KR101985300B1 - Pharmaceutical Composition for Treating or Preventing Brain Tumor Comprising Midkine inhibitor - Google Patents

Abstract

A pharmaceutical composition for the treatment and / or prevention of a brain tumor comprising as an active ingredient a combination of a midkine inhibitor or a midkine inhibitor and temozolomide, and a pharmaceutical composition for the treatment and / or prevention of a temporomolomic treatment of a midkine inhibitor and / Applications are provided for overcoming resistance to therapy.

Description

[0001] The present invention relates to a pharmaceutical composition for Treating or Preventing Brain Tumor including a Midkine Inhibitor,

A pharmaceutical composition for the treatment and / or prevention of a brain tumor comprising as an active ingredient a combination of a midkine inhibitor or a midkine inhibitor and temozolomide, and a pharmaceutical composition for the treatment and / or prevention of a temporomolomic treatment of a midkine inhibitor and / Applications are provided for overcoming resistance to therapy.

Brain tumor refers to a tumor that occurs in the brain tissue or membrane tissue that surrounds it. It refers to a primary brain tumor and a secondary brain tumor that has metastasized to the brain tissue or brain membrane at other sites

Brain tumors found in adults include glioma, glioblastoma, meningioma (meningioma), pituitary adenoma (adenoma), and schwannoma.

Glioblastoma is a tumor originating in the glial cells of the brain, accounting for 12 to 15% of all brain tumors and the most common primary brain tumor in adults (3.19 / 100,000; Cancer Epidemiol Biomarkers Prev. 2014 Oct; 23 (10): 1985-96).

Unlike other tumors, glioblastoma is tightly stretched between cells and tissues and has a relatively fast growth rate and a high rate of metastasis. Increased intracranial pressure usually causes severe headache, nausea and vomiting in the morning, and symptoms such as epileptic seizures, loss of memory and behavioral changes occur. Brain edema associated with the tumor itself or the tumor may cause symptoms such as limb movement or sensory depression, facial paralysis, speech disturbances, cognitive impairment, and left and right disturbances due to decreased nerve function.

The treatment of glioblastomas, similar to other brain tumors, is performed primarily by surgical removal of the tumor as much as possible, followed by radiation therapy and chemotherapy with chemotherapy. Despite these therapeutic efforts, the average survival time is around 15 months and the 5-year survival rate is 7%, which is a very poor prognosis (N Engl J Med 2008; 359: 492-507).

In addition, various side effects and resistance according to radiotherapy and chemotherapy are obstacles to the treatment of brain tumor. There is also the problem that there is no standard treatment for recurrence of brain tumors.

Therefore, it is required to develop a new treatment method of brain tumor which is excellent in anticancer effect, low in side effect and able to overcome resistance to existing anticancer drug.

US 2011-0159022 A1

Treatment of brain tumors, such as glioblastoma, and conventional therapies (such as temozolomide and / or radiation therapy) by the combination of the Midkine inhibitor alone or the combination of the midkine inhibitor and Temozolomide The use of midkines to overcome resistance is provided.

One example provides a pharmaceutical composition for the prevention and / or treatment of brain tumors, which comprises a Midkine inhibitor as an active ingredient.

Another example provides a pharmaceutical composition for the prevention and / or treatment of brain tumors, which comprises a midkine inhibitor and temozolomide as an active ingredient.

Other examples include a combination of a midkine inhibitor (or a pharmaceutical composition comprising a midkine inhibitor as an active ingredient) or a midkine inhibitor and temozolomide (or a pharmaceutical composition comprising a midkine inhibitor and temozolomide as an active ingredient) Drugs; And a kit for preventing and / or treating brain tumors including a radiation irradiation apparatus.

Another example provides a method for preventing and / or treating brain tumors, comprising administering a midkine inhibitor to a subject in need of prevention and / or treatment of a brain tumor. The method for preventing and / or treating the brain tumor may further include irradiating the tumor with the radiation before, simultaneously with, or after the step of administering the midkine inhibitor.

Another example provides a method for preventing and / or treating brain tumors, comprising coadministering a midkine inhibitor and temozolomide to a subject in need of prevention and / or treatment of a brain tumor. The method for preventing and / or treating brain tumors may further include irradiating the subject with radiation before, simultaneously with, or after the step of administering the combination of the midkine inhibitor and temozolomide.

The brain tumor that is the subject of the prevention and / or treatment may be a glioma (e. G., Glioblastoma) that is resistant to conventional chemotherapy treatments such as glioblastoma or temozolomide and / or radiation therapy.

Another example of the present invention provides a pharmaceutical composition for inhibiting tumor stem cells of brain tumors containing a midkine inhibitor as an active ingredient, for inhibiting stem cell function of tumor cells, or for preventing the recurrence of brain tumors.

