KR101989349B1 - Composition for treating and preventing viral infection comprising extracts from Camellia japonica - Google Patents

Abstract

The present invention provides a pharmaceutical composition for preventing and treating viral infection, which contains, as an active component, an extract of Camellia japonica derived from a natural product which effectively suppresses replication and decellularization of virus to effectively control viral infection, thereby exhibiting an excellent antiviral effect.

Description

[Technical Field] The present invention relates to a pharmaceutical composition for preventing and treating viral infection, which comprises an extract of Camellia sinensis as an active ingredient.

The present invention relates to a pharmaceutical composition for preventing and treating viral infection, and more particularly, to a pharmaceutical composition for preventing and treating viral infection containing a camellia extract as an active ingredient.

Influenza is an acute respiratory disease caused by influenza virus infection. It is prevalent around winter every year. Such influenza virus is a single-stranded RNA virus belonging to Orthomaxovirus, , And C-type. Among them, various mutations appear in A-type, and many suffer from the global pandemic. Retroviruses, on the other hand, are a type of RNA virus and have a reverse transcriptase for inserting RNAs containing their genetic information into the DNA of the host cell. Because of this feature, most RNA viruses do not follow the central dogma, and the protein capsids surrounding the viral RNAs, when released from the host cell, . It is a characteristic of viruses to synthesize DNA using RNA as a template using such reverse transcriptase. RNA viruses, unlike conventional DNA enzymes, can also cause mutations in viruses due to the lack of the ability to correct genetic errors during the synthesis process. As the virus itself is embedded in the host cell and becomes part of the host, it is impossible for the body's immune system to remove only the virus. If the host is attacked by a strong immune system against the virus-infected host cell, We get up together and follow the functional damage of our body organ. Therefore, for the intrinsic treatment of viral infection, a method of primarily inhibiting viral infection and a method of attacking and selectively destroying virus-infected cells are effective, and human immunodeficiency virus (viral infection) . Korean Patent Laid-Open Publication No. 2016-0024092 discloses a pharmaceutical composition for preventing or treating a coronavirus-related disease containing a camellia extract or an oleanantitrhen derivative isolated therefrom.

However, in the case of the prior art described above, there is a problem that the possibility of side effects such as drug resistance and the antiviral effect are limited due to derivatives of the compounds.

It is an object of the present invention to provide a pharmaceutical composition for preventing and treating viral infection, which contains, as an active ingredient, a camellia extract derived from a natural material exhibiting excellent antiviral effect by inhibiting replication and decellularization of virus. However, these problems are exemplary and do not limit the scope of the present invention.

According to one aspect of the present invention, there is provided a pharmaceutical composition for preventing and treating viral infection comprising camellia japonica extract or an active fraction obtained by separating the camellia extract by chromatography as an active ingredient.

According to one embodiment of the present invention as described above, virus infection and viral infection, which effectively suppress viral replication and decellularization, effectively inhibit viral infection and produce an excellent antiviral effect, The production effect of the pharmaceutical composition for prevention and treatment can be realized. Of course, the scope of the present invention is not limited by these effects.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic view schematically showing a process for producing a camellia leaf hot-water extract of the present invention. FIG.
Fig. 2 is a graph showing the separation and collection conditions of the camellia leaf hot-water extraction of the present invention.
Fig. 3 is a photograph showing the results of TLC analysis of the camellia leaves hydrothermal extract and F2 fraction of the present invention.
FIG. 4 is a photograph of a gel analysis of the inhibitory effect of actin gene expression in the Raw264.7 cell line according to the PCR treatment of the camphor leaf extract of the present invention. Hydrogen peroxide was compared by treating 1 mM as a control group
FIG. 5 is a gel photograph of a reverse transcriptase activity and a DNA polymerase activity inhibitory effect in the Raw 264.7 cell line analyzed by PCR reaction according to the hydrolysis treatment of camellia starch of the present invention.
FIG. 6 is a gel photograph showing the results of actin gene PCR analysis after treatment of Camellia extract (CWE) and CWE fractions (F1 to F4) in Raw264.7 cell line according to the hydrolysis treatment of camellia of the present invention. CWE: 100 μg / mL, F1-F4: 50 μg / mL.
FIG. 7 is a photograph showing the results of analysis of actin protein immunocytochemistry after treatment of the CWE fraction (F2) of the present invention in Raw264.7 cell line by concentration.
8 is a gel photograph showing the results of PCR analysis of viral gene (pQCXIP) after treatment with CWE and CWE fractions (F2) in GP2-293 packaging cells. CWE: 100 μg / mL, F2: 50 μg / mL.

