KR101989930B1 - Composition for controlling honeybee Nosema disease comprising dsRNA as effective component and uses thereof - Google Patents

Abstract

The present invention comprises the step of processing the Jose do Sera within bee Jose horsemen control composition and the compositions containing dsRNA to inhibit the FNR1 (Ferredoxin NADP + reductase 1) or the expression of FNR2 gene as an active ingredient of (Nosema ceranae) , And a method for controlling the bee sickle horse disease.

Description

[0001] The present invention relates to a composition for controlling a honeybee syrup containing dsRNA as an active ingredient and a use thereof,

The present invention relates to a composition for controlling a honeybee sickle-bloom which contains dsRNA as an effective ingredient for inhibiting the expression of a specific gene in nyese macera, and a method for controlling a honeybee sickle horse using such a composition.

Nosema ceranae , a causal agent of Nogema 's disease that is prevalent in beekeeping bees, is an endoplasmic retrovirus , an intracellular organism of fungi. Among the microbial strains that develop in adult bees are largely divided into N. apis and Noge masera , among which the nemesis is spreading rapidly and shows higher virulence to bees. Indeed, infections in nature cause gradual decline of individuals, large-scale collapse of autumn and winter populations, and reduced productivity of honey. However, the symptoms of Nogejima due to Nogejima are due to the bee subspecies, the environment of collection of pollen and flower seeds, the management of the fishermen, the biological and nonbiological factors, and even the region and the climate, There is a difficulty in diagnosing Nogee's disease.

Infections of the fungus in the fungus are caused by the fecal-oral route, which excretes the spores within a few weeks of the initial infection, and the excreted spores are a new source of infection for other individuals. Another cause is rapid transmissibility in the rod population due to trophallaxis between individuals.

In Korea, it was reported for the first time in the late 1960s. According to the results of 2013 survey, about 20,000 specimens of 16 specimens of farmers were found to be bee nemaemas. Therefore, the seriousness of the problem is recognized in Korea, but the research and development of the solution is still at the basic stage because Nogema is an absolute parasitic. In addition, Fumagilin, which is a kind of antibiotics, is used as a control agent of Nogema but the persistence of honey bee products and toxicity to mammals are pointed out and its effect is insufficient and new control methods are urgently needed .

RNA interference (RNAi) technology, which is being studied recently, is a gene silencing phenomenon that occurs when double stranded RNA (dsRNA) is introduced into cells. Once the dsRNA is delivered into the cell, the dsRNA is recognized by the Dicer enzyme, which cleaves the dsRNA to around 20 nucleotides, and the reaction is initiated. The cleaved dsRNA is called siRNA (short interfering RNA) and forms RNA-induced silencing complex (RISC) with various kinds of nucleic acid degrading enzymes. Thereafter, the sequence of the target mRNA having the complementary sequence is cleaved by the antisense strand (guide strand) of the siRNA loaded into the RISC, thereby causing rapid degradation of the mRNA, thereby suppressing the production of the protein encoded by the desired mRNA do. Since RNA interference has a gene-specific and powerful influence, it can synthesize dsRNA targeting a specific gene and suppress the expression of a desired gene. Therefore, it can be used in various fields such as agricultural pest control, suppression of cancer cell expression, .

The application of RNA interference technology in honey bees has been extended to the control of Varroa mite, starting from the proven effects of IAPV (Israeli acute paralysis virus), and the large-scale bee virus control effect using RNA interference technology has been reported.

Korean Patent No. 1564842 discloses' RNAi-based dsRNA for controlling spotted mite disease, a salicylic acid composition containing the same, a method for enhancing toxicity using the same and a method for controlling the same, 'Korean Patent Publication No. 2014-0017291 discloses' A composition for treating Nogema apis, and a method for purifying Nogemaa apis. "However, there is no description of a composition for controlling a bee's sickle-shaped fever containing dsRNA that inhibits gene expression in the nogejemera of the present invention and its use.

Disclosure of the Invention The present invention has been made in view of the above-mentioned needs. The present inventors prepared dsRNA targeting the mitochomal gene of Nosema ceranae and treated the bee infected with Nogema, and found that FNR1 (Ferredoxin NADP + reductase 1) or FNR2 gene showed excellent effect on the suppression of spore multiplication rate and / or the survival rate of bee infected with nemema compared with the case of dsRNA combination of previously reported genes. In addition, as a result of preparing and treating the chitosan-bound nanocomposite with the dsRNA, it was confirmed that the excellent control effect was maintained even when the dsRNA-chitosan nanocomposite was treated with bees at intervals of 3 days or more as compared with the general dsRNA. .

In order to solve the above problems, the present invention provides the bees Jose horsemen controlling composition comprising a dsRNA that Jose town sera inhibit in FNR1 (Ferredoxin NADP + reductase 1) or the expression of FNR2 genes (Nosema ceranae) as an active ingredient .

In addition, the present invention provides a method for controlling a bee's sickle-neck disease, comprising the step of treating the bee sickle sickness-controlling composition with normal bees or suspected bee sickles.

The composition comprising the dsRNA which inhibits gene expression in the present invention of the present invention as an active ingredient inhibits the expression of mitochondrial proteins in the nematocyte when it enters the body of bees through feeding, And induce improvement of the survival rate of bees infected with Nogema. Therefore, the composition of the present invention can be used for the control of the bee sickle disease and can be substituted for a chemical resistant insecticide which is easily resistant.

Fig. 1 shows results of multiple PCR performed to identify the species of Nemema isolated from bees. MP, multiple PCR products.
Fig. 2 shows the result of PCR on the seven genes finally selected, and genomic DNA in Nogemacera was used as a template.
3 is a schematic diagram of a method for producing the dsRNA of the present invention.
FIG. 4 is a gel loading photograph for confirming the size of the prepared dsRNA.
FIG. 5 shows the results of analysis of the survival rate (a) and the survival rate (b) of the nematode sporophyll according to the dsRNA treatment. no incubated: bee that has not treated both nemema and dsRNA.
Figure 6 shows the results of qRT-PCR performed to investigate the effect of dsRNA treatment on the expression of each target gene.
FIG. 7 shows the results of analysis of the growth rate of N. japonica according to the dsRNA combination treatment.
8 shows the results of analysis of the survival rate of bees according to the dsRNA combination treatment.
9 is an optical microscope photograph (A) of the dsRNA-chitosan nanocomposite and an optical microscope photograph (B) of the chitosan solution to which the dsRNA is not added.
FIG. 10 shows the results of analysis of the survival rate of bees by treating dsRNA-chitosan nanocomposite at 1 day, 2 days, and 3 days intervals without inoculation of nemema in order to confirm the toxicity of dsRNA-chitosan nanocomposite.
FIG. 11 shows the results of analysis of the spore multiplication rate (a) and the survival rate (b) of the honeybee depending on the intervals between the dsRNA-chitosan nanocomposite and the dsRNA. CP +: dsRNA-chitosan nanocomposite, CP-: dsRNA.