Another example is a method for inhibiting tumor stem cells in a brain tumor comprising administering a midkine inhibitor to a subject in need thereof for inhibiting tumor stem cells of a brain tumor or inhibiting stem cellization of tumor cells, Thereby providing a method for preventing recurrence of a brain tumor.

Other examples provide for resistance to or overcoming resistance to existing chemotherapeutic treatments of midkine inhibitors, such as chemotherapy for brain tumors (such as radiation therapy and / or temozolomide therapy).

Specifically, one example provides a pharmaceutical composition for radiation therapy comprising a midkine inhibitor as an active ingredient and / or for overcoming resistance or increasing reactivity to temozolomide.

Another example is a method of overcoming resistance to temozolomide and / or radiation therapy and / or a method of overcoming resistance to temozolomide and / or radiation therapy, comprising administering a midkine inhibitor to a subject in need of radiation therapy and / or resistance to or resistance to temozolomide. Or a reactive enhancement method.

The resistance to temozolomide and / or radiation therapy may be resistance to temozolomide and / or radiation therapy of a brain tumor (e. G., Glioblastoma).

Another example provides a pharmaceutical composition for enhancing the efficacy of temozolomide and / or radiation therapy comprising a midkine inhibitor as an active ingredient.

Another example provides a method of enhancing the efficacy of temozolomide and / or radiation therapy comprising the step of administering a midkine inhibitor to a subject in need of increasing the efficacy of the temozolomide and / or radiation therapy.

A subject in need of such an increase in the efficacy of the temozolomide and / or radiation therapy may be a brain tumor patient, such as a glioblastoma patient, or a brain tumor patient with resistance to temozolomide and / or radiation therapy, such as a glioblastoma patient have.

Another example is the step of contacting the candidate compound with a brain tumor test group cell and measuring the expression level (mRNA amount) of the midkine protein amount and / or the midkine gene of the test group cell after the candidate compound contact, Comparing the amount of midkine protein and / or the amount of metastatic expression of a midkine gene in a brain tumor comparison cell group that has not been in contact with the candidate compound before or in the presence of the candidate compound, or a temozolomide for overcoming resistance to temozolomide in brain tumors A method for screening a therapeutic agent for a resistant brain tumor.

The screening method is characterized in that when the amount of the midkine protein and / or the expression amount of the midkine gene in the test group cells is lower than that in the comparison group cells after the comparing step, the candidate compound is overcome resistance to the temozolomide of the brain tumor Or as a candidate for a therapeutic agent for temozolomide-resistant brain tumors.

The brain tumor test cell and the brain tumor comparison cell may be derived from the same brain tumor patient. The brain tumor may be a glioblastoma, and the brain tumor cell may be a glioblastoma cell.

In this specification, as the malignancy of the brain tumor increases, the expression level of the midkine (MDK) increases, and the higher the expression level of the midkine, the worse the prognosis of the brain tumor. It has also been found that by inhibiting midkine at the protein and / or gene level it is possible not only to inhibit the growth of tumor cells of brain tumors (e.g. glioblastoma) but also to inhibit stem cell function. In addition, when the midkine inhibitor is administered in combination with the conventional treatment of brain tumors such as Temozolomide and / or radiation treatment, administration of temozolomide or radiolabel alone, or administration of temozolomide and radiation treatment It was confirmed that the anticancer effect can be obtained even in the case of brain tumors resistant to temozolomide and / or radiation therapy as compared with the case of concurrent therapy.

Midkine (MDK), also called neurite growth-promoting factor 2 (NEGF2), is a protein encoded by the MDK gene. Midkine is an autocrine growth factor of cells. Midkine is a low molecular weight heparin-binding growth factor and is a nonglycosylated protein composed of two domains linked by disulfide bridges. The midkine or its sublingual gene described herein may be derived from a mammal (such as a mammal), such as a primate such as a human, a monkey, or a rodent such as a mouse or a rat. For example, the midkines may be selected from the group consisting of human midkines (e.g., NCBI Accession Numbers NP_001012333.1, NP_001012334.1, NP_001257479.1, NP_001257480.1, NP_001257481.1, NP_002382.1, (For example, NCBI Accession Numbers NM_001012333.2, NM_001012334.2, NM_001270550.1, NM_001270551.1, NM_001270551.1, etc.) (MRNA) (e.g., NCBI Accession Numbers NM_001012335.2, NM_001012336.2, NM_010784.4, NM_001291481.1, NM_001291482.1 , NM_001291483.1, etc.), and the like. The midkine gene may be a gene encoding a human midkine (for example, NCBI Accession Numbers NP_001012333.1, NP_001012334.1, NP_001257479.1, NP_001257480.1, NP_001257481.1, NP_002382.1, etc.) (For example, NCBI Accession Numbers NM_001012333.2, NM_001012334.2, NM_001012334.2, etc.), which encode a gene coding for a gene encoding a protein, for example, CBI Accession Numbers NP_001012335.1, NP_001012336.1, NP_001278410.1, NP_034914.1, NM_001270550.1, NM_001270551.1, NM_001270552.1, NM_002391.4, etc.), mouse midkine gene (mRNA) (for example, NCBI Accession Numbers NM_001012335.2, NM_001012336.2, NM_010784.4, NM_001291481.1, NM_001291482. 1, NM_001291483.1, etc.), and the like.