Definition of Terms:

As used herein, the term "camellia japonica " is an evergreen arboreous tree native to Korea, including China and Japan, and growing up to about 15 m in length. Long oval leaves are thick and glossy. Camellia fruit runs after the camellia flower has passed, and when it is fully ripe, seeds are produced that can be blended with camellia oil. In recent studies, such as Dongbok-Bo, the camellia leaves have been shown to be effective in relieving psoriasis, sore throat, burns, and antibacterial effects. Branches and fruits are effective for scalp dandruff, cartilage, menstrual irregularity, diuresis, hemorrhage, It is known to be effective for gynecological diseases such as drinking by drinking tea and releasing blood.

As used herein, the term "influenza virus" is a causative agent of influenza virus, which has a coating on virus particles and a spherical shape with a diameter of 80 to 120 nm, but has a polymorphism such as a filamentous particle. It was discovered in 1933 as a pathogen, and in 1940 another virus was found. People with immunity to conventional viruses also have no immunity to the virus, and they develop when infected. So, to distinguish the two, the type A was found in 1933, the type B was found in 1940, and again in 1949 another type of influenza was found in type A or type B and was named C type.

DETAILED DESCRIPTION OF THE INVENTION [

According to one aspect of the present invention, there is provided a pharmaceutical composition for preventing and treating viral infection comprising camellia japonica extract or an active fraction obtained by separating the camellia extract by chromatography as an active ingredient.

The camellia extract may be an extract of camellia leaves, fruit, stem or root part, preferably a camellia leaf or fruit extract.

In the above pharmaceutical composition, the extract may be extracted with water, C1 to C4 lower alcohol or a mixture thereof, and the active fraction may be one prepared by a fractional liquid chromatography process. The preparative liquid chromatography may be a high performance liquid chromatography (HPLC) using a concentration gradient of a mixture solution of tertiary distilled water and methanol as a developing solvent, and the active fraction may have a methanol concentration of 30% to 70% Preferably a fraction eluted at a methanol concentration of 40% to 60%, and most preferably 45% to 55%.

In the above pharmaceutical composition, the virus is selected from the group consisting of EBV (Epstein-Barr virus), HAV (hepatitis A virus), hepatitis B virus, HCV (hepatitis C virus), HDV viruses such as Hantaan virus, CMV (cytomegalovirus), HIV (human immunodeficiency virus), influenza virus, HPV (human papilloma virus), poliovirus, ebola virus, Viruses such as rotavirus, dengue virus, West Nile virus, yellow fever virus, adenovirus, Japanese encephalitis virus, BK virus, , Smallpox virus, Zika virus, SFTS virus, avian influenza virus, retrovirus or herpes simplex virus (HSV). .

According to another aspect of the present invention, there is provided a health functional food comprising Camellia japonica extract or an active fraction obtained by chromatographically separating the camellia extract as an active ingredient.

The pharmaceutical composition of the present invention can be administered orally or parenterally, and oral administration is more preferable, but is not limited thereto. When administered parenterally, it is possible to administer through various routes such as intravenous injection, intranasal inhalation, intramuscular injection, intraperitoneal administration, percutaneous absorption and the like.

In addition, the pharmaceutical composition for treating liver diseases of the present invention may be administered at a dose of 0.1 mg / kg to 1 g / kg, more preferably at a dose of 1 mg / kg to 600 mg / kg. On the other hand, the dose can be appropriately adjusted according to the age, sex and condition of the patient.

