KR101992455B1 - Tenacibaculum maritimum virulence attenuation technique and live attenuated vaccine for preventing fish Tenacibaculosis disease - Google Patents

Abstract

The present invention relates to a gliding bacterium attenuated strain having an excellent vaccine effect, and to a method for preparing an attenuated Tenacibaculum maritimum strain. The method of the present invention comprises a step of culturing Tenacibaculum maritimum strains in a liquid medium containing novobiocin in the range of 0.5 to 200 μg/mL.

Description

[Tenacibaculum maritimum virulence attenuation technique and live attenuated vaccine for preventing fish Tenacibaculosis disease}

The present invention relates to an attenuated sliding bacteria and a fish vaccine composition using the same, and relates to an excellent vaccine effect compared to a dead vaccine using a wild bacterial strain, which is safe compared to the wild bacterial strain.

Tenacibaculum maritimum , a causative agent of sliding bacterial disease, was initially called Flexibacter maritimus , and is a Gram-negative Enterobacteriaceae with a suitable temperature for growth of 15~25℃. When infected with glide bacteriosis, the body surface of flounder turns gray or circular wounds and ulcers are observed, and only the skeleton remains as the fins are corroded. The flounder with corroded gills turns black and floats without power. Since the skin ulcer is not defined in a specific area, it forms ulcers in the mouth, tail, gills, fins, and eyes, and secondary infection occurs by other bacteria and protozoa. A high mortality rate of 90-95% occurs in many fish farms.

Methods to minimize the damage to the farm from pathogens include antibiotics and vaccines that kill pathogens. Antibiotics are substances made by microorganisms and prevent the growth or life of other microorganisms. Antibiotics are widely used in aquaculture, but as resistant bacteria emerge due to abuse of antibiotics, the seriousness of antibiotic use has emerged.

Vaccines are artificially made by lowering the antigenicity of a pathogen and can increase immunity and prevent reinfection by producing antibodies against the pathogen from the host's immune cells. Typical vaccines are four vaccines, live vaccines, and toxoids.

The dead vaccine is a vaccine inactivated by treating a pathogen with heat or chemicals. Live vaccine is a vaccine made from living pathogenic microorganisms by weakening the pathogenicity, and is also called an attenuated vaccine. Toxoid is a vaccine made by inactivating toxic substances that cause disease, not pathogens, leaving only its antigenicity.

Many studies have reported that the herbal vaccine is effective and enhances immunity when compared to the four vaccines. The strain used in the herbal attenuated vaccine weakens the pathogenicity and enhances the host's immunity, but does not cause disease.

Until now, the herbal poisoned vaccine has been widely used in humans and animals, but the Korean aquaculture industry has not used the herbal poisoned vaccine for disease treatment. Therefore, the present invention is to develop a safe and excellent herbal medicine poisoning vaccine for preventing T. maritimum infection in flounder.

The present invention develops a technology for attenuating the strains of sliding bacteria, and provides a strains of attenuating sliding bacteria having excellent vaccine effects compared to four vaccines, and a method of manufacturing the same.

The present invention also provides a fish vaccine using a raw attenuated strain, comprising the attenuated strain of the fish pathogenic bacterium, as an active ingredient, an excellent fish vaccine and a manufacturing method thereof while using the same concentration of antigen. do.

Accordingly, in order to achieve the above object, the present inventors have developed a technology for attenuating from the causative agent of bacterial diseases occurring in fish, and developed a vaccine containing the attenuated bacteria obtained from the present technology as an active ingredient.

The present invention provides a method for attenuating sliding bacteria, which is the causative agent of bacterial diseases occurring in fish. An example of the present invention relates to a method for producing attenuated sliding bacteria comprising the step of culturing the sliding bacteria (Tenacibaculum maritimum) while stirring in a liquid medium containing antibiotics. The manufacturing method includes the step of selecting a colony by taking a culture medium after the step of culturing and culturing in a solid medium, and culturing in a liquid medium containing the antibiotic and selecting a colony by culturing in a solid medium 1 Repeat more than once, and as the number of repetitions increases, the concentration of antibiotics increases. For example, the concentration of the antibiotic may be gradually increased in the range of 0.5 μg/mL to 200 μg/mL.

In the present invention, it can be used as an antibiotic to mutate pathogens and weaken pathogenicity. Examples of the antibiotic may be Novobiocin, and the like, but is not limited thereto. The culture medium for culturing the strain used in the step of culturing the strain can be appropriately selected and performed according to the strain to be cultured, and the specific culture conditions can be appropriately selected and used from known culture conditions, and the step of culturing the bacteria is performed. Before doing, it may further include the step of pre-culturing for 12 to 24 hours in a culture medium for bacteria.

As a specific example, an example of preparing the mutant strain according to the present invention is to separate the sliding bacterial wild strain (TM-WT) from the lesion of the halibut skin, and a marine medium solution containing a low concentration, for example, 0.25 μg/mL of Novobiocin. Incubate for a certain time at a temperature of 25 ℃ while stirring. Take 20 μL of the cultured strain in marine broth medium, spread it on a marine solid medium for culturing a strain containing Novobiocin, and then culture it to form a bacterial colony, and one colony is randomly selected. This process is repeated several times. By gradually increasing the concentration of Novobiocin (eg, 0.5 μg/mL to 200 μg/mL), the mutant strain of the sliding bacteria by Novobiocin is selected. After the subculture, the target attenuated sliding bacteria strain (TM-NOV) is selected by subculture 30 times.

Accordingly, in order to achieve the above object, the present inventors have developed a technology for attenuating from the causative agent of bacterial diseases occurring in fish, and developed a vaccine containing the attenuated bacteria obtained from the present technology as an active ingredient.