According to an aspect of the invention there is provided a bee Jose horsemen controlling composition comprising a dsRNA that Jose town sera inhibit in FNR1 (Ferredoxin NADP + reductase 1) or the expression of FNR2 genes (Nosema ceranae) as an active ingredient to provide.

In addition, the composition of the present invention for controlling a bee's sickle-knot disease can be used to inhibit the expression of Tc40 (translocase of the outer membrane 40), TOM70, Nar1 (nuclear architecture related 1), Nc14 (Nosema ceranae 14) But it is not limited thereto.

The FNR1, FNR2, TOM40, TOM70 and Nar1 genes of the present invention encode a mitosome protein in Nogemacera. The mitosome is a functional organ similar to a typical mitochondrion, to be. Mitosomes contain proteins that act on iron-sulfur clusters, which have been reported to act as a selectable factor to maintain cell organs in an asymptomatic environment.

The composition for controlling can be used as a microbial pesticide. The control may be, but is not limited to, treatment.

The dsRNA of the present invention is a dsRNA having high homology in its sense sequence, and in particular, containing the same sequence for a target (purpose) mRNA sequence.

The dsRNA that inhibits the expression of the FNR1 gene may be the base sequence of SEQ ID NO: 1, and the dsRNA that inhibits the expression of the FNR2 gene may be the base of SEQ ID NO: 2 But it is not limited thereto. The nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 of the present invention means a nucleotide sequence of a sense strand in a double stranded RNA (dsRNA), and an antisense strand that binds to the target FNR1 or FNR2, Or a sequence complementary to the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

In addition, each dsRNA that inhibits the expression of the TOM40, TOM70, Nar1, Nc14, and Nc17 genes may be composed of the nucleotide sequence of SEQ ID NOS: 3 to 7, but is not limited thereto. The nucleotide sequences of SEQ ID NOS: 3 to 7 also mean the nucleotide sequences of the sense strands in the respective dsRNAs for the TOM40, TOM70, Nar1, Nc14 and Nc17 genes.

In the composition for controlling a disease according to an embodiment of the present invention, the dsRNA may be in the form of a complex with chitosan bound thereto, but is not limited thereto, and may include various substances capable of promoting dsRNA stability or absorption into a target cell As shown in FIG. The dsRNA-chitosan nanocomposite of the present invention has increased stability compared to dsRNA without chitosan. The dsRNA or the dsRNA-chitosan nanocomposite may be synthesized and prepared according to methods known in the art.

The composition for the control of the present invention according to the present invention may be in the form of, for example, directly sprayable solutions, powders and suspensions, or in the form of highly concentrated aqueous, oily or other suspensions, dispersions, emulsions, oily dispersions, pastes, dusts, But are not limited thereto.

The composition of the present invention for controlling Nogzabug can be formulated into various forms. The preparation can be prepared, for example, by adding a solvent and / or a carrier. Often, inert additives and surface-active materials, such as emulsifiers or dispersants, are mixed into the formulation. Suitable surface-active materials include, but are not limited to, aromatic sulfonic acids (e.g., lignosulfonic acid, phenol-sulfonic acid, naphthalene- and dibutylnaphthalenesulfonic acid), fatty acids, alkyl- and alkylarylsulfonates, alkyl lauryl ethers, A salt of a fatty alcohol glycol ether, a sulfonate naphthalene and derivatives thereof, a condensate of formaldehyde, a condensate of naphthalene or naphthalene sulfonic acid, a phenol and a formaldehyde Condensates, polyoxyethylene octylphenol ethers, ethoxylated isooctyl-, octyl- or nonylphenol, alkylphenyl or tributylphenyl polyglycol ethers, alkylaryl polyether alcohols, isotridecyl alcohol, fatty alcohol / ethylene oxide condensates , Ethoxylated castor oil, polyoxyethylene alkyl ether or polyoxypropylene, lauryl alcohol Polyglycol ether acetate, sorbitol esters, lignin-sulfite waste liquid, or may be a cellulose, are not limited.

Suitable solid carrier materials are in principle all porous and comprise an agriculturally acceptable carrier such as mineral earths such as silica, silica gel, silicate, talc, kaolin, limestone, limestone, chalk, Fertilizers such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, vegetable products such as cereal flour, bark powder, wood meal, And nut shell powder), or cellulose powder. The solid carrier may be used alone or in combination of two or more.

The present invention also provides a method of controlling a bee's sickle-neck disease, comprising the step of treating the bee sickle sickness-controlling composition with normal bees or suspected bee sickles. The composition of the present invention for controlling Nogzema knocker comprises dsRNA targeting mitochomaceous gene in Nogemacera as an active ingredient, and the dsRNA is as described above. The method for controlling the sickle cell disease may be treating the normal sickle cell disease to prevent the sickle cell disease, treating the sickle cell disease by treating the sickle cell disease suspect with the sickle cell disease, and preferably treating the bee infected with the sickle cell disease, It is not limited.

In the control method of the present invention, the treatment may be carried out by uniformly diluting the control composition with water to control the agar horseradish, then spraying the bee with a suitable spraying device such as a power sprayer, or a composition containing an effective amount of dsRNA It may be, but is not limited to, eating bees. An " effective amount " of the present invention means an amount that is beneficial or sufficient to produce the desired result.

In the method for controlling a honeybee syringe bottle according to an embodiment of the present invention, the treatment composition is prepared by mixing a dsRNA-chitosan-binding dsRNA-chitosan nanocomposite targeting a mitosome gene in Nogemacera with 1 But may be, but not limited to, eating bees at intervals of one to three days.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Materials and methods

1. Test insects and strains

The test insects were reared on the bees ( Apis mellifera ), 24 hours after the emergence, and 50% sucrose and Bee bread were supplied as main feed.

Nosema ceranae was isolated from western bees infected with Nogejima from the Spring Bong of the Rural Development Administration. Nogema, an absolute parasitic species, was cultivated using bees' organisms.

2. Isolation of spores

In order to isolate pure N. japonica spores from bees, the mid-field was removed from the adult bees of the infected bees and placed in a 1.5 ml microtube together with 3 mm beads and then ground using a homogenizer. The heavy grinding is added to the sterile water by performing centrifugal separation at 1,000x g, 5 minutes, and the column into a 2mm filter paper served to filter out of the tissue piece bee. Thereafter, a Percoll concentration gradient of 15, 50, 75, and 90% was prepared and the filtered solution was centrifuged at 10,000 × g , 30 minutes, 4 ° C. to obtain a precipitate Was recovered and pure Pseudomonas sp. Was isolated and used for the experiment.