The pharmaceutical pharmaceutical composition may be formulated into various formulations. The pharmaceutical composition may be prepared in the form of a tablet, packaged in a retort pouch, dried by hot air drying, freeze-drying, etc., Or may be formulated into a jelly form by being mixed with a gelling ingredient such as gelatin. Any of the known formulations conventionally used in the production of pharmaceutical preparations can be used.

In addition, one or more pharmaceutically acceptable carriers may be used in preparing the pharmaceutical compositions of the present invention, including various conventional organic or non-aqueous carriers, such as excipients, lubricants, binders and lubricants in solid formulations, In liquid formulations, such as disintegrants, solubilizers, solubilizers, isotonic agents, buffering agents,

There is a soothing agent. In addition, if necessary, additives such as conventional preservatives, antioxidants, colorants, sweeteners, adsorbents, wetting agents and the like can be appropriately used in appropriate amounts.

The health functional food of the present invention may be in the form of a capsule, tablet, powder, granule, liquid, ring, flaky, paste, syrup, gel, jelly or bar form. Functional foods. The health functional foods may be formulated into various formulations suitable for health functional foods such as tablet, drink, powder, pill, capsule, tablet (coated tablet, sugar-coated tablet, etc.) and jelly.

Viral infections translate to optimize the normal function of host cells for viral replication and virion production. Among them, the structural modification and rearrangement of actin in the cell is significantly changed, affecting the life cycle of virus recombination and egression. Transformation of these cells by viral infection is caused by Rous sarcoma virus, avian retrovirus, simian virus 40, and adenovirus, Resulting in abnormal cell proliferation and morphological transformation. In particular, since assembly of viruses in host cells is completed and actin is excreted in the cells, actin overexpression can be regulated to inhibit virion decontamination. In this technology, the expression of the actin in the cell is effectively inhibited at a high concentration by the camellia extract, and thus it can be developed as a new material preventing the secondary infection of the virus.

In the meantime, in order to treat the conventional virus, a cell membrane fusion inhibitor, a reverse transcriptase inhibitor to convert RNA to DNA, and a protease inhibitor to block the protein cleavage process by protease were used. In addition, Binding CCR5 receptor inhibitors, integrase inhibitors that inhibit the formation of provirus, and agents that inhibit the final maturation stage of newly evolved viruses from host cells have been used as therapeutic agents. However, most of the drugs currently used are synthetic medicines, and they are not able to completely inhibit the virus. Therefore, drug resistance is frequent, and side effects such as immunity, fat distribution syndrome, mitochondrial toxicity, bone metabolic abnormalities and hepatotoxicity have occurred. Therefore, fewer side effects of antiviral efficacy studies are in progress and the development of superior natural products derived material actual swine flu (novel swine-origin influenza A, H1N1) treatment Tamiflu is octagonal anise (Illicium verum, one of the spices Hooker used the It is expected that the development of natural product drugs will be exploited in the light of the facts derived from. Therefore, the inventors of the present invention have recognized that when the natural material-derived material is used as an adjuvant, it is highly valuable as an adjunctive agent together with an antiviral agent when controlling the decrease of immunity and suppressing viral amplification, As a result of the effort, a pharmaceutical composition for preventing and treating viral infection derived from natural products extracted from camellia leaves which are native to Korea has been developed.

According to the present invention, it has been confirmed that the active substance contained in the chromatographic fraction (F2) of the camellia extract has an effect of inhibiting the replication of the virus and inhibiting the out-celling of the virus body that has been combined in the host cell. In addition, the mechanism (F2) of expression of actin cytoskeleton, which is very important for the viral life cycle (binding, penetration, nuclear localization, gene replication and reverse transcription, Lt; RTI ID = 0.0 > viral < / RTI > production and extracellular flux. In addition, since the primary infection of the virus and the hydroquinone known to interfere with the target cell binding of the virus secreted from the host cell are included, the substance of the present invention suppresses the normal assembly and descaling of the virus from the infected cells Lt; RTI ID = 0.0 > antiviral < / RTI > The above results indicate that Tamiflu, an anti-influenza drug derived from octopus, can be developed as a next-generation new drug with more effective dual anti-viral efficacy than a neuraminidase inhibitor (viral decellular inhibitor). Accordingly, the present invention can be applied not only to specific viruses but also to various kinds of viruses.