The present invention provides a method for attenuating sliding bacteria, which is the causative agent of bacterial diseases occurring in fish. An example of the present invention relates to a method for producing attenuated sliding bacteria comprising the step of culturing the sliding bacteria (Tenacibaculum maritimum) while stirring in a liquid medium containing antibiotics. The manufacturing method includes the step of selecting a colony by taking a culture medium after the step of culturing and culturing in a solid medium, and culturing in a liquid medium containing the antibiotic and selecting a colony by culturing in a solid medium 1 Repeat more than once, and as the number of repetitions increases, the concentration of antibiotics increases. For example, the concentration of the antibiotic may be gradually increased in the range of 0.5 μg/mL to 200 μg/mL.

In the present invention, it can be used as an antibiotic to mutate pathogens and weaken pathogenicity. Examples of the antibiotic may be Novobiocin, and the like, but is not limited thereto. The culture medium for culturing the strain used in the step of culturing the strain can be appropriately selected and performed according to the strain to be cultured, and the specific culture conditions can be appropriately selected and used from known culture conditions, and the step of culturing the bacteria is performed. Before doing, it may further include the step of pre-culturing for 12 to 24 hours in a culture medium for bacteria.

As a specific example, an example of preparing the mutant strain according to the present invention is to separate the sliding bacterial wild strain (TM-WT) from the lesion of the halibut skin, and a marine medium solution containing a low concentration, for example, 0.25 μg/mL of Novobiocin. Incubate for a certain time at a temperature of 25 ℃ while stirring. Take 20 μL of the cultured strain in marine broth medium, spread it on a marine solid medium for culturing a strain containing Novobiocin, and then culture it to form a bacterial colony, and one colony is randomly selected. This process is repeated several times. By gradually increasing the concentration of Novobiocin (eg, 0.5 μg/mL to 200 μg/mL), the mutant strains of the sliding bacteria by Novobiocin are selected. After the subculture, the target attenuated sliding bacteria strain (TM-NOV) is selected by subculture 30 times.

The present invention provides an attenuated mutant strain of the sliding bacteria (Tenacibaculum maritimum ), which is the causative agent of bacterial diseases occurring in fish.

The attenuated slide bacterial strain is 1 x 10 ⁸ CFU / fish administered to halibut in concentration 5 x 10 ⁷ CFU / fish to 1 x 10 ⁸ when the CFU / fish density wild primarily attacked experiments, the attenuated antenna Ciba Coolum The relative survival rate of halibut to which maritimum is intraperitoneally administered is 50 to 100%, or the relative survival rate of the flounder to which the attenuated tenassibaculum maritimum is immersed and administered is 10 to 80%, or 15 to 70%.

The strain may be in the range of 30 to 80 w/w%, or 40 to 60 w/w%, based on 100 w/w% of wild strain, in the amount of bacteria in the stationary phase of the strain growth cycle. The strain according to the present invention is safe and has low pathogenicity compared to wild strains, and specifically, an experiment confirming the pathogenicity of TM-NOV was confirmed (Example 3). Compared to% or more, TM-NOV represents 0%.

The attenuated sliding bacterial strain (TM-NOV) of the present invention is a mutation induced from the sliding bacterial strain JJ1309, for example, the attenuated sliding bacterial strain (TM-NOV) of the present invention is KCTC as of September 4, 2017. It may be a strain of accession number KCTC18609P deposited in.

The attenuated sliding bacterial strain (TM-NOV) of the present invention has a rod shape and may have an average length of 1.000 to 3.500 μm, preferably 2.000 to 3.000 μm, more preferably 2.732 μm. The gliding bacteria wild strain (TM-WT) glides on the wet surface and the surface of the colony is smooth. In addition, as the colony becomes yellow and the culture time increases, the color of the colony changes to brown. The strain may be characterized in that the surface of the colony is dry, forms a pale yellow or white colony, and the color of the colony is maintained even when the culture time is prolonged.

The attenuated sliding bacterial strain (TM-NOV) according to the present invention, for example, when the strain is cultivated at a temperature of 25° C. in a marine broth, the doubling time is 3 to 5 hours in the logarithmic phase. , Preferably it may be 3 to 4.5 hours. Also, It was confirmed that the attenuated sliding bacterial strain (TM-NOV) slowed growth compared to the smooth bacterial wild strain (TM-WT) and the control (Passage control), and the cell density decreased by about 50% compared to the wild strain. In addition, based on the logarithmic season (6 to 12 hours), the time to double the amount of strain in the case of the wild strain (TM-WT) is 2.5 hours, whereas the time in the case of the attenuated strain (TM-NOV) is 4 hours. It was confirmed that it was required (FIG. 3 and Table 3).

In addition, the strain of the present invention is in the lag phase, the logarithmic growth phase, the stationary phase, and the death phase, which are the growth cycles of the strain when cultured at a temperature of 25°C in marine broth. , The attenuated sliding bacterial strain of the present invention for the _{OD 600} value of the sliding bacteria wild strain (TM-WT) in the stagnant phase, when the growth rate and the death rate of the strain are the same or when the strain is at rest and the amount of the strain is kept at a constant maximum. The ratio of the (TM-NOV) OD ₆₀₀ value may be 0.3 to 0.8, 0.45 to 0.65, or 0.5 to 0.65.

The marine broth may use a conventional known medium, for example, Difco ^TM Marine Broth 2216 (cat. No. 279110) or the like may be used. It is composed similarly to the major minerals of seawater, peptone and yeast extract are added for nutrients, and the specific composition is as shown in the table below, and the final pH may be 7.6±0.2 per 1L of distilled water.

Peptone 5.0 g Yeast Extract 1.0 g Ferric Citrate 0.1 g Sodium Chloride 19.45 g Magnesium Chloride 5.9 g Magnesium Sulfate. 3.24 g Calcium Chloride 1.8 g Potassium Chloride 0.55 g Sodium Bicarbonate 0.16 g Potassium Bromide 0.08 g Strontium Chloride 34.0 mg Boric Acid 22.0 mg Sodium Silicate 4.0 mg Sodium Fluoride 2.4 mg Ammonium Nitrate 1.6 mg Disodium Phosphate 8.0 mg

In the present specification, the amount of cells is the total count, the amount of dry cells, the amount of wet cells, the value of measuring the components in the microbial cells (nitrogen/protein/ATP/chlorophyll content of the cells after centrifugation), and the amount of centrifugation (Packed cell volume). , It may mean the amount of cells measured by turbidimetry, the amount of cells measured using a spectrophotometer (unit, OD ₆₀₀ or OD ₆₆₀ ).