3. DNA extraction and PCR for polymerase chain reaction (PCR)

The pure genomic DNA extraction kit (Intron, Korea) was used to extract the genomic DNA according to the manufacturer's instructions after three separate rounds of freezing and freezing with liquid nitrogen were performed. PCR reaction. Multiplex PCR was performed using primers specific to each species (Table 1) to distinguish between N. apis and N. ceranae . The PCR reaction was carried out using 1 μl of DNA solution and 10 pmol of each primer in AccuPower PCR PreMix (250 mM dNTPs, 10 mM Tris-HCl (pH 9.0), 30 mM KCl, 1.5 mM MgCl ₂ , 1 unit Taq DNA polymerase; Bioneer Co., And the reaction was repeated 35 times at 95 ° C for 30 seconds, at 55 ° C for 30 seconds, and at 72 ° C for 2 minutes. The reaction was terminated by treatment at 72 ° C for 10 minutes. The amplified PCR product was confirmed by electrophoresis on 1.0% agarose gel.

Primers for identification Primer name The base sequence (5 '- > 3') Mnapis F GCATGTCTTTGACGTACTATG (SEQ ID NO: 8) Mnceranae F CGTTAAAGTGTAGATAAGATGTT (SEQ ID NO: 9) Muniv R GACTTAGTAGCCGTCTCTC (SEQ ID NO: 10)

4. PCR amplification and cloning of Najema gene

The selection of genes for the production of dsRNA was carried out by using the genomic information of the reported Nogemaceae and the genomic information of the Western species of bees using the BLAST (https://blast.ncbi.nlm.nih.gov/) of the National Center for Biological Information (NCBI) Blast.cgi) was used to analyze the comparison and estimation functions. The target gene determined through this process was amplified by PCR using the primer set of Table 2. The composition of the reaction mixture was adjusted to a final volume of 50 μl by adding 0.25 μl of Takara taq HS, 5 μl of 10 × PCR buffer, 4 μl of dNTP mixture, and 10 pmol of each primer. The reaction was repeated 25 times at 30 ° C for 30 seconds, 48.5 ° C for 30 seconds, and 72 ° C for 30 seconds, and the reaction was terminated by treatment at 72 ° C for 10 minutes.

Primers for cloning target genes in Nogemaacera gene primer The base sequence (5 '- > 3') TOM70 F ATGAAAAAGTAAACAAGTCAGAATTC (SEQ ID NO: 11) R CCGCTTGATTTATTAATTATAAACC (SEQ ID NO: 12) Nc14 F AATGTCATTCAAATACAAATGTTTG (SEQ ID NO: 13) R TTTAAAACACTGCATCTTATAAATTC (SEQ ID NO: 14) Nc17 F AGCAAAATTATTAAAATTATAAC (SEQ ID NO: 15) R ATTTAATTAACTACAGAATTGTTAG (SEQ ID NO: 16) TOM40 F AATAACCGTAAATATCTCATCTGTC (SEQ ID NO: 17) R TAAAGAAACGCTATTTTTATGAAAC (SEQ ID NO: 18) Nar1 F ATCGATTTAAATATTCCTATTTG (SEQ ID NO: 19) R ACTTTTTTTAGTGTTAATCATGTC (SEQ ID NO: 20) FNR1 F AATGAGAAAATTCTGTATATGAACAC (SEQ ID NO: 21) R TTTTAAATAATCATAAAAGTTGTGTAG (SEQ ID NO: 22) FNR2 F AGAATTCCTTACTTATTTACATACAC (SEQ ID NO: 23) R ATTTATTACTTGTTTAATTTATGAAG (SEQ ID NO: 24)

The PCR product was cloned by pMD20 cloning vector (Takara biotechnology, Japan) according to the manufacturer's method and ligated with the PCR amplification product and transformed into competent cells of Escherichia coli XL1 blue strain to obtain ampicillin, X-gal (5 -bromo-4-chloro-3-indolyl- beta -D-galactopyranoside) and IPTG (isopropyl [beta] -D-1-thiogalactopyranoside), white colonies were selected and cultured in a liquid medium . The cultured Escherichia coli was extracted with a DOKDO-Prep ^™ Plasmid mini-prep kit (Elpis Biotech. Inc, Korea), and the plasmid was extracted and analyzed with Macrogen (Korea).

5. Production of dsRNA

For preparation of dsRNA, a reverse primer containing a T7 promoter sequence and a reverse primer specific for N. jima gene were prepared, and a reverse primer containing a N. jima gene-specific forward primer and a T7 promoter sequence (Table 3) PCR was performed. The composition of the PCR reaction was adjusted to a final volume of 50 μl by adding 0.25 μl of Takara taq HS, 5 μl of 10 × PCR buffer, 4 μl of dNTP mixture, and 10 pmol of each primer. After 1 minute of initial denaturation at 95 ° C for 2 minutes, The reaction was repeated 10 times at 30 ° C for 30 seconds, 47.5 ° C for 30 seconds, and 72 ° C for 30 seconds. The reaction was repeated 15 times at 95 ° C for 30 seconds, 67 ° C for 30 seconds, and 72 ° C for 30 seconds And the reaction was terminated by treatment at 72 ° C for 5 minutes.

Primers for dsRNA synthesis gene primer The nucleotide sequence (5 '- > 3') (SEQ ID NO: TOM70 T7-Tom70-F TAATACGACTCACTATAGGGAGA CTGAATGTTACAAGCAGATGGG (25) rTom70-R ACCAGGAGTATCTGGATGAC (26) rTom70-F CTGAATGTTACAAGCAGATGGG (27) T7-Tom70-R TAATACGACTCACTATAGGGAGA ACCAGGAGTATCTGGATGAC (28) Nc14 T7-Nc14-F TAATACGACTCACTATAGGGAGA CTCCTGGACAGTCCGCTAG (29) rNCl4-R GAATCAGTTGACGGTAAACGG (30) rNc14-F CTCCTGGACAGTCCGCTAG (31) T7-Nc14-R TAATACGACTCACTATAGGGA GAATCAGTTGACGGTAAACGG (32) Nc17 T7-Nc17-F TAATACGACTCACTATAGGGAG AGCTTGATGGGCTTATCTCC (33) rNc17-R GCAATGCGATTTCCACGG (34) rNc17-F AGCTTGATGGGCTTATCTCC (35) T7-Nc17-R TAATACGACTCACTATAGGGAGA GCAATGCGATTTCCACGG (36) TOM40 T7-Tom40-F TAATACGACTCACTATAGGGAGA CAGATTTCTCATGTCTCTTC (37) rTom40-R TGATTGTTATCTACACATCC (38) rTom40-F CAGATTTCTCATGTCTCTTC (39) T7-Tom40-R TAATACGACTCACTATAGGGAGA TGATTGTTATCTACACATCC (40) Nar1 T7-Nar1-F TAATACGACTCACTATAGGGAGA CATCTTATGTCAAAAATATTC (41) rNar1-R CAAATGTATATTTCGCATAC (42) rNar1-F CATCTTATGTCAAAAATATTC (43) T7-Nar1-R TAATACGACTCACTATAGGGAGA CAAATGTATATTTCGCATAC (44) FNR1 T7-FNR1-F TAATACGACTCACTATAGGGAGA TGTTCCTGGTGATAGTATTG (45) rFNRl-R CATCTTCTTGATTTCTAAATC (46) rFNR1-F TGTTCCTGGTGATAGTATTG (47) T7-FNR1-R TAATACGACTCACTATAGGGAGA CATCTTCTTGATTTCTAAATC (48) FNR2 T7-FNR2-F TAATACGACTCACTATAGGGAG ATGGACAGTTTTGATTTCG (49) rFNR2-R GCGCTTCGGTAGTAAAATG (50) rFNR2-F ATGGACAGTTTGATTTCG (51) T7-FNR2-R TAATACGACTCACTATAGGGAGA GCGCTTCGGTAGTAAAATG (52)