Hereinafter, the present invention will be described in more detail by way of examples. It should be understood, however, that the invention is not limited to the disclosed embodiments, but may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, Is provided to fully inform the user.

Example 1: Preparation of camellia extract

To prepare the camellia extract, 100 g of completely dried Camellia sinensis powder was immersed in 3 L of water, followed by hot water extraction at 95 ° C for 3 hours. 1 filter paper. The filtered extract was then lyophilized to give a final 22.8 g hot water extract.

Example 2: Separation of camellia extract

The present inventors isolated the camellia extract obtained in Example 1 at a concentration of 50 mg / mL in tertiary distilled water, and then 10 mL of the extract was loaded on a YMC LC forte / R (YMC, Japan) HPLC apparatus One). Specifically, the flow rate was 30 mL / min, and the absorbance was confirmed at 203 nm, 254 nm, and 280 nm wavelength. Two columns of YMC-DispoPackAT ODS-25 / 40g were separated from each other at room temperature. F1 was methanol concentration of 30%, F2 was methanol concentration of 50%, F3 was 70% of methanol, and methanol was used as distillation conditions for solvent A and B, respectively. 10 minutes and 3 minutes B% = 10% and 3 minutes to 6 minutes, respectively, starting from 10% at 10% to 16% The analysis was performed under the conditions of B% = 30%, 6 min to 9 min, B% = 50%, 9 min to 12 min, B% = 70%, and 12 min to 20 min B% = 100% . As a result, as shown in FIGS. 1 and 2, the yield of the F1 fraction was the highest (75.2%), the yield of the F2 fraction was the next highest (12.5%), and the yields of F3 and F4 decreased in that order.

Example 3: GC-MS and TLC analysis

The present inventors performed GC-MS analysis and thin layer chromatography using the obtained CWE (camellia starch waters extract) and F2 fractions.

Specifically, GC-MS analysis of the fraction showing biological activity and CWE was performed using GC-MS (Agilent Technologies 5975C) equipped with a CTC CombiPAL autosampler system (Palo, Alto, USA). The column used for the sample analysis was an HP-5 column (Agilent Technologies, 250 μm × 0.25 μm × 30 m). After 5 minutes of holding at 50 ° C., the column was elevated by 10 ° C. per minute and then stopped at 310 ° C. for 5 minutes holding. In addition, all samples were dissociated to 10 mg / mL using the appropriate solvents for GC-MS analysis and then splitless injected in 5 μL aliquots. TLC analysis was performed by dissolving 10 mg / mL of hydroquinone standard product (Sigma-Aldrich, USA), Camellia hot water extract (CWE) and fraction (F2) in distilled water and 10 times on TLC glass plate. The diluted TLC glass plate was put into a transfer chamber, and methanol was first developed to a mobile phase 6 cm. The 4 cm development site was cut out, and then ethyl acetate: methanol: water (77:13:10, v / v) The developed glass plate was analyzed by iodine staining and ultraviolet irradiation (254, 365 nm).

As a result of GC / MS analysis, it was confirmed that hydroquinone (homology 91 ~ 93%) expected to have virus (HIV) and membrane-bound inhibitory activity was contained, and 11.9% of CWE and F2 It was confirmed that the fraction contained 5.5% of hydroquinone, respectively. This showed that although the content of hydroquinone contained in the F2 fraction was lower than that in the CWE, a superior effect was observed in the F2 fraction and the substance was expected to play an auxiliary role in antiviral efficacy. However, On, and virion) assembly inhibition and decellularization inhibition were confirmed by the antiviral efficacy of the active substance in the F2 fraction. In addition, hydroquinone (Rf = 0.94) was detected at 254 nm in F2 fraction collected from the camellia hot water extract by thin layer chromatography and 365 nm analysis showed that the spot (Rf = 0.52) and a spot (Rf = 0.74) present only in the F2 fraction (Fig. 3).