As another example of the present invention, the present invention provides a vaccine composition for preventing diseases of fish, preferably comprising an attenuated strain, comprising an attenuated sliding bacterial body (TM-NOV) as an active ingredient. . The dead vaccine is a vaccine in which the bacteria are inactivated, and the immune response is weaker than that of the live vaccine, so it has the disadvantage of having to be inoculated several times, so the live vaccine is more preferable.

Matters regarding the strain can be applied equally to the vaccine composition. When the strain of the present invention is infected with fish, it does not cause fish disease caused by sliding bacteria, for example, sliding bacteria disease, and the route of administration of the vaccine may be administered by, for example, intraperitoneal injection or immersion method. Not limited. The fish may be one or more selected from the group consisting of flounder, black sea bream, sea bream, yellowtail, stone sea bream, turbot, rainbow trout, and salmon, but is not limited thereto. The vaccine composition according to the present invention can be used for halibut having a weight of 8 g or less or a length of 10 cm or less per halibut.

The vaccine composition of the present invention is administered to fish and has a remarkably excellent vaccine effect on fish diseases caused by fish diseases, for example, sliding bacterial diseases. Specifically, the attenuated sliding bacteria strain was ^{administered to flounder at a concentration of 1x10 8} CFU/fish, and after 4 weeks, wild ^{strains were challenged at a concentration of 5 x 10 7} CFU/fish to 1x10 ⁸ CFU/fish. The relative survival rate of the flounder administered intraperitoneally with Coolum maritimem is 50 to 100%, or the relative survival rate of the flounder to which the attenuated Tenassiba coolum maritime has been immersed is 10 to 80%, or 15 to 70%. The relative survival rate (RPS) of the flounder to which the attenuated tenassibaculum maritimem was administered is determined by the method of Equation 1 below.

The relative survival rate of the flounder administered intraperitoneally with the attenuated Tenassibaculum maritimum was 50 to 100%. Specifically, after injecting the vaccine composition of the attenuated sliding bacteria strain (TM-NOV) into the peritoneal cavity of the flounder at a concentration ^{of 1x10 8} CFU/fish, the wild strain (TM-WT) was attacked by intraperitoneal injection at the concentration of ^{1x10 8 CFU/fish} During the experiment, the relative survival rate (RPS) of the flounder administered with the attenuated tenassibaculum maritimum was 50%, and an attack experiment was carried out by intraperitoneal injection of a ^{gliding bacterium wild strain (TM-WT) at a concentration of 5×10 7 CFU/fish.} In this case, the relative survival rate of the flounder to which the attenuated Tenashibaculum maritimem was administered was 100%.

After immersing the flounder in 2L seawater at a concentration of ^{5x10 6} CFU/mL of attenuated gliding bacteria strain (TM-NOV), an attack experiment was performed by intraperitoneal injection of the ^{activating bacteria wild strain (TM-WT) at a concentration of 1x10 8 CFU/fish.} In case the relative survival rate of the flounder to which the attenuated sliding bacterial strain was administered is 15%, and the attenuated sliding bacterial strain was tested by intraperitoneal injection at a concentration of ^{5x10 7 CFU/fish with the wild bacterial strain (TM-WT).} The relative survival rate of the administered flounder was 69%.

In addition, in order to evaluate the formation of ulcers on fish skin, an attack experiment was performed with an intramuscular injection of the wild strain of the sliding bacteria, and the Relative Percentage of Infecion (RPI) of the flounder administered with the attenuated Tenashibaculum maritimum was measured. I did. The group (NOV-IP) in which attenuated sliding bacterial strain (TM-NOV) was administered to the peritoneal cavity of halibut at a concentration of ^{1 x 10 8 CFU/fish was 1 x 10 7} CFU/fish concentration 4 weeks after vaccination. By intramuscular injection, the relative infection rate (RPI) was found to be 1 to 60, preferably 1 to 55. The group (NOV-IMS) in which flounder was immersed in 2L seawater with attenuated sliding bacterial strain (TM-NOV) at a ^{concentration of 5 x 10 6 CFU/mL (NOV-IMS), 1 x 10 7} CFU/ By intramuscular injection at a fish concentration, the relative infection rate (RPI) of the halibut to which the attenuated Tenashibaculum maritimum was administered was 1 to 15, preferably 1 to 11. The relative infection rate (RPI) of the flounder to which the attenuated tenassibaculum maritimem was administered was determined by the method of Equation 2 below.

Fish diseases that can be prevented by the vaccine composition may be fish diseases or infectious diseases caused by sliding bacteria. For example, the fish disease may be a bacterial sliding bacterial disease.

The content of the attenuated cells of the strain included in the vaccine composition according to the present invention may be appropriately adjusted and set according to the fish and pathogens to be applied.

The vaccine composition according to the present invention may further include additives such as excipients and/or stabilizers, and may further include, for example, phosphate buffered saline (PBS).

The vaccine composition of the present invention can be administered by various methods such as injection administration or immersion method, preferably intraperitoneal injection or immersion method, and more preferably, it may be administered by immersion method.

The present invention is a vaccine for the prevention of fish diseases including the attenuating technology of the sliding bacteria obtained by treating the wild or parental strain with Novobiocin and the mutant strain itself as an attenuated microorganism, and a dead vaccine using the inactivated bacteria of the wild strain. Compared to that, it can be usefully utilized because it has an excellent vaccine effect even at the same concentration.