The PCR cloning method was carried out in the same manner as described above. After cloning, the plasmid DNA was linearized by treating the restriction enzyme corresponding to the 3 'terminal sequence, and T7 reaction compounds were mixed and reacted according to the manufacturer's method using a T7 RiboMAX Express RNAi system (Promega, USA) to synthesize dsRNA .

6. Inoculation with ngerze and dsRNA feeding test

Within 24 hours, 20 bees were transferred per cage, and after 3 days of adaptation, they were inoculated with 5.0 × 10 ⁴ purified norejmaseras per flask. After the inoculation day, 32 μg / ml dsRNA and 50% The cross was mixed daily. The cage was made for single use. The treatment of dsRNA was performed using a single treatment method and a combination treatment of two or more to test mutual synergy. As a control group, noge - ma inoculation group and non - treatment group were used. The treatment effect of dsRNA was examined by comparing the spore multiplication rate and the survival rate of bees at 14 days after inoculation. The survival rate of bees was examined every day and recorded from 14 to 20 days. The spore multiplication rate was calculated by counting the number of spores by extracting the live bees from the live bees on the 14th day after inoculation. Respectively.

7. Quantitative real-time PCR for quantification

At least three bees inoculated with Noge and dsRNA were extracted for quantitative real-time PCR (qRT-PCR) and total RNA was extracted using SV Total RNA Isolation System (Promega) . Then, cDNA was synthesized using Hyperscript RT premix (Gene all, Korea) using RNA quantified as 100 μg as a template. Synthesis conditions were as follows: 55 ℃ for 45 min, 92 ℃ for 5 min, and ice for 5 min. The synthesized cDNA was used as a template for qRT-PCR. Each target gene-specific primer was used, and the antisense gene, β-tubulin gene, was used as a comparative control (Table 4). The PCR conditions were 95 ° C for 2 minutes, 95 ° C for 5 seconds, 53 ° C for 10 seconds, and 72 ° C for 15 seconds. After repeated 40 cycles, the expression level of the control gene and the target gene was measured by Delta Delta CT Relative comparison.

qRT-PCR primers gene primer The base sequence (5 '- > 3') bee
actin F AGGAATGGAAGCTTGCGGTA (SEQ ID NO: 53) R AATTTTCATGGTGGATGGTGC (SEQ ID NO: 54) β-tubulin F AGAACCAGGAACGATGGAGA (SEQ ID NO: 55) R TCCTTGCAAACAATCTGCAC (SEQ ID NO: 56) TOM40 F CATTACTAGCTTAAATACGTACACC (SEQ ID NO: 57) R CATGTGGGTACCTCTTATTCTAA (SEQ ID NO: 58) FNR1 F AAAGACCAACTATACAGGTTCTTA (SEQ ID NO: 59) R GAACAAAGTAGACCAATACTATCAC (SEQ ID NO: 60) FNR2 F ACTTTGTCACCGTCTCTCTTG (SEQ ID NO: 61) R CTGGGAAGTGTAATACCAGTAC (SEQ ID NO: 62) Nar1 F ACTGAAAGATGTCCCTTTAACA (SEQ ID NO: 63) R GTGCTTTCCTCATAAACACTATC (SEQ ID NO: 64)

8. Fabrication of dsRNA-chitosan nanocomposite

32 쨉 g of dsRNA was diluted in 100 쨉 l of a 50 mM sodium sulfate solution and treated with an equal amount of a chitosan solution (0.02% chitosan / sodium acetate buffer, pH 4.5) and allowed to stand at 55 째 C for 1 minute to form a complex. After that, the mixture was mixed with a vortex mixer for 30 seconds. Then, the dsRNA-chitosan nanocomplex was precipitated by centrifugation at 13,000 rpm for 10 minutes, and the supernatant was removed. Then, 1 ml of 50% It was resuspended and used for the experiment.

9. Application test of dsRNA-chitosan nanocomposite

To evaluate the safety of chitosan against bees, chitosan complex was formed and mixed with 50% sucrose for 1 day, 2 days, and 3 days, and the survival rate was observed for 15 days. The dsRNA-chitosan nanocomposites were treated once a day, two days, or three days after inoculation with Nogema, and the survival rate of bees was compared with that of Nogema. As a control, dsRNA alone treated with the same number of times as the Nosema inoculum and the dsRNA-chitosan nanocomposite was used.

Example 1: Application of RNAi for control in Nyeme macera

1-1. Selection of genes for gene silencing in Nogema

① Analysis of homology of mitochondrial and nemematomosomes related genes

Mitochondria are energy-metabolizing organisms in eukaryotes and are intracellular organelles that play an essential role in the metabolism of organisms. In the case of the same eukaryote, Nogema, there is mitosome which performs a similar function instead of mitochondria. In the present invention, it is expected that the suppression of the growth of Nogema by inhibiting the function of the mitosome-related gene is expected, And the homology with similar genes in bees.

Based on the total genomic information in Nogemasaera (Cornman RS et al., 2009, Plos Pathogens, 5 (6): e1000466), it is assumed that a mitochondrial-related gene, a collection of Fe-S cluster proteins known as mitochondria- Twenty candidate genes were selected. Amino acid levels were analyzed for genes that have similar functions to the western bees and oriental bees ( A. ceranae ). As a result, four genes, TOM40 (Translocase of the outer membrane 40), FNR1 (Ferredoxin NADP + reductase 1), FNR2, and Nar1 (nuclear architecture related 1), which have the lowest protein homology with the mitochondrial gene of bees (Table 5). The exact function of the four genes finally selected has not been reported so far, but the functions that are inferred are as follows. TOM40 acts as a pathway for the transport of proteins from the mitochondrial outer membrane into the interior of the mitochondria and serves as a key component of the TOM complex. FNR1 and FNR2 are flavin proteins that reduce NADP + by ferredoxin. They are involved in the degradation of electron transport and biological substances. Nar1 is thought to act as an intermediate mediator of cytosolic and nuclear Fe-S protein biosynthesis. All four of these genes are presumed to be related to the Fe-S cluster maturation of mitosome.