Example 4: Inhibition of cytoskeletal actin gene expression

Viral infections translate to optimize the normal function of host cells for viral replication and virion production. Among them, the structural modification and rearrangement of actin in the cell is significantly changed, affecting the life cycle of virus recombination and egression. Transformation of these cells by viral infection is caused by Rous sarcoma virus, avian retrovirus, simian virus 40, and adenovirus, Resulting in abnormal cell proliferation and morphological transformation. In particular, since assembly of viruses in host cells is completed and actin is excreted in the cells, actin overexpression can be regulated to inhibit virion decontamination.

Accordingly, the inventors of the present invention have found that by inhibiting cytoskeletal actin gene expression and treating virus-infected host cells by the treatment of camellia extract (CWE) of the present invention using RT-PCR, The inhibition of virion secretion which induces tea infection was analyzed.

Specifically, the present inventors treated the camellia hot water extract (CWE) and the fractions (F1 to F4) of the present invention using a mouse macrophage cell line (Raw 264.7) to investigate the inhibition of cytoskeletal actin gene expression, For the cultivation, the cells were grown at 90% in an incubator adjusted to 5% CO ₂ at 37 ° C using an alpha minimum essential medium (Hyclone, UT, USA) containing 10% fetal bovine serum , And subculture was controlled not to exceed 20 times. Thereafter, the cultured cells were suspended in 0.25% trypsin-EDTA, and then the number of cells was counted using a hemocyte calculator. The cytotoxicity test was performed so that the cultured cells were 1.0 × 10 ⁴ cells / well on a 96-well plate. In addition, the gene expression test was performed in a 6-well plate at 1.5 × 10 ⁶ cells / well and the cells were preincubated for 2 hours and then used for the expression of actin gene.

The expression level of actin gene was determined by RT-PCR. To do this, total RNA of the cultured cells was extracted from Raw264.7 cells using a triazole reagent (Invitrogen, MA, USA). That is, 1 mL of the triazole reagent was added to dissolve the cells, and the cells were allowed to stand at room temperature for 5 minutes. Then, 200 μL of chloroform was added thereto, followed by centrifugation at 13500 rpm for 15 minutes. The clear supernatant (500 μL) was then transferred to a new tube and an equal volume of isopropyl alcohol was added, followed by centrifugation at 13500 rpm for 10 minutes to precipitate the RNA. The RNA precipitate was washed with 0.75 mL of 70% ethanol diluted with distilled water treated with diethyl pyrocarbonate (DEPC, Sigma-Aldrich), and dried in air to use as a reverse transcription sample. In addition, the total RNA was treated with the camphor hot-water extract of the present invention at a concentration of 10-100 μg / ml and treated with 1 ml of hydrogen peroxide (H ₂ O ₂ ), and used as a control. On the other hand, cDNA synthesis of the primary DNA strand was carried out using 1 쨉 g of the extracted total RNA, and the reverse transcription reaction was carried out using the IMPROM-II reverse transcription system (Promega) and oligo dT primer (see Table 1). In addition, PCR was performed using a 2x premix containing tag-polymerase (ReddyMix PCR Master Mix, CA, USA) for 35 cycles. The nucleic acid sequences of the primers used in the PCR reaction are summarized in Table 1 below.

primer The nucleic acid sequence (5 '-> 3') SEQ ID NO: Forward TACAGCTTCACCACCACAGC One Reverse AAGGAAGGCTGGAAAAGAGC 2

As a result, it was confirmed that the expression of actin was inhibited when the cells were treated with 100 μg / ml of the camellia hot water extract of the present invention (FIG. 4), and the CWE treated with ethanol In PCR (2), when the PCR is performed after the CWE treatment in the distilled water (3), the total RNA is subjected to the CWE treatment and the PCR is performed through the cDNA process (4) During the PCR (⑤), when the total RNA was treated with distilled water and the cDNA was treated with distilled water and then subjected to PCR (⑥), actin expression was all suppressed except for the negative control groups 1 and 6, Inhibition of actin gene expression by camelliace extracts was shown to act on both the reverse transcription and DNA polymerization reactions (Fig. 5). These results suggest that the inhibition of actin overexpression in viral infection inhibits virion decellularization. In addition, the effect of controlling the expression of actin gene in fractions (F1 to F4) isolated from the camellia hot water extract (CWE) of the present invention was found to be similar to that of CWE in the F2 fraction, (Fig. 6).