1 shows the colony formation and PCR analysis results of the wild strain of sliding bacteria (TM-WT) and the strain of attenuated sliding bacteria (TM-NOV) according to Example 1.
FIG. 2 shows the results of Scanning Electron Microscopy (SEM) of the wild strain of sliding bacteria (TM-WT) and the strain of attenuated sliding bacteria (TM-NOV) according to Example 2.
3 shows the results of measuring _{OD 600} values for each culture time of the wild strain (Passage control), the wild strain (TM-WT) and the attenuated active strain (TM-NOV) subcultured according to Example 2 Is shown.
FIG. 4 is a result of measuring the biochemical enzyme activity of the sliding bacterial wild strain (TM-WT) and the attenuated sliding bacterial strain (TM-NOV) using the API ZYM kit according to Example 2.
5 is a Western-blot result of the sliding bacterial wild line (TM-WT) and the attenuated sliding bacterial strain (TM-NOV) according to Example 2.
FIG. 6A is an intraperitoneal injection of a smooth bacterial wild strain (TM-WT) and a 15 passaged wild strain (Passage control) and an attenuated sliding bacterial strain (TM-NOV) passaged 15 times according to Example 3 This is the result of displaying the cumulative mortality rate.
6B is an intraperitoneal injection of a smooth bacterial wild line (TM-WT) and a wild line (Passage control) subcultured 30 times and an attenuated sliding bacterial strain (TM-NOV) subcultured 30 times according to Example 3 This is the result of displaying the cumulative mortality rate.
7 is a photograph of a flounder showing the results of intramuscular injection of the bacteria of the wild strain strain (TM-WT) and the attenuated strain strain (TM-NOV) according to Example 3. FIG.
Figure 8a is a vaccine by intraperitoneal injection and immersion at a concentration of ^{1 x 10 8} CFU/fish in the inactivated cells of the wild strain (TM-WT) and the attenuated cells (TM-NOV) of the running bacteria according to Example 5. After administering the bacterium wild strain (TM-WT) ^{intraperitoneally injected at a concentration of 1 x 10 8} CFU/fish to conduct an attack experiment, the fish mortality according to the obtained vaccine effect is shown.
Figure 8b is a vaccine by intraperitoneal injection and immersion at a concentration of ^{1 x 10 8} CFU/fish in the inactivated cells of the wild strain (TM-WT) and the attenuated cells (TM-NOV) of the running bacteria according to Example 5 ^{In the case of intraperitoneal injection of T. maritimum wild strain at a concentration of 5 x 10 7} CFU/fish as an attack experiment after administration of T. maritimum, fish mortality according to the obtained vaccine effect is shown.
Figure 9 shows the inactivated bacteria of the wild strain (TM-WT) and the attenuated bacteria of the sliding bacteria (TM-NOV) at a ^{concentration of 1 x 10 8} CFU/fish by intraperitoneal injection and immersion after administration of the vaccine. In the case of an attack experiment by intramuscular injection of bacterial wild strain (TM-WT) at a ^{concentration of 1 x 10 7} CFU/fish, the results of the experiment on the formation of ulcers on the skin of fish according to the vaccine effect are shown.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the present invention is not limited by the following examples.

<Example 1> Preparation of attenuated sliding bacteria strain (TM-NOV)

After separating the JJ1309 strain (TM-WT) from the halibut skin lesion, it was incubated at 200 rpm for 72 hours at 25° C. in 10 ml of marine broth containing 0.25 μg/mL of Novobiocin. The marine broth was used Difco ^TM Marine Broth 2216 (cat. No. 279110), the final pH was 7.6 ± 0.2, was used after sterilization at 121 ℃ 15 minutes in a high pressure humidifier. At each subculture, 20 μL of marine broth medium was plated on marine agar plate, and the concentration of Novobiocin was gradually increased from 0.5 μg/mL to 200 μg/mL. When colonies were formed on the plate treated with Novobiocin, the process of randomly selecting one colony was repeated and inoculated into liquid medium to select mutant strains. Even in the medium with a concentration of Novobiocin of 200 μg/mL, the colony-forming bacteria were selected and further subcultured 30 times.

As a result of performing PCR using the sliding bacteria-specific primers (SEQ ID NO: 1 and SEQ ID NO: 2), it was confirmed that the bands of the wild bacterial strain (TM-WT) and the attenuated sliding bacterial strain (TM-NOV) are the same. Was done (Fig. 1). The attenuated sliding bacteria strain (TM-NOV) was made into glycerol stock and stored at -80 °C.

Forward primer (SEQ ID NO: 1): ATGGCATCGTTTTAAA

Reverse primer (SEQ ID NO: 2): CGCTCTCTGTTGCCAGA

<Example 2> Analysis of attenuated sliding bacteria strain (TM-NOV)

2.1. Morphological characteristics of attenuated sliding bacteria strain (TM-NOV)

The morphological characteristics of the attenuated sliding bacterial strain (TM-NOV) of Example 1 were examined. In the case of the gliding bacteria wild strain (TM-WT), the surface was smooth while sliding on the wet surface. In addition, the colony was yellow and the color of the colony changed to brown as the incubation time increased. On the other hand, the attenuated gliding bacteria strain (TM-NOV) had a dry surface of the colony, formed a pale yellow or white colony, and it was confirmed that the color of the colony did not change even when the incubation time was lengthened. Was done (Fig. 1).

In addition, using Scanning Electron Microscopy (SEM), the difference in morphology was confirmed between the wild strain of sliding bacteria (TM-WT) and the strain of attenuated sliding bacteria (TM-NOV). The sample was fixed in advance in 4% glutaraldehyde, pH 7.2, washed twice in 0.1M PBS, post-fixed with 1% Osmium Tetroxide, and dehydrated with ethanol. Then, after coating with platinum, the image was observed using a field-emission scanning electron microscope (JEOLJSM-6700F) with an acceleration voltage of 10 kV, and the results are shown in FIG. 2. As a result, it was confirmed that the sizes of the two bacteria were different. Specifically, the average length of the wild strain (TM-WT) was 4.776 μm, but the average length of the attenuated strain (TM-NOV) was 2.732 μm. It was much shorter in length than wild strain (TM-WT).