The genes for TOM70, Nc14 and Nc17 reported in European Patent No. 2427180 on the method for controlling Noregera horses through RNAi technology were selected together as a control for relative comparison. TOM70 is one of the components of the TOM complex with TOM40, and Nc14 and Nc17 are presumed to act as ATP / ADP transporters that transfer energy from the host and are not mitosome related genes.

The mitosome-related dsRNA target gene gene Wyoming
Amino acid homology Estimation function TOM40 24% The mitochondrial import channel binds to non-native proteins and prevents their aggregation Mitosome gene FNR1 24% Pyridine nucleotide-driven electron transport in mitosome. Providing short electron for formation of Fe / S cluster FNR2 33% Nar1 24% Critical Fe / S cytosolic proteins.
The [Fe-Fe] hydrogenase like Nar1 links early and late steps of biogenesis TOM70 · The mitochondrial import receptor:
Tom70 recognizes precursors of membrane proteins with internal targeting signals Nc14 · ATP / ADP transporter:
A type of nucleotide transporter which is used for import ATP from their eukaryotic host cell Non-mitosome gene Nc17 ·

② Identification in Noge Maserah separated from domestic

In order to identify the strain as a test strain of nemema isolated from a honeybee infected with domestic nematode disease, two types of nematode infected with bees were used, and multiple PCR was performed using the genome DNA of Nemema as a template and the primers shown in Table 1. The target part for the identification of the nematode species is 16S rRNA (SSU rRNA), which is about 220 bp in the case of N. apis and about 140 bp in the case of N. ceranae do. As a result of the PCR of the present invention, the band of the PCR product was confirmed at a size of about 140 bp, and thus the isolated species of Nogema was identified as Nogemaceae (Fig. 1).

③ Identification of target gene sequence in Nogemaseera

PCR was performed using the primers of Table 2, which are specific for each gene, using the nemesis genomic DNA as the template for the seven genes finally selected including the control group. As a result, the predicted values of the control genes Nc17, Nc14 and TOM70 Bands were confirmed at about 1.3 Kb, 1.7 Kb, and 1.2 Kb, respectively, and bands were confirmed at about 1 Kb, 1.3 Kb, 1.7 Kb, and 1.2 Kb, which are predicted positions of the target genes TOM40, FNR1, FNR2 and Nar1 2). These PCR products were cloned and their nucleotide sequences were analyzed. As a result, the desired gene was confirmed in domestic isolates by having high homology of about 99% or more with the previously reported sequence (Table 6).

Sequence analysis of target mitochomal gene of Korean isolate Najema gene Number of other nucleotides
(nt) Separated Nezama
The complementary sequence (bp) The reported Nogema genome sequence and sequence similarity TOM40 8 846 99.1% FNR1 6 1134 99.6% FNR2 5 1503 99.7% Nar1 8 1248 99.3%

④ Selection of dsRNA production site

Based on the nucleotide sequence analysis results of the candidate dsRNA target genes, the dsRNA production site was determined to be a region having no homology to the bee 's gene and no consecutive sequence more than 20 bases in sequence. This is to exclude the possibility of complementary mRNA degradation of the bee gene since the dsRNA is cleaved into siRNA of about 21 bp by Dicer in the cell. The length of the dsRNA was determined to be about 600-750 bp, according to reports that RNAi using dsRNA exhibits persistence and effective gene interference in long dsRNAs longer than 500 bp than in shorter dsRNAs of less than 100 bp. The protozoa lacked almost all introns and IGS (intergenic space) like prokaryotes and did not carry out reverse transcription PCR.

⑤ Production of dsRNA

As shown in FIG. 3, dsRNA was prepared by PCR amplification and cloning followed by linearization, and T7 promoter to synthesize complementary strand RNAs, so as to have a T7 promoter sequence before or after the target region of the dsRNA in the control group and the target gene in the target gene , And the expected size of the dsRNA was confirmed for each gene (Figure 4).

1-2. Gene silencing assay by dsRNA

① Inhibitory effect of dsRNA on Norepinephosphatidia

The results of the simultaneous treatment of the three dsRNAs of TOM70, Nc14 and Nc17 showed that they were the most effective at the same time, And the survival rate of honeybee. Since bee infections occurred at 10-14 days after the injection of Noge, the medium was extracted from live bees on the 14th day after inoculation, and the growth rate of Nogema spores was counted. As a result, the lowest production of nematode sporozoa was observed in the individual treatments of dsRNA for FNR1 and FNR2, and the reduction rate was 62% and 67%, respectively, compared to the nodame inoculation without dsRNA treatment, and the dsRNA treatment for TOM40 and Nar1 In addition, it showed a decrease rate of about 40%, and it was confirmed that the four genes selected effectively inhibited the proliferation of N. japonica (Fig. 5). Compared with the control TOM70 / Nc14 / Nc17, FNR1 and FNR2 showed spore production rates of 25% and 30% lower, respectively.

In order to observe the survival rate of bees infected with Nogema from dsRNA treatment, we compared the survival rates of the nematode inoculated with dsRNA. As a result, the survival rate of FNR1 and FNR2 increased significantly, and the survival rate was similar to that of the control (Fig. 5). On the other hand, Nar1 treatment showed the lowest survival rate among dsRNA treatments.

② gene expression level by dsRNA treatment

qRT-PCR was performed to investigate the effect of dsRNA treatment on the expression of each gene. The expression level of the gene was analyzed by using the delta-delta CT calculation method, and the gene expression level of each of the dsRNA-treated seeds and the Neze-inoculated seeds was analyzed by comparing the antisense gene, β-tubulin and the respective genes (FIG. Despite the treatment of dsRNA at the same concentration, the level of gene expression inhibition was different for each gene, but the expression of all the target genes was inhibited. These results confirm that the prepared dsRNA is suitable as an RNAi tool for the suppression of expression of each target gene, and that reduction of spore production by dsRNA treatment and improvement of survival rate of bees are results of gene expression inhibition.

③ Synergy test according to dsRNA combination

Synergistic effects of selected dsRNA combinations were analyzed according to the reported results that the mixing treatment of two or more dsRNAs was more effective than the single treatment at the same concentration. We confirmed the spore multiplication rate by mixing 2, 3 and 4 at the same concentration as the treatment of single dsRNA. In the two combinations, TOM40 / FNR1 showed a spore formation rate of about 56% lower than that of the non-dsRNA-treated seeds (Fig. 7a), and the combination of TOM40 / FNR1 / FNR2 (Fig. 7B). In the four dsRNA combination treatments, the combination of TOM40 / FNR1 / FNR2 / Nar1 showed a 52% inhibition of spore formation and was higher than that of the previously reported TOM70 / Nc14 / Nc17 (Fig. 7C).

