moisturizers and the like, and may include thickeners, inorganic salts and synthetic polymeric substances for the purpose of improving physical properties. For example, when a cleanser and a soap are prepared using the cosmetic composition of the present invention, geranic acid can be easily added to a common cleanser and soap base. In the case of producing a cream, it can be prepared by adding geranic acid or a salt thereof to a cream base of a typical underwater type (O / W). A synthetic or natural material such as a flavor, a chelating agent, a coloring matter, an antioxidant, an antiseptic, and a protein, a mineral, and a vitamin for the purpose of improving a physical property may be further added. The content of geranic acid contained in the cosmetic composition of the present invention is not limited thereto, but is preferably 0.001 to 10% by weight, more preferably 0.01 to 5% by weight based on the total weight of the whole composition. If the content is less than 0.001% by weight, the desired anti-aging or wrinkle-reducing effect can not be expected. If the content is more than 10% by weight, safety or formability may be difficult.

As described above, the composition comprising the geranic acid of the present invention or a pharmaceutically acceptable salt thereof as an active ingredient increases the phosphorylation of 4E-BP1 and p70S6K1 protein in myobacterium and inhibits MuRF1 and MaFbx / atroginl gene expression In muscular diseases caused by lowering of myocardial function, muscle wasting or muscle regeneration, muscle differentiation, muscle regeneration, and muscle mass increase can be shown to enhance the muscle strength, and muscle relaxation can be suppressed. , For muscle regeneration and for increasing muscle mass, or for improving muscle function.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Example ]

Preparation Example . Cell culture

The mouse myoblast cell line (C2C12 cell) was purchased from ATCC (Manassas, Va., USA). The cells were cultured in 10% fetal bovine serum (Gibco-BRL) ₂ incubator. When the cultured cells became 80% confluent, they were differentiated into myotubes using 2% horse serum media (Gibco-BRL).

Example  One.

50 μM of dexamethasone (dexa; Sigma) and 100 μM of geranic acid (CAS Number 459-80-3, Sigma) were treated together for two days from the fourth day of differentiation.

Comparative Example  One.

100 μM of geranic acid (CAS Number 459-80-3, Sigma) was treated in the same manner as in Example 1 above.

Experimental Example  1. Mouse Myoblasts  Used Geranic Muscle loss suppression  efficacy

(One) Giemsa -wright staining

Myotube according to Example 1 was washed twice with phosphate buffered saline (PBS) and fixed with 100% methanol for 10 minutes. After completion of the fixation, the plate was allowed to stand for 10 minutes at room temperature, and Giemsa-wright staining solution (Asan Pharm, Seoul) was stained for 30 minutes.

(2) Myotube  Thickness measurement

The myotubes stained in Experimental Example 1 were photographed at an X20 magnification using a fluorescence microscope (IX 71, Olympus) and analyzed using image J software (USA). Six sections were randomly selected in each well and examined microscopically. At least 100 myotube thicknesses were analyzed from each well (3 replicates / Group).

1 is a graph showing changes in the thickness of myotubes in mouse myoblasts.

As shown in FIG. 1A, in the case of Comparative Example 1, the thickness of myotubes was significantly reduced compared to that of normal cells. In Example 1 treated with geranic acid, dexamethasone reduced myotube thickness again It can be confirmed visually. In addition, as shown in FIG. 1B, it was confirmed by numerical value using image J software that Example 1 in which geranic acid was treated showed a 62% significant increase in myotube thickness reduced by dexamethasone. In other words, geranic acid increases myotube thickness in mouse myoblasts, suppressing muscle loss, and promoting muscle growth.

Experimental Example  2. Identification of mechanism

(One) Trizol  RNA isolation and RT- PCR  (reverse transcription-polymerase chain reaction)

334 μl of Trizol solution was added per 1 × 10 ⁷ cells of mouse myoblast, and the mixture was centrifuged at 12,000 × g for 10 minutes at 4 ° C. The supernatant was transferred to a new tube, and 67 μl of chloroform was added and vortexed. The supernatant was again transferred to a new tube and isopropanol was added so that the ratio of the supernatant and isopropanol was 1: 1. The mixture was centrifuged at 12,000 × g for 10 minutes at 4 ° C., and the supernatant was removed. To the remaining precipitate was added 1 ml of 70% ethanol and the mixture was centrifuged at 7,500 × g at 4 ° C. And centrifuged for 5 minutes. After removing the ethanol, the tube containing the RNA precipitate was dried at room temperature for 15 minutes, and the RNA pellet was dissolved using nuclease free water. The concentration of RNA extracted at 260 nm and 280 nm wavelength was measured using a UV / VIS spectrophotometer (Beckman coulter, DU730) and agarose gel electrophoresis was performed to confirm the integrity of the RNA sample.