Example 5: Immunocytochemical staining analysis

We performed immunocytochemical staining of Raw264 / 7 cells treated with F2 fractions at 1, 25, and 50 μg / mL, respectively, in order to compare protein expression levels of actin.

Specifically, for immunocytochemical analysis, Raw264 / 7 cells cultured in a slide culture chamber were fixed in 4% paraformaldehyde for 15 minutes, washed with phosphate buffered saline (PBS) supplemented with 100 mM glycine for 5 minutes, As a solution, 0.1% Triton X-100 (Sigma Aldrich) solution was added and left at room temperature for 30 minutes. Blocking was achieved by treating serum albumin at 1% concentration, reacting at room temperature for 30 minutes, and washing with phosphate buffer solution three times. Subsequently, the beta-actin monoclonal antibody was diluted 1: 200 in a 20% phosphate-buffered saline solution supplemented with 1% bovine serum albumin, subjected to an antigen-antibody reaction at room temperature for 3 hours, The antibody was incubated for 2 hours and then observed using a fluorescence microscope.

As a result, the overall distribution of actin, the cytoskeleton, was low, indicating that actin gene regulation by actinomycetes extract was effective (FIG. 7).

Example 6: Virion secretion inhibition

In order to analyze virus decellated from packaging cells (GP2-293) by the camellia extract and active fraction (F2) according to an embodiment of the present invention, the present inventors concentrated the virus by concentrating the GP2-293 culture, Viral PCR was performed using primers for the gene.

Specifically, a commercially available virus infection system (pQCXIP Retroviral Vector, Clontech, CA, USA) was used to investigate the inhibitory effect of camellia extract on virion secretion. In other words, virus-like similar experiments were performed by constructing transformed cell lines to stably carry out MMLV Gag-Pol, pCMV-VSVG, virus expression vector and virion production required for virus packaging. First, GP2-293 packaging cells (derived from human embryonic kidney cells HEK 293) expressing intracellular gag and pol proteins were co-infected with Retro-x vector and pVSVG (envelope plasmid) to produce GP2-293 cells To produce viral proteins and to replicate viral RNA at the same time. The virion in combination with the viral gene and virus protein migrated to the cell membrane and allowed the infective virion to escape (decellularize) to the outside of the cell. The expression levels of actin in HEK 293 cells and GP2-293 cells were compared to compare the levels of inhibition of gene expression of the camellia extract. In order to confirm the presence or absence of the decellularized virus, The antiviral efficacy of the camellia extract was confirmed by gene qualitative analysis.

As a result, in the experimental group treated with CWE (100 μg / mL) and F2 fraction (50 μg / mL), the RNA virus vector gene (194 base pair, 5'primer: 2141-2164; 3'primer: 2329-2352) And the second infection by the virus was effectively controlled around the virus-infected cells (Fig. 8).