From the above results, it was confirmed that the spore proliferation was reduced to a certain level in all treatments compared to the noge shrimp. However, when the FNR1 and FNR2 were treated alone, the degree of reduction of N. jejuni was more than 60%, confirming that the synergistic effect of mixing of dsRNA was not large.

The results of the analysis of the survival rate of bees showed that the synergistic effect of the dsRNA combination treatment was not significant, but the survival rate was improved by 20-40% in all the treatments compared to the control group of Nogame (FIG. 8). The survival rate of bees by three combinations showed a high survival rate in all combinations except for TOM40 / FNR1 / FNR2 treatment. In the case of mixed treatment of three dsRNAs, the effect of suppressing spore multiplication was not significantly increased, but the survival rate was higher Improvement effect can be observed. The survival rate of the bees in the four dsRNA mixed treatments was found to be higher than that of the Noge ma inoculum by 35% or more, and no significant difference was found between the previously reported Tom70 / Nc14 / Nc17 combinations. Even when all of the selected dsRNAs were mixed, no synergistic effect was observed.

From the above results, it was confirmed that the mitochondrial-related genes were inhibited to proliferate to N. jema, and that TOM40, FNR1, FNR2 and Nar1 newly selected in the present invention were all useful for RNAi. In particular, unlike the results of previous reports, FNR showed the best results with only single treatment, confirming that FNR is particularly useful for RNAi. All of the selected genes are genes that express mitosome-related proteins. Therefore, it was considered that the inhibitory effect of only one or two genes influenced the suppression of spore growth and the improvement of survival rate of bees. In the present invention, dsRNA was prepared and treated for the purpose of inhibiting the expression of the gene related to the same organs, and the effect of inhibiting the proliferation of Najema could be observed, but the synergistic effect between them could not be confirmed. It was judged that there are limitations to the effect because several genes were set for the purpose of RNA interference to the same organ. If a different kind of gene involved in the germination, pathogenicity and energy dependence from the host is selected as the target gene of another dsRNA, a synergistic effect with the dsRNA selected in the present invention may be expected.

Example 2. Preparation of dsRNA-chitosan nanocomposite

To improve the stability and intracellular transport of dsRNA in vivo, dsRNA-chitosan nanocomposite with chitosan was prepared and its effect was tested.

2-1. Fabrication of dsRNA-chitosan nanocomposite

① Determination of the concentration of dsRNA for production of dsRNA-chitosan nanocomposite

For the nanocomposite formation of dsRNA and chitosan, a mutual quantitative balance for electrostatic interaction was required and the amount of optimal dsRNA was determined accordingly. Based on the reported results, the amount of dsRNA was determined by forming dsRNA in the amount of 20 μg, 32 μg, and 45 μg, and comparing the amount of uncomplexed dsRNA (Zhang et al., 2010, Insect Molecular Biology 19 (5) : 683-693). As a result, it was confirmed that when 20 μg of dsRNA was used, 35% of the initial amount, 18% of 32 μg of dsRNA, and 36% of 45 μg of dsRNA remained. Thus, dsRNA-chitosan nanocomposites were prepared at a concentration of 32 μg of dsRNA.

② Identification of dsRNA-chitosan nanocomposite

As the dsRNA for the dsRNA-chitosan nanocomposite effect assay, FNR2, which showed the most excellent effect in inhibiting the growth of Nogema, was used, and successful formation of the prepared chitosan complex could be observed with an optical microscope (FIG. 9).

③ Safety of dsRNA-chitosan nanocomposite against bees

In order to test the safety of honey bees prior to testing for dsRNA-chitosan nanocomposite, only dsRNA-chitosan nanocomposites were treated at 1 day, 2 days, and 3 days intervals without inoculation of nematode. As a result, the survival rate was decreased by about 10% at maximum compared to the dsRNA-free treatment but the treatment did not significantly affect the survival of bees at intervals of more than 2 days (FIG. 10).

2-2. Effectiveness of dsRNA-chitosan nanocomposite

① Spore production rate of nemema according to treatment interval of dsRNA-chitosan nanocomposite

The number of spores collected on day 14 after the injection of Nogema showed that the dsRNA-chitosan nanocomposite and dsRNA decreased the spore multiplication rate by more than 60% when fed at 1 day and 2 days intervals. (Fig. 11A). However, at the 3-day feeding interval, the dsRNA-chitosan nanocomposite showed a spore proliferation inhibitory effect more than 30% higher than the dsRNA. These results indicate that when dsRNA was fed for 2 days or less, a sufficient amount of dsRNA was fed so that the stability and transportability of the dsRNA would not be a problem. If the dsRNA is treated at intervals of 3 days or more, the dsRNA , And that this problem can be solved through formation of dsRNA-chitosan nanocomposite.

② Survival rate of bees according to treatment interval of dsRNA-chitosan nanocomposite

The effect of dsRNA-chitosan nanocomposite was investigated through the survival rate of bees. As a result, the dsRNA-chitosan nanocomposite provided at 3-day intervals showed about 20% of the dsRNA-chitosan nanocomposite- And improved survival rate. However, similar to spore production rate, no significant difference was observed between dsRNA-chitosan nanocomposites fed at 1 or 2 days intervals (FIG. 11B).

There are several disadvantages to the in vivo treatment of dsRNA, the biggest problem being the unstability of the nucleic acid during delivery into the cell. Therefore, high-concentration dsRNA administration is required for the application of the nucleic acid itself as a pest control agent, which indirectly suggests that controlling the pest using expensive dsRNA may be very economical. Therefore, in the field of pharmacy, nanocomposites such as liposome and PEG-conjugation have been developed in order to increase the effective uptake and stability of RNAi. In the present invention, dsRNA-chitosan nanocomposite is applied to RNAi, And the improvement of stability was confirmed. In addition, there is no significant difference in the efficiency of treatment interval of 2 days or less and the treatment efficiency in 3 days interval, and it is expected that economical dsRNA treatment can be performed by reducing the total treatment frequency and throughput when chitosan nanocomposite is formed .