CDNA was synthesized by reverse transcription using oligo dT primer and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA) for RNA samples from mouse myoblast. PCR was carried out using 5 'and 3' flanking sequences of the cDNA to be amplified as a template, using the cDNA obtained from the reverse transcription as a template. The primer sequences used at this time are shown in Table 1 below. 1 μl of the amplified PCR product was electrophoresed on 1% agarose gel to confirm the DNA band.

Gene description Primers Sequences (5 '- &gt; 3') Annealing
온도
(° C) PCR
product
(bp) MaFbx
(synonym: atrogin-1) F GTCCAGAGAGAGGGCAAGTC 63 141 R GTCGGTGATCGTGAGACCTT MuRF1
(synonym: TRAM63) F CTGAGCTGAGTAACTGCATC 60 147 R AGAGGGTGTCAAACTTCTGA Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) F GTGATGGCATGGACTGTGGT 55 163 R GGAGCCAAAAGGGTCATCAT

(2) Western blotting

To perform western blotting, 500 μL of 100 mM Tris-HCl, pH 7.4, 5 mM EDTA, 50 mM sodium pyrophosphate, 50 mM NaF, 100 mM orthovanadate, 1% Triton X-100, Lysis buffer containing 1 mM phenylmethanesulfonyl fluoride, 2 μg / mL aprotinin, 1 μg / mL pepstatin A, and 1 μg / mL leupeptin was harvested and centrifuged at 1,300 × g at 4 ° C. for 20 min. The layers were taken and proteins were quantified according to the Bradford method (Bio-Rad). 40 ㎍ of protein was electrophoresed on SDS polyacrylamide gel and transferred to nitrocellulose membranes (Amersham, Buckinghamshire, UK). The membranes were washed three times for 10 minutes using tris-buffered saline and tween 20 solution (TBS-T), and then blocked for 60 minutes with 10% skim milk. Membranes were added to the primary antibody diluted at a ratio of 1: 1,000, and the cells were washed with TBS-T for 12 hours at 4 ° C. The membranes were again diluted 1: 2,000 with secondary antibody For 60 min and washed. The primary antibodies were p70S6K1, phopho-p70S6K1 (p-p70S6K1), 4E-BP1, phospho-4E-BP1 (p-4E-BP1) and GAPDH (Cell Signaling Technology, Beverly, MA, USA) . Finally, proteins were visualized on X-ray film using an ECL Western blot detection kit (RPN2106, Amersham, Arlington Heights, IL, USA). Visualized bands were scanned on X-ray film and quantified using Quantity One analysis software (Bio-Rad).

2 is a graph showing changes in expression of molecules involved in proteolytic and synthetic processes in mouse muscle myoblasts treated with geranic acid.

As shown in FIG. 2, in Comparative Example 1, the amount of p-4E-BP1 and p-p70S6K1 protein, which are involved in protein synthesis, was significantly decreased compared to that of normal cells (FIG. 2A) The expression of the genes MaFbx / atroginl and MuRF1 was significantly increased (Fig. 2B). In Example 1 treated with geranic acid, the amount of p-4E-BP1 and p-p70S6K proteins reduced by dexamethasone was again significantly increased (Fig. 2A), and the expression of MuRF1 and MaFbx / atrogin1 was significantly decreased (Fig. 2B). In other words, geranic acid might have been involved in increasing the amount of muscle ultimately by increasing the phosphorylation of 4E-BP1 and p70S6K1 protein in murine myoblasts and inhibiting MuRF1 and MaFbx / atrogin1 gene expression.

Hereinafter, formulation examples of the composition containing the extract of the present invention will be described, but the present invention is not intended to be limited thereto but is specifically described.

Formulation Example 1: Preparation of powder

20 mg of geranic acid

100 mg of lactose hydrate

10 mg of talc

The above ingredients were mixed and filled in an airtight container to prepare powders.

Formulation Example 2: Preparation of tablets

10 mg of geranic acid

Corn starch 100 mg

100 mg of lactose hydrate

Magnesium stearate 2 mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

Formulation Example 3: Preparation of capsules

10 mg of geranic acid

3 mg of microcrystalline cellulose

Lactose hydrate 14.8 mg

Magnesium stearate 0.2 mg

After mixing the above components, the capsules were filled in gelatin capsules in accordance with the usual methods for preparing capsules.

Formulation Example 4: Preparation of injection

10 mg of geranic acid

180 mg mannitol

2974 mg of sterile distilled water for injection

26 mg of sodium hydrogen phosphate

After the above components were mixed, they were prepared with the above ingredient contents per 1 ampoule (2 mL) according to the usual injection preparation method.