2.2. Base sequence analysis of attenuated sliding bacteria strain (TM-NOV)

^{Genomic DNA was extracted using the QIAamp TM} DNA Mini kit (Qiagen, Germany) in order to confirm the sequence of the attenuated sliding bacteria strain (TM-NOV). The extracted genomic DNA was confirmed by Insilicogen, Inc (South Korea) using PacBio single-molecule real-time (SMRT). The sequence was analyzed and the results of comparing the wild strain (TM-WT) with the attenuated strain (TM-NOV) are shown in Table 2 below.

Type TM-WT TM-NOV Gene defintion SNV C A TetR family transcriptional regulator SNV T C TetR family transcriptional regulator SNV C T copper transporter Insertion - T hypothetical protein Insertion - A SNV T C hypothetical protein SNV T C SNV T A excinuclease ABC subunit A Deletion C - hypothetical protein [Aquimarina atlantica] SNV C A 24-dienoyl-CoA reductase SNV C A hypothetical protein SNV T A aminopeptidase SNV A T SNV G A pseudouridine synthase SNV A G isocitrate dehydrogenase SNV C T isocitrate lyase Deletion A - phosphoesterase SNV T C 5-methyltetrahydropteroyltriglutamate--
homocysteine methyltransferase SNV A G restriction endonuclease subunit R SNV A G DNA-binding protein SNV A T phosphoglycerate mutase SNV A T phosphoglycerate mutase SNV A T alkaline phosphatase SNV T C 50S ribosomal protein L4 SNV T C SNV T C portal protein SNV A G DNA gyrase subunit B Deletion C - - SNV T C glycerol kinase NOV_
large_variant2 - ACCATCCTGA
TGCCTTGTTGC
(SEQ ID NO: 3) - NOV_
large_variant1 ACCTGGCTCCGTTAAACAGTATGCACCAAA
ACGCTCACCC
ATT
(SEQ ID NO: 4) - acyl-CoA dehydrogenase SNV G A hypothetical protein SNV C A sterol desaturase SNV C A

Most of the mutations occurred in single nucleotides and deletions or insertions also occurred. In the sequence of the acyl-CoA dehydrogenase gene, 43 sequences were deleted.

The attenuated sliding bacteria strain (TM-NOV) was deposited on September 4, 2017 at the Korea Research Institute of Bioscience and Biotechnology Biological Resource Center (KCTC) located at 181 Ipsin-gil, Jeongeup-si, Jeollabuk-do, and was given the accession number KCTC18609P.

2.3. Growth rate of strains of T. maritimum mutant strain

The growth rate of the attenuated sliding bacteria strain (TM-NOV) was confirmed using a spectrophotometer (Thermo scientific ^{TM ).} When the OD (Optical density, optical density) of the inoculated strain is measured and reaches 1 OD/mL, 100 μL is newly inoculated into 20 ml of marine broth and cultured at 200 rpm at 25°C. 1, 6, 12, 24, 36 The growth rate was measured at, 48, and 72 hours. _{The measured OD 600} , which is the cell density of the attenuated sliding bacterial strain (TM-NOV) and the sliding bacterial wild strain (TM-WT), is shown in Table 3 below and is shown in FIG. In Table 3 below, the OD ratio is the denominator of the OD value of the active bacterial strain (TM-WT) under the same culture time under the same culture conditions, and the OD value of the attenuated sliding bacterial strain (TM-NOV) according to the present invention. the ratio of the OD value calculated on the molecule (= sliding attenuated bacterial strain (TM-NOV) OD ₆₀₀ value / sliding bacterial wild week (TM-WT) OD ₆₀₀ values).

division 0-h 6-h 12-h 24-h 36-h 48-h 72-h Passage control 0.05 0.15 1.09 1.58 1.72 1.7 1.57 TM-WT 0.05 0.23 1.05 1.53 1.67 1.63 1.58 TM-NOV 0.05 0.07 0.28 0.8 0.96 1.01 0.93 OD ratio 1.00 0.30 0.27 0.52 0.57 0.62 0.59

Figure 3 shows the results of measuring the _{OD 600} value for each culture time of the sliding bacterial wild strain (TM-WT) and the attenuated sliding bacterial strain (TM-NOV). As shown in Fig. 3 and Table 3, the attenuated sliding bacterial strain (TM-NOV) has a slower growth compared to the sliding bacterial wild strain (TM-WT) and the control (Passage control), and the cell density is about 50% compared to the wild strain. It was confirmed that it decreased. In addition, based on the logarithmic season (6 to 12 hours), the time to double the amount of strain in the case of the wild strain (TM-WT) is 2.5 hours, whereas the time in the case of the attenuated strain (TM-NOV) is 4 hours. It was confirmed what was required.

2.4. Biochemical characteristics of attenuated sliding bacteria strain (TM-NOV)

API ZYM kit was used to measure the biochemical enzyme activity of the attenuated sliding bacteria strain (TM-NOV). After removing the sample medium, resuspending it in 1 x PBS, McFarland No. Make it a concentration of 5. 1 mL of sample is sonicated for 5 minutes in the cold state, and then 40 μL is added to each cupule. API ZYM strips were stored at 37° C. for 4 hours, and then 20 μL of fresh color reagent was added and reacted in the dark for 5 minutes.