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Composition for controlling honeybee Nosema          dsRNA as effective component and uses thereof <130> PN17335 <160> 64 <170> Kopatentin 2.0 <210> 1 <211> 668 <212> RNA <213> Nosema ceranae <400> 1 uguuccuggu gauaguauug gucuacuuug uucaaauaau gauuugcuug uuaaugaaau 60 guuaaguuua cuagaaaugu cuggugauac auuauuauau auugagcaaa uuggaaaaac 120 gggguuucaa uucgaaggau cuuugcguga cuuuuucaag uauauuuuug auuuuacuuc 180 auagccuaaa aaagcauggc uuauggauau uucuaaaacc ucuaaaaaua agcaugauau 240 ugaauaucug uguucuaaag aaggaguaaa agauuauuua agcaucauua agaacuggaa 300 uaaugugcuu gacauuauau auacauuuca auguaaacca aguuuagagg aucuuauuau 360 gaauugucaa acaauuaagc caagauauua uucacuuacu aaccacguaa augaaaaaug 420 ugaaauuuua guagcaauua uuaaaaaagg cgauagauau ggacauguuu ccaauuucau 480 agauaugcaa aauuauaaua auuuaaagau cugucacaga ccgaguaaau uauuuagauu 540 aaauuuuugu aaaaaagugu uggguauuug uacuggaacu ggcauugcuc cauuuuuuuc 600 guuuuugaaa aauaaagaag acgaucaaua uaucaaacua auauauggau uuagaaauca 660 agaagaug 668 <210> 2 <211> 746 <212> RNA <213> Nosema ceranae <400> 2 auggacaguu uugauuucga aaaaauauua gauauugaua ugauuauauu uguauguucg 60 acucauggga augguucuga accuuuuaac augacuaaau uuuggaaauu uuugcgcaaa 120 aaaaaucugc cuacaaauuu uuuacaacac uuaaauuuug cuguauuugg ccuuggggau 180 ucgucuuaua aaucuuuuaa uuuuuguucu aaaaaguugu auaauugccu uuuaaaacac 240 ggagcuaaac cucugauaag aaaggguaau ggagauagcc aagacaaaga aggauuuaug 300 ggcgaauuua agacauggau aaaagaucua uauuauauau uaccgcauua caaacuacaa 360 aaugcuaaaa auuuugcaag uuguaaaaau gauuuauaca gugcgucaau aaaugauauu 420 aagauauuaa caccuuacaa uuacauuuau ccuauuuuag aaauaaaauu ugauauagau 480 auagaaaauu uugaaaucgg ugauugucua gcgguuuauc cugaaaauua uaauuacgag 540 gaguuuguaa gauauaauaa cauaaaggac aauaccuugg uuaaauauau uaaaaaauau 600 ugugauuuua auucuauucc ucaaauuuau uuuuuucuac aacuuucgcu uaucacagau 660 accauugcug aggaauaucg ugagaaaugu aaagaaauuu aucuaaauua cgaucuguac 720 uaugauuaca uuuuacuacc gaagcg 746 <210> 3 <211> 575 <212> RNA <213> Nosema ceranae <400> 3 cagauuucuc augucucuuc uaugggcgca gauuucgaca uaaaacagac auacgccacg 60 uucugcuuua acaaucuuuu gcuacaaacg agcauagacc aagacaaaau auuuagaaua 120 agagguaccc acauguuuaa aaaucuacuu acuaaauucc auacaguaau ugguagaagu 180 aaagauaucu uuacacaaau agagguagac auaaaaaaua aauacaauaa uauguguaua 240 aaaaugauac agccagcuau uaaaggugcu ucauguauau acguggguaa uuauaugcag 300 cagcuaggag uaauuagucu ugguggggag auuauuaaag cugaugagua cauuggacua 360 ucuuuuguag ggagauauga agggauuggu ucuauuucua cuauaucacu ucagcaguuu 420 auacacugu cuauagauua uuacaagaca uugucucua uuugugacgu agguauuaaa 480 auaucaacug auagggaaaa aucaguuaau uauggauuag gaguuaaacu gcacaguaaa 540 aaaggagaaa uuaucggaug uguagauaac aauca 575 <210> 4 <211> 737 <212> RNA <213> Nosema ceranae <400> 4 cugaauguua caagcagaug ggaaauaaaa aaaaauuucu uaaagauuua gcacuuuaug 60 aaacauuugc uaauaauaaa gaaguccaag augaaauuau gcagacuguu aaggaaauuu 120 gugaagaaga agugagugag uuuauugaac aagaaggcuu aaaaauuaau aaagaagaug 180 ugcuaagagg acuuguuuca auaaaaaaua uaaaugagau uuaugaugca uuuggaggua 240 aaucuaagaa guuuaaauuu ucuaaugaug aaaaggaagu guuaaauuu cuuaaugcca 300 uuauuuuaca ccuaaaagga aaaaaagaag aggcaauucu uuuauuagaa aaaucuacuu 360 auaaauacag uaucuuguau agagcauauu uucuuacauu gaagaaugaa uauacuucau 420 cugcauugcc uuuagaugac gagauuacua cgcuuuacuu guauucuaag auuuuuaaag 480 auaaaucuga uacuuaccuu aaaucugcua uagauaaauc aguagaucua ccuauugaac 540 agaaagacuu ucuguacgua gaucuucuug uauuuuacau uucuaaaaag gauguugaaa 600 aaguuaauga aacaauuaau aauuuaaaag agacucuuac ucccacuuua uuggaacuua 660 uuggagaaua uuauuuaaaa aguggaaauc acucuaaaau guuagaucua uuaucuaguc 720 auccagauac uccuggu 737 <210> 5 <211> 664 <212> RNA <213> Nosema ceranae <400> 5 caucuuaugu caaaaauauu cuguaugaua guguuuauga ggaaagcacg agagacaaaa 60 uaauaauaag ugacuguccu aggacuguuu cauauauuga aaggcaagca caccauuuaa 120 uugaauauuu aucuguuacu ucuacacaac aacaagccau aaagcuacuu gcucaggggc 180 gaaguauaag ugucauacag ugcuaugaua aauuuuuaga gaauagcgau gauguuuuaa 240 cuaccuauga uuuuuauaaa augauuuugg aucuaggauu uuuacagcau aauuuuauua 300 aaggaaccug ugagaaaugg gagaagugua cuauuggaua ucauuaugga uauuuagaac 360 acauauuaaa uaagaagaac aauuauuuaa caaaaaauga uaguauaaaa auauuuaaca 420 guaaaaauga ggagguaagg uuaaauggaa aaagaaaauu aaauauuaac acaguuacau 480 uaaauaaaau uaauauaccu gagauagauu auaaauauaa aaauggagug uuuacauaua 540 cacagaucaa aaauaauaag aaaaaaaaau auuuaagaau auugggucua gaaccucuuc 600 uuaauuuuau uaaggaaagu aaacauaaag aauuagaaua ugauguaugc gaaauauaca 660 uuug 664 <210> 6 <211> 670 <212> RNA <213> Nosema ceranae <400> 6 cuccuggaca guccgcuaga uuugucccuu uauuuuaugu uggaucuaau uuggcuuuac 60 uucuuucagg aaugauaaau uauuuuuaua guguaaguaa aucuaaaaug ucguauguug 120 cggccgaaag auuuuuuaau ggauuuuuuu gucugagugg aauucucugu gcuguaauuu 180 aucauauaua gaaaauaaug uuacuaguaa accaauguuu guuagaaaga 240 cuuuuacuaa aaagaagagu aaagugaagg uuggauuugu ugauggacuu auugagauga 300 guaaaucuaa acuacuguug aauaugucau uagucguauu auuuuaugcu guuucuacga 360 auauuauuga gucagcuuau aaaucugcuu uagcugucgg ugcuaaugaa acuggugagg 420 caaaaucuac cuaugcuuca auuuauacau caauugaaca aucuggaguu gcugucauug 480 ucaugauuuu gcuacuuacc ccuuuuccaa ggcuuauuaa aacaaaagga uggauuacaa 540 uagccauucu auguccuauu auuacuuuuu uuucugcuuu ugguacuuuu guauuagcuu 600 auuuaaacuu cccaauuaca aacaaagagg auaauauauu ugauauuuac cguuuaccgu 660 caacugauuc 670 <210> 7 <211> 632 <212> RNA <213> Nosema ceranae <400> 7 agcuugaugg gcuuaucucc uuuuuuauau auguacagug aguggauaag uacuuuaugu 60 uacaucuuau cggaguugug gaguacucua guaguugguu uugcuuuaua ugcguuagcc 120 aaucaugcuu guacagaaga ugaaaugaaa gaaauuguuc cuaauuuuuc cacaaucacc 180 gccauuucaa ugauuauuuc uguagcuuuu auuuauauaa aagaugaauu agcaaauaua 240 cuuccugcag guuugcauga uaaaauugac gguaguaguu uguuuuuuuu gaucuugucu 300 uuuguaacua cauuaauuua cuuuuuaaaa aguuauauuc cucuuaaaac uaaagaaaua 360 aaggaaacua uaaauaaaga agaagacaaa acgacauccu cguuugaucu uuuacaaucc 420 aaauuuuuaa gaaauaugug ugcagcggca uuaaucuaug cuauuaaugc aggauuuauu 480 gauauguccu uaaaaaauuc uuuaucuacg ggaagcagaa uuaauaauau gccuccgaaa 540 gauuauucuc aaaaauauuu aguaacaacu uccuuaacga uuagugcugu aucauuauuu 600 uauaacuuug uaauccgugg aaaucgcauu gc 632 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gcatgtcttt gacgtactat g 21 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 cgttaaagtg tagataagat gtt 23 