Formulation Example 5: Preparation of a liquid preparation

10 mg of geranic acid

10 mg of isomerized sugar

5 mg mannitol

Purified water quantity

Lemon incense quantity

The components are dissolved in purified water according to the usual preparation method, and the lemon flavor is added in an appropriate amount. Then, purified water is added to adjust the total volume to 100 mL, sterilized and filled in a brown bottle to prepare a liquid preparation.

Formulation Example 6: Preparation of Health Functional Foods

10 mg of geranic acid

Vitamin mixture quantity

Vitamin A Acetate 70 ㎍

Vitamin E 1.0 mg

0.13 mg of vitamin B ₁

0.15 mg of vitamin B ₂

0.5 mg of vitamin B ₆

Vitamin B ₁₂ 0.2 g

10 mg vitamin C

Biotin 10 μg

Nicotinic acid amide 1.7 mg

50 ㎍ of folic acid

Calcium pantothenate 0.5 mg

Mineral mixture quantity

1.75 mg of ferrous sulfate

0.82 mg of zinc oxide

Magnesium carbonate 25.3 mg

15 mg of potassium phosphate monobasic

Secondary calcium phosphate 55 mg

Potassium citrate 30 mg

100 mg of calcium carbonate

24.8 mg of magnesium chloride

Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a composition suitable for health food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional method for producing healthy foods , Granules can be prepared and used in the manufacture of health food compositions according to conventional methods.

Formulation Example 7: Preparation of health drinks

Geranic acid 10 mg

Vitamin C 15 g

Vitamin E (powder) 100 g

19.75 g of ferrous lactate

3.5 g of zinc oxide

Nicotinic acid amide 3.5 g

Vitamin A 0.2 g

Vitamin B ₁ 0.25 g

0.3 g of vitamin B ₂

Purified water quantitation

The above components were mixed according to a conventional health drink manufacturing method, and the mixture was heated for about 1 hour at 85 DEG C with stirring, and the solution thus prepared was filtered to obtain a sterilized 2-liter container, which was sealed and sterilized, &Lt; / RTI &gt;

Although the compositional ratio is relatively mixed with a component suitable for a favorite drink, it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as the demand class, the demanding country, and the use purpose.

Hereinafter, a preparation example of a cosmetic composition containing the extract of the present invention will be described, but the present invention is not intended to be limited thereto but is specifically explained.

Production Example 1: Nutritional lotion (milk lotion)

2.0% by weight of geranic acid of the present invention

Squalane 5.0 wt%

4.0 wt%

Polysorbate 60 1.5 wt%

1.5% by weight of sorbitan sesquioleate

0.5% by weight liquid paraffin

Caprylic / capric triglyceride 5.0 wt%

Glycerin 3.0 wt%

3.0% by weight of butylene glycol

3.0% by weight of propylene glycol

Carboxyvinyl polymer 0.1 wt%

0.2% by weight triethanolamine

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the nutritional lotion, the compounding ratio thereof may be arbitrarily varied, and the preparation may be carried out according to a conventional method in the field of cosmetics.

Production Example 2: Flexible Longevity (Skin lotion)

2.0% by weight of geranic acid of the present invention

Glycerin 3.0 wt%

Butylene glycol 2.0 wt%

Propylene glycol 2.0 wt%

Carboxyvinyl polymer 0.1 wt%

PEG 12 nonyl phenyl ether 0.2 wt%

Polysorbate 80 0.4 wt%

Ethanol 10.0 wt%

0.1% by weight triethanolamine

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-described components is a mixture of the components suitable for the relatively long softening time, it may be arbitrarily varied in its blending ratio, and it can be produced according to a conventional production method in the field of cosmetics.

Production Example 3: Nourishing cream

2.0% by weight of geranic acid of the present invention

Polysorbate 60 1.5 wt%

0.5% by weight of sorbitan sesquioleate

PEG 60 hardened castor oil 2.0 wt%

10% by weight liquid paraffin

Squalane 5.0 wt%

Caprylic / capric triglyceride 5.0 wt%

Glycerin 5.0 wt%

3.0% by weight of butylene glycol

3.0% by weight of propylene glycol

0.2% by weight triethanolamine

Antiseptic

Pigment amount

Fragrance quantity

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the nutritional cream, the compounding ratio of the ingredient may be arbitrarily varied, and can be manufactured according to a conventional method in the field of cosmetics.