The results of comparing the attenuated sliding bacterial strain (TM-NOV) and the sliding bacterial wild strain (TM-WT) using the API ZYM system are shown in Figure 4, and the biochemical of the attenuated sliding bacterial strain (TM-NOV) The enzyme activity measurement results are shown in Table 4 below. From the above experimental results, it was confirmed that the biochemical properties of the two bacteria were not significantly different.

division Enzyme name TM-WT TM-Nov One Control 0 0 2 Alkaline phosphatase 5 4 3 Esterase (C4) One 3 4 Esterase (C8) 2 2 5 Lipase (C14) One One 6 Leucine arylamidase 5 5 7 Valine arylamidase 5 3 8 Cystine arylamidase One One 9 Trypsin One One 10 α-Chymotrypsin One One 11 Acid phosphatase 4 4 12 Napthol-AS-BI-phosphohydrolase 4 3 13 α-Galactosidase One One 14 β-Galactosidase One One 15 β-Glucoronidase One One 16 α-Glucosidase 0 One 17 β-Glucosidase One One 18 N-Acetyl-β-glucosaminidase One One 19 A-Mannosidase One One 20 A-Fucosidase 2 2

2.5 Western Blot (western-blot) inspection

Western-blot was performed to check whether the antigens of the wild strain (TM-WT) and the attenuated strain (TM-NOV) were changed.

Specifically, immunization to rabbits was performed using an anti-laid bacteria polycolonal antibody (Youngin Frontier). After culturing T. maritimum , only bacteria were collected by centrifugation and washed twice with PBS. The bacteria were treated with RIPA lysis buffer for 1 hour. After centrifugation, proteins in the supernatant were measured based on bovine serum albumin. Each strain was subjected to electrophoresis by 12% SDS-PAGE, and the protein (antigen) was transferred to the PVDF membrane at 20V for 1 hour using Trans-Blot SD Semi-Dry Transfer Cell (Bio-Rad). The protein-transferred membrane was treated with a blocking solution (5% skimmed milk in TTBS) and reacted for 12 hours at 4°C, and the membrane was washed with TTBS (0.1% Tween 20 in TBS, pH 7.5) for 5 minutes at 4°C. . Anti-sliding bacteria polycolonal antibody (1:3000) was reacted for 2 hours. After the reaction, it was washed three times with TTBS, and peroxidase-conjugated secondary antibody (1:3000) was treated at 4° C. for 1 hour. After washing 6 times with TTBS and treating the membrane with an ECL detection reagent (Amersham), the results of analysis using Microchemi 4.2 are shown in FIG. 5. 5 is a photograph showing the Western-blot results of the sliding bacterial wild line (TM-WT) and the attenuated sliding bacterial strain (TM-NOV).

As shown in Fig. 5, the two antigens of the wild strain (TM-WT) have bands around 20kDa and 30kDa, respectively, whereas the attenuated strains (TM-NOV) have bands around 20kDa and 30kDa. Disappears, it has an antigen different from that of the wild strain (TM-WT), and it is inferred that the antibody did not recognize it due to the difference in protein.

<Example 3> Confirmation of pathogenicity of attenuated sliding bacteria strain (TM-NOV)

To confirm whether the attenuated sliding bacterial strain (TM-NOV) of Example 1 causes disease, an average of 8 g of flounder was used, and the attenuated sliding bacterial strain (TM-NOV) and the sliding bacterial wild strain (TM-WT) were used. ) In order to compare the pathogenicity of the cells, the cells were administered by intraperitoneal and intramuscular injection. Before the attack experiment, he was subjected to acclimatization for a week.

As for the cells used for intraperitoneal and intramuscular injection, the sliding bacterial wild strain (TM-WT), the subcultured wild strain (Passage control), and the attenuated sliding bacterial strain (TM-NOV) were used. TM-WT) was not subcultured, and the subcultured wild strain (Passage control) and attenuated sliding bacteria strain (TM-NOV) were subcultured 15 times and 30 times to prepare cells.

In each group, 100 μL of the sliding bacterial wild strain (TM-WT), the subcultured wild strain (Passage control), and the attenuated sliding bacterial strain (TM-NOV) were added to the peritoneal cavity of 10 flounders in two concentrations (1 x 10). ⁸ or 1 x 10 ⁷ CFU/fish), and passaged wild strains (Passage control) or attenuated sliding bacteria strains (TM-NOV) were passaged 15 times and 30 times. In addition, the intramuscular injection was performed at a ^{concentration of 1 x 10 7} CFU/fish to compare the pathogenicity of the wild strain (TM-WT) and the attenuated strain (TM-NOV).

For the intraperitoneal injection and intramuscular injection, the mortality rate was measured for 2 weeks, and the fish mortality rate according to the abdominal injection was shown in Figs. 6a (passage 15 times) and 6b (passage 30 times), and the fish mortality rate according to intramuscular injection Is shown in FIG. 7.

Figure 6a is a result showing the cumulative mortality after intraperitoneal injection of the wild strain (TM-WT) and the wild strain (Passage control) and attenuated strain (TM-NOV) passaged 15 times. 6b shows the cumulative mortality rate after intraperitoneal injection of the gliding bacteria wild line (TM-WT), the wild line subcultured 30 times (Passage control) and the attenuated sliding bacterium strain (TM-NOV).

FIG. 7 is a photograph of a flounder showing the results of intramuscular injection of the sliding bacterial wild strain (TM-WT) and the attenuated sliding bacterial strain (TM-NOV). Intramuscular injection formed ulcers on the skin, but it was difficult to cause halibut mortality at low concentrations.

Therefore, the pathogenicity of the attenuated sliding bacterial strain (TM-NOV) in the attack experiment using intraperitoneal injection was lower than that of the smooth bacterial strain (TM-WT) and the subcultured wild strain (Passage control). In the attack experiment using intramuscular injection, flounder injected with the lubricating bacteria wild strain (TM-WT) showed various infection symptoms in the skin on the 5th day after injection, but the halibut injected with the attenuated lubricating bacteria strain (TM-NOV) Did not show any symptoms. As a result, it can be seen that the pathogenicity of the attenuated sliding bacterial strain (TM-NOV) is weakened.

<Example 4> Safety test of vaccine composition

To confirm the vaccine safety of the attenuated sliding bacteria strain (TM-NOV), three concentrations (1 x 10 ⁶ , 1 x 10 ⁷ , and 1 x 10 ⁸ CFU/fish) in the abdominal cavity of healthy flounder The mortality rate was recorded for 2 weeks by injection of the strain (TM-NOV). One week after intraperitoneal injection, liver, kidney, and spleen were collected from 5 flounders from each group, homogenized in PBS, and spread on Marine solid medium.