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gacttagtag ccgtctctc 19 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 atgaaaaagt aaacaagtca gaattc 26 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ccgcttgatt tattaattat aaacc 25 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 aatgtcattc aaatacaaat gtttg 25 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 tttaaaacac tgcatcttat aaattc 26 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 agcaaaatta ttaaaattat aac 23 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 atttaattaa ctacagaatt gttag 25 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 aataaccgta aatatctcat ctgtc 25 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 taaagaaacg ctatttttat gaaac 25 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 atcgatttaa atattcctat ttg 23 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 acttttttta gtgttaatca tgtc 24 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 aatgagaaaa ttctgtatat gaacac 26 <210> 22 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 ttttaaataa tcataaaagt tgtgtag 27 <210> 23 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 agaattcctt acttatttac atacac 26 <210> 24 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 atttattact tgtttaattt atgaag 26 <210> 25 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 taatacgact cactataggg agactgaatg ttacaagcag atggg 45 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 accaggagta tctggatgac 20 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 ctgaatgtta caagcagatg gg 22 <210> 28 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 taatacgact cactataggg agaaccagga gtatctggat gac 43 <210> 29 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 taatacgact cactataggg agactcctgg acagtccgct ag 42 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 gaatcagttg acggtaaacg g 21 <210> 31 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 ctcctggaca gtccgctag 19 <210> 32 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 taatacgact cactataggg agaatcagtt gacggtaaac gg 42 <210> 33 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 taatacgact cactataggg agagcttgat gggcttatct cc 42 <210> 34 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 gcaatgcgat ttccacgg 18 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 agcttgatgg gcttatctcc 20 <210> 36 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 taatacgact cactataggg agagcaatgc gatttccacg g 41 <210> 37 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 taatacgact cactataggg agacagattt ctcatgtctc ttc 43 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 tgattgttat ctacacatcc 20 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 cagatttctc atgtctcttc 20 <210> 40 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 taatacgact cactataggg agatgattgt tatctacaca tcc 43 <210> 41 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 taatacgact cactataggg agacatctta tgtcaaaaat attc 44 <210> 42 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 caaatgtata tttcgcatac 20 <210> 43 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 catcttatgt caaaaatatt c 21 <210> 44 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 taatacgact cactataggg agacaaatgt atatttcgca tac 43 <210> 45 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 45 taatacgact cactataggg agatgttcct ggtgatagta ttg 43 <210> 46 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 catcttcttg atttctaaat c 21 <210> 47 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 tgttcctggt gatagtattg 20 <210> 48 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 taatacgact cactataggg agacatcttc ttgatttcta aatc 44 <210> 49 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 taatacgact cactataggg agatggacag ttttgatttc g 41 <210> 50 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 gcgcttcggt agtaaaatg 19 <210> 51 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 atggacagtt ttgatttcg 19 <210> 52 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 taatacgact cactataggg agagcgcttc ggtagtaaaa tg 42 <210> 53 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 aggaatggaa gcttgcggta 20 <210> 54 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 aattttcatg gtggatggtg c 21 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 agaaccagga acgatggaga 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 56 tccttgcaaa caatctgcac 20 <210> 57 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 57 cattactagc ttaaatacgt acacc 25 <210> 58 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 58 catgtgggta cctcttattc taa 23 <210> 59 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 59 aaagaccaac tatacaggtt ctta 24 <210> 60 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 60 gaacaaagta gaccaatact atcac 25 <210> 61 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 61 actttgtcac cgtctctctt g 21 <210> 62 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 62 ctgggaagtg taataccagt ac 22 <210> 63 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 63 actgaaagat gtccctttaa ca 22 <210> 64 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 64 gtgctttcct cataaacact atc 23

Claims (6)

The present invention relates to a composition for controlling a honeybee sickle-bloom, which comprises, as an active ingredient, dsRNA which inhibits the expression of FNR1 (Ferredoxin NADP + reductase 1) or FNR2 gene of Nosema ceranae,
The dsRNA that inhibits the expression of the FNR1 or FNR2 gene comprises the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2,
Wherein the dsRNA is in the form of a complex with chitosan bound thereto. 2. The method according to claim 1, further comprising a respective dsRNA which inhibits the expression of TOM40 (translocase of the outer membrane 40), TOM70, Nar1 (nuclear architecture related 1), Nc14 and Nc17 genes. A composition for controlling a toad disease,
Wherein each of the dsRNAs that inhibit the expression of the TOM40, TOM70, Nar1, Nc14, and Nc17 genes comprises the nucleotide sequence of SEQ ID NOS: 3 to 7, respectively. delete delete delete A method for controlling a bee's sickle-neck disease, comprising the step of treating the bee's sickle's fever prevention composition according to claim 1 or 2 to a normal bee or a skeptic bee.

Images