Production Example 4: Massage cream

1.0% by weight of geranic acid of the present invention

Wax 10.0 wt%

Polysorbate 60 1.5 wt%

PEG 60 hardened castor oil 2.0 wt%

0.8% by weight of sorbitan sesquioleate

Liquid paraffin 40.0 wt%

Squalane 5.0 wt%

Caprylic / capric triglyceride 4.0 wt%

Glycerin 5.0 wt%

3.0% by weight of butylene glycol

3.0% by weight of propylene glycol

0.2% by weight triethanolamine

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparatively suitable for the massage cream, the compounding ratio thereof may be arbitrarily modified, and can be manufactured according to a conventional manufacturing method in the field of cosmetics.

Production Example 4:

1.0% by weight of geranic acid of the present invention

Polyvinyl alcohol 13.0 wt%

0.2% by weight of sodium carboxymethylcellulose,

Glycerin 5.0 wt%

Allantoin 0.1 wt%

6.0% by weight of ethanol

PEG 12 nonyl phenyl ether 0.3 wt%

Polysorbate 60 0.3 wt%

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above components is comparatively comparatively compatible with the pack, the compounding ratio thereof may be arbitrarily varied and can be produced by a conventional method in the field of cosmetics.

Production Example 6: Gel

0.5% by weight of geranic acid of the present invention

0.05% by weight of sodium ethylenediaminetetraacetate

Glycerin 5.0 wt%

Carboxyvinyl polymer 0.3 wt%

5.0% by weight of ethanol

PEG 60 hardened castor oil 0.5 wt%

Triethanolamine 0.3 wt%

Preservative, pigment, perfume

Purified water to 100%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the gel, the blending ratio may be arbitrarily varied and can be produced by a conventional method in the field of cosmetics.

Although the compounding ratio is comparatively comparatively suitable for the cosmetic composition, it can be applied to cosmetics for various uses including other color cosmetics. Depending on its effectiveness, it can be applied to a human body thinly, It can be used for manufacturing in ointment, and it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as demand level, demand country, use purpose, and the like.

Hereinafter, a preparation example of a livestock feed composition containing the extract of the present invention will be described, but the present invention is not intended to be limited thereto but is specifically explained.

Production Example 1: Preparation of Feed Additive

0.1 to 10% of the composition of the present invention,

Tribasic calcium phosphate 1 to 20%

0.01 to 0.1% of vitamin E

Enzyme powder 1 ~ 10%

Lactic acid bacteria 0.1 ~ 10%

Glucose 20-90%

Production Example 2: Production of feed

Using the feed additive of Production Example 1 as an active ingredient, feeds were prepared in the following composition.

Feed additives of Preparation Example 1 0.1 to 10%

Bran 40 ~ 49.9%

Milo 21.20%

Soybean meal 20.00%

Fish meal 3.00%

Molasses 4.00%

Mineral 1.53%

Vitamin 0.27%

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

Claims (11)

A pharmaceutical composition for preventing or treating muscle diseases comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient,
Wherein the muscle disorder is a muscle disorder caused by muscle weakness, muscle loss, muscle atrophy, muscle wasting or muscle degeneration
A pharmaceutical composition for preventing or treating a muscle disorder.
The method according to claim 1,
Wherein said composition increases the expression of p-4E-BP1 or p-p70S6K1 protein
A pharmaceutical composition for preventing or treating a muscle disorder.
The method according to claim 1,
The composition is characterized by reducing the expression of MuRF1 (Muscle Ring-Finger Protein) or MaFbx (Muscle atrophy F-box)
A pharmaceutical composition for preventing or treating a muscle disorder.
delete 4. The method according to any one of claims 1 to 3,
The muscular diseases include atony, muscular atrophy, muscular dystrophy, myasthenia gravis, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis, amyotrophic lateral sclerosis, , Charcot-Marie-Tooth disease, and sarcopenia. In a preferred embodiment of the present invention,
A pharmaceutical composition for preventing or treating a muscle disorder.
A pharmaceutical composition for muscle regeneration or muscle strengthening comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.
A health functional food composition for improving muscle function comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.
A health functional food composition for muscle regeneration or muscle strengthening comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.
CLAIMS 1. A composition for the prevention or treatment of muscle diseases comprising a geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient,
Wherein the muscle disorder is a muscle disorder caused by muscle weakness, muscle loss, muscle atrophy, muscle wasting or muscle degeneration
Compositions for livestock feed for preventing or treating muscle disorders.
A composition for livestock reproduction or muscle strengthening animal feed comprising, as an active ingredient, geranic acid or a pharmaceutically acceptable salt thereof.
A cosmetic composition for improving muscle function comprising geranic acid or a pharmaceutically acceptable salt thereof as an active ingredient.

Images