It was observed that the mortality rate did not appear even in the group injected with a high concentration of attenuated sliding bacteria strain (TM-NOV) (1 x 10 ^{8 CFU/fish).} Even if the tissue of flounder injected with the attenuated sliding bacteria strain (TM-NOV) was smeared on the plate, no bacterial colonies were formed. It is interpreted that the attenuated sliding bacteria strain (TM-NOV) was removed from the immune system of the flounder because the bacteria had a limited growth rate and the pathogenicity was weakened.

<Example 5> Measurement of efficacy of vaccine composition

5.1 Vaccination

Vaccine experiments were performed in two ways: intraperitoneal injection and immersion method. Intraperitoneal injection of 750 flounder with an average of 8g without vaccine (Naive), intraperitoneal injection with formalin-treated sliding bacteria wild strain (WT-IP), and intraperitoneal injection of the attenuated sliding bacterial strain of live Example 1 Group (NOV-IP), a group (WT-IMS) subjected to immersion method by formalin treatment of a wild strain of sliding bacteria and a group (NOV-IMS) subjected to immersion method (NOV-IMS) of the attenuated sliding bacteria strain of living Example 1, 5 Divided into dog groups.

^{Two types of vaccines were used for intraperitoneal injection, and 1 x 10 8} CFU of inactivated bacteria or live attenuated active bacteria strain (TM-NOV) of a live attenuated wild strain obtained by treatment with formalin was diluted in PBS. 100 μL was injected by composition at the concentration of /fish.

The vaccine used in the immersion method is an inactivated bacterial vaccine from a wild strain obtained by treatment with formalin or a bacterial vaccine from a live attenuated sliding bacterial strain (TM-NOV) at a ^{concentration of 5 x 10 6} CFU/mL in 2L seawater. It was immersed for a minute.

5.2. Attack experiment by intraperitoneal injection

Four weeks after vaccination of Example 5.1, a wild strain of gliding bacteria ^{was injected into the abdominal cavity of 20 flounders in each group at two concentrations of 1 x 10 8} and 5 x 10 ⁷ CFU/fish. The mortality of halibut to which the vaccine was administered was observed for 14 days, and the efficacy of the vaccine was evaluated in comparison with the control group injected with PBS, and the results are shown in FIGS. 8A, 8B, and Table 5. The relative survival rate (RPS) of the flounder to which the attenuated Tenashibaculum maritimem was administered was determined by the method of Equation 1 below.

[Equation 1]

Type of vaccine Offensive
Dosing concentration Mortality (%) Relative survival rate (%) Control (Naive) 1x10 ⁸ CFU/fish 100 - Wild wine-abdominal cavity (WT-IP) 1x10 ⁸ CFU/fish 55 45 Mutant-abdominal cavity (NOV-IP) 1x10 ⁸ CFU/fish 50 50 Wild wine-immersion (WT-IMS) 1x10 ⁸ CFU/fish 95 5 Mutant-Immersion (NOV-IMS) 1x10 ⁸ CFU/fish 85 15 Control (naive) 5x10 ⁷ CFU/fish 65 - Wild wine-abdominal cavity (WT-IP) 5x10 ⁷ CFU/fish 15 77 Mutant-abdominal cavity (NOV-IP) 5x10 ⁷ CFU/fish 0 100 Wild wine-immersion (WT-IMS) 5x10 ⁷ CFU/fish 35 46 Mutant-Immersion (NOV-IMS) 5x10 ⁷ CFU/fish 20 69

Figures 8a and 8b are inactivated wild strain vaccine and attenuated mutant strain vaccine after treatment of the vaccine by intraperitoneal and immersion method, when an attack test was performed by intraperitoneally injecting the active bacterial strain (TM-WT) at two concentrations. , This is the result of measuring fish mortality and relative survival rate (%) of inactivated wild strain vaccine and attenuated mutant strain vaccine.

Figure 8a is an intraperitoneal injection (WT-IP or NOV ^{) of a vaccine composed of 1 x 10 8} CFU/fish concentration of inactivated cells of the wild strain of the sliding bacteria (TM-WT) or the attenuated cells of the strain of the sliding bacteria (TM-NOV). -IP) and immersion method (WT-IMS or NOV-IMS), and then an ^{attack experiment with a running bacterial wild strain (TM-WT) at a concentration of 1 x 10 8} CFU/fish shows the resulting fish mortality. . Figure 8b is an intraperitoneal injection (WT-IP or NOV-IP ^{) of a vaccine composed of 1 x 10 8} CFU/fish concentration of inactivated cells of wild strain (TM-WT) or attenuated cells of sliding bacterial strain (TM-NOV). ) And the immersion method (WT-IMS or NOV-IMS), and then the mortality of fish obtained by conducting an attack experiment with a ^{wild strain of gliding bacteria at a concentration of 5 x 10 7 CFU/fish.}

During the attack experiment by intraperitoneal injection, the vaccine-injected group showed effective defense ability when compared to the control group (Naive) that was not injected with the vaccine.In particular, the strain concentration in the attack experiment was 5 x 10 ⁷ CFU/fish. In the case, it was confirmed that the mortality amount was significantly lowered. In addition, in both routes of intraperitoneal injection and immersion, it was confirmed that the attenuated mutant strain (TM-NOV) was more excellent in vaccine efficacy than the inactivated wild strain (TM-WT) vaccine. As for the effect according to the route of administration, intraperitoneal administration showed lower mortality and higher relative survival rate compared to the immersion method.

5.3. Attack experiment by intramuscular injection (measurement of skin ulcers)

Four weeks after vaccination of Example 5.1, a wild strain of gliding bacteria ^{was injected into the muscles of 10 flounders in each group at a concentration of 1 x 10 7} CFU/fish. The symptoms of the disease on the halibut to which the vaccine was administered were observed for 14 days, and the efficacy of the vaccine was evaluated compared to the control group injected with PBS, and the results are shown in FIGS. 9 and 6.