Example 7: Antiviral efficacy experiment

The present inventors cell lesions effect (cytopathic effect, CPE) inhibition test and MTT (3- (4,5-dimethythiazol- 2-yl) Using the sensitive cells in in vitro method to search for antiviral efficacy 2,5 diphenyl tetrazolium bromide) analysis test. Amantadine (M2 protein inhibitor) and ribavirin (RNA synthesis inhibitor) were used as a positive control. The test procedure was cytotoxicity and cytopathic effect (CPE) / Hong Kong, Flu B 1; Lee) was investigated for antiviral activity using antiviral activity assay and MTT assay. Madin-Darby Canine Kindey (MDCK) cells were used for the cultivation of each virus. Medium for maintenance culture of MDCK cells was cultured in a medium containing 10% fetal bovine serum and penicillin / streptomycin / Medium (MEM) was used. The number of MDCK-infected cells was maintained at 2.0 × 10 ⁵ cells / well, and serum-free MEM containing vitamins solution, diglucose and trypsin was used as a medium for virus inoculation. On the other hand, the virus for inoculation was cultured in a 75 cm ² tissue culture flask, and CPE was induced. When cells adhered to the cells were removed, the cells were frozen-thawed twice, centrifuged at 1,500 × g for 5 minutes, Was dispensed into a freezing vial and stored at -80 < 0 > C. The infectivity of the virus for inoculation was estimated to be 50% cell culture infectious dose (CCID ₅₀ ), and diluted 30,000 times of the culture broth (1.2, 0.6, 3.8) of each of Flu A (PR8, HongKong) and Flu B The antiviral efficacy test for camphor extract (CWE, F2) was carried out by culturing the host cells under the same conditions as in the cytotoxicity test, discarding the culture medium, diluting the culture medium for 3 consecutive dilutions, 100 [mu] L of the culture solution and 100 [mu] L of the virus of 10 times the TCID50 were inoculated. Compared to the cytotoxicity test after 2 days of culture, the CPE inhibitory effect of the extract was compared. Cells containing untreated cells, 3 kinds of virus-inoculated cells and camellia extract (CWP, F2) CPE inhibitory effects were compared and analyzed.

As a result, as shown in the following Table 2, the cytotoxicity of camellia extract (CWE and F2) was> 2,400 μg / mL in the CC ₅₀ (μg / mL) analysis and did not show cytotoxicity to the MDCK . Therefore, the antiviral activity of CWE and F2 was found to be superior in antiviral activity in CWE and F2 fractions when the CPE inhibition assay derived from viral infection was applied. In particular, F2 fraction was higher in Flu A and Flu B The selectivity index (SI) analyzed by CC ₅₀ / EC ₅₀ was also higher than that of the comparative positive control, indicating excellent antiviral activity.

Comparison of antiviral activity number code toxicity
CC ₅₀ (ug / ml) Antiviral activity
(EC ₅₀ : ug / ml) Selectivity index
FluA FluA FluB FluA FluA FluB H1N1 H3N2 - H1N1 H3N2 - PR8 HongKong Lee PR8 HongKong Lee One CWE (μg) > 2400.0 31.4 <29.6 74.0 > 76.4 > 81.1 > 32.4 2 F2 (μg) > 2400.0 <29.6 <29.6 45.7 > 81.1 > 81.1 > 52.5 4 Solvent (methanol) > 42.0 > 42.0 > 42.0 > 42.0 ND ND ND 5 AMT (μM)
(Amantadine) > 100.0 > 100.0 2.3 > 100.0 ND > 43.5 ND 6 RBV ([mu] M)
(Ribavirin) > 100.0 29.9 13.4 19.6 > 3.3 > 7.5 > 5.1

In conclusion, the pharmaceutical composition for preventing and treating viral infection containing the extract of Camellia sinensis according to the present invention is useful for preventing the reverse transcription of the virus without affecting the activity and survival of the target cell (target cell) (Actin) protein, which is essential for the regulation of gene amplification and viral decolorization (egression), is observed. Thus, it is possible to develop a natural drug product which prevents secondary infection of viruses.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. Accordingly, the true scope of the present invention should be determined by the technical idea of the appended claims.

<110> GANGNEUNG-WONJU NATIONAL UNIVERSITY INDUSTRY ACADEMY COOPERATION GROUP <120> Composition for treating and preventing viral infection          comprising extracts from Camellia japonica <130> PD18-5628 <160> 2 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward <400> 1 tacagcttca ccaccacagc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse <400> 2 aaggaaggct ggaaaagagc 20

Claims (5)

A pharmaceutical composition for preventing and treating influenza virus infection, comprising as an active ingredient Camellia japonica extract or an active fraction obtained by separating the camellia extract by chromatography. The method according to claim 1,
Wherein the extract is extracted with water, C1 to C4 lower alcohols or a mixture thereof. The method according to claim 1,
Wherein the active fraction is produced by an aliquot liquid chromatography process. delete A health functional food for anti-influenza virus, comprising as an active ingredient Camellia japonica extract or an active fraction obtained by separating the camellia extract by chromatography.

Images