The FIG. 9 is inactivated wild week Vaccine for 1 x 10 ⁸ CFU / fish concentration intraperitoneal injection (WT-IP) and immersion (WT-IMS) enforcement and attenuated mutant vaccine 1 to x 10 ⁸ CFU / fish concentration After intraperitoneal injection (NOV-IP) and immersion (NOV-IMS), 4 weeks post-running bacteria wild ^{strain (TM-WT) was intramuscularly injected at a concentration of 1 x 10 7} CFU/fish to perform an attack experiment. This is the result of testing whether an ulcer is formed on the skin. Relative infection rate (RPI) is by the method of Equation 2 below. I decided.

[Equation 2]

Type of vaccine Offensive
Dosing concentration Ulcer formation rate (%) Relative infection rate (%) Control (naive) 1 x 10 ⁷ CFU/fish 90 - Wild wine-abdominal cavity (WT-IP) 1 x 10 ⁷ CFU/fish 90 100 Mutant-abdominal cavity (NOV-IP) 1 x 10 ⁷ CFU/fish 50 55 Wild wine-immersion (WT-IMS) 1 x 10 ⁷ CFU/fish 80 88 Mutant-Immersion (NOV-IMS) 1 x 10 ⁷ CFU/fish 10 11

The death of fish according to the vaccine effect was not observed, but as a result of examining skin ulcers, 90% of ulcers occurred in the control group (Naive) not injected with the vaccine. As a result of evaluating the relative infection rate, 100% in the intraperitoneal injection of the inactivated wild strain vaccine (WT-IP), 55% in the intraperitoneal injection of the attenuated mutant vaccine (NOV-IP), and inactivated wild strain. Skin ulcers were found in 88% in the group immersed in the vaccine (WT-IMS) and 11% in the group immersed in the attenuated mutant vaccine (NOV-IMS) (FIG. 9). From these results, it is predicted that the immersion administration of the attenuated mutant vaccine (TM-NOV) strongly protects the skin of fish from infection of the wild strain (TM-WT).

Compared with the dead vaccine of the wild strain strain (TM-WT), the vaccine effect of the attenuated strain strain (TM-NOV) according to the present invention is further significantly differentiated in the administration of the intraperitoneal injection and immersion method. Looking at the relative survival rate for fish, which evaluates the efficacy as an objective vaccine, it can be seen that the intraperitoneal injection has a higher value than the immersion method. However, it can be said that sliding bacteria are bacteria that attach to the skin and gills to form ulcers, and it can be said that it is more preferable to evaluate the RPI by administering it intramuscularly than to evaluate the efficacy by observing the mortality rate after administering the sliding bacteria into the abdominal cavity .

Therefore, it was found that the vaccine composition comprising the live attenuated sliding bacteria strain (TM-NOV) according to the present invention exhibits a more excellent vaccine effect in the immersion method.

Korea Research Institute of Bioscience and Biotechnology Biological Resource Center KCTC18609P 20170904

<110> Jeju National University Industry-Academic Cooperation Foundation <120> Tenacibaculum maritimum virulence attenuation technique and live attenuated vaccine for preventing fish Tenacibaculosis disease <130> DPP20183503KR <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Forward primer in Example 1 <400> 1 atggcatcgt tttaaa 16 <210> 2 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer in Example 1 <400> 2 cgctctctgt tgccaga 17 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NOV_large_variant2 of Tenacibaculum maritimum variant (TM-NOV) <400> 3 accatcctga tgccttgttg c 21 <210> 4 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> NOV_large_variant1 of Tenacibaculum maritimum wild type (TM-T) <400> 4 acctggctcc gttaaacagt atgcaccaaa acgctcaccc att 43

Claims (9)

Culturing a Tenacibaculum maritimum strain in a liquid medium comprising Novobiocin in the range of 0.5 μg / mL to 200 μg / mL, wherein the attenuated Tenacibaculum maritimum strain A process for producing
Culturing in the liquid medium and culturing in a solid medium to select colonies are repeated two or more times,
The repetition is performed by gradually increasing the concentration of novobiocin and then selecting a strain that forms a colony in a medium having a concentration of novobacin of 200 μg /
The attenuated Tenaciabaculorum maritimum strain produced by the above-mentioned method,
It is a strain of Tenascibaculorum maritimum with deposit number KCTC18609P
The amount of the bacterial cells in the stationary phase during the strain growth period is 30 to 80 w / w% based on 100 w / w% of the wild state,
The doubling time in which the amount of the cells is doubled in the logarithmic growth phase is 3 to 5 hours,
Wherein the OD600 value is 0.3 to 0.8 in a stationary phase in which the strain level is maximized when cultured at 25 占 폚 in a marine broth supplemented with 20 占 퐂 / ml of novobiocin.
A method for producing attenuated Tenaciabaculorum maritimum strains. The method according to claim 1, further comprising the step of pre-culturing for 12 to 24 hours in a culture medium for bacterial culture, prior to performing the step of culturing said Tenaciabaculorum maritimum strain in a liquid medium. A method for producing a Staphylococcus aureus strain. 3. The method according to claim 2, wherein the step of pre-culturing is carried out while stirring in a marine broth containing novobacin. delete According to claim 1, intraperitoneal administration of an attenuated antenna Ciba Coolum grains timeom strain prepared by the method in halibut to 1 x 10 ⁸ CFU / fish concentration, and 5 x 10 ⁷ CFU / fish to 1 x 10 ⁸ CFU / fish concentration of wild-type flounder, the relative survival rate (RPS) of the flounder administered with the above-described Toxin A, T. vivax coliformis maritimum was 50 to 100%, and the attenuated Tenaciba colum maritimum strain How to make:
[Equation 1]

delete delete delete delete

Images