Temozolomide (TNZ) is also sometimes referred to by the trade name Temodar, Temodal, Temcad and the like, and the IUPAC designation is 4-methyl-5-oxo-2,3,4,6,8-pentagayjicyclo [4.3.0 ] Nona-2,7,9-triene-9-carboxamide (4-methyl-5-oxo-2,3,4,6,8-pentazabicyclo [4.3.0] triene-9-carboxamide). Temozolomide is an alkylating agent that is widely used in the treatment of brain tumors.

As described herein, a brain tumor refers to both brain tissue and tumors that arise in the surrounding membrane tissue, and may be primary brain tumors or metastatic brain tumors. In one example, the brain tumor can be a glioma, a glioblastoma, a meningioma (meningioma), a pituitary adenoma (adenoma), or a schwannoma, such as a glioblastoma.

An example of the present invention provides a pharmaceutical composition for the prevention and / or treatment of brain tumor comprising a midkine inhibitor as an active ingredient. The midkine inhibitor may be included in a pharmaceutically effective amount to achieve the desired effect.

Another example provides a method for preventing and / or treating brain tumors, comprising administering a midkine inhibitor to a subject in need of prevention and / or treatment of a brain tumor. The midkine inhibitor may be administered in a pharmaceutically effective amount to achieve the desired effect. The method may further comprise identifying a subject in need of prevention and / or treatment of a brain tumor prior to the administering step.

As described above, it is also possible to inhibit the growth of tumor cells of a brain tumor (for example, glioblastoma) by inhibiting the midkine at the protein and / or gene level as well as to inhibit stem cell function, It is possible to treat cancer more effectively and fundamentally, and it is also effective in preventing recurrence of cancer.

In addition, when the midkine inhibitor is administered in combination with the existing typical brain tumor treatment method, such as temozolomide administration and / or radiation treatment, administration of temozolomide or radiosensitization alone or in combination with administration of temozolomide and radiation treatment (Anticancer effect) as well as an anticancer effect against brain tumors resistant to temozolomide and / or radiation therapy, as compared with the case where the administration of temozolomide and / Or reduce the dose of radiation and / or increase the interval between administration and / or irradiation, thereby reducing the adverse effects to the patient.

Thus, the prevention and / or treatment of the brain tumor may further include the administration of temozolomide and / or the step of irradiating to obtain a more effective effect.

Accordingly, another example provides a pharmaceutical composition for preventing and / or treating brain tumors, which comprises a midkine inhibitor and temozolomide as an active ingredient. In one embodiment, the midkine inhibitor and temozolomide may be in a form for simultaneous administration of the two drugs, wherein the medicament inhibitor and the temozolomide are mixed to form a single formulation (blend). In another embodiment, the midkine inhibitor and temozolomide may be in a form for simultaneous or sequential administration of both drugs, wherein the medicament is a midkine inhibitor and temozolomide, respectively. In this case, the pharmaceutical composition comprises a first pharmaceutical composition comprising a midkine inhibitor as an active ingredient, and a second pharmaceutical composition comprising temozolomide as an active ingredient, for simultaneous or sequential administration, Lt; / RTI > In the case of sequential administration, the order may be reversed.

Other examples include a combination of a midkine inhibitor (or a pharmaceutical composition comprising a midkine inhibitor as an active ingredient) or a midkine inhibitor and temozolomide (or a pharmaceutical composition comprising a midkine inhibitor and temozolomide as an active ingredient) Drugs; And a kit for preventing and / or treating brain tumors including a radiation irradiation apparatus. The kit may include the drug and the irradiation device in a connected state, or may be contained separately from each other so that a series of therapies can continuously irradiate the drug regardless of the order of administration of the drug or sequentially. have. The radiation irradiating apparatus can be selected from among all conventional apparatuses used for irradiating radiation of a desired radiation dose (for example, a radiation dose applied to brain tumor treatment). For example, the radiation emitting apparatus may be configured to deliver a radiation dose of about 1 Gy to about 6 Gy, about 1 Gy to about 4 Gy, about 1 Gy to about 2 Gy, about 2 Gy to about 6 Gy, about 2 Gy to about 4 Gy, or about 4 Gy to about 6 Gy But is not limited thereto. In one example, devices that can be used for radiation include, but are not limited to, IBL 437C blood Irradiator (CIS US, Inc., Bedford, Mass.).

As described above, when the midkine inhibitor is administered to a brain tumor such as a glioblastoma patient, the stem cell ability of the tumor cell of the brain tumor (for example, glioblastoma) is suppressed and the brain tumor tumor stem cell is decreased (death, proliferation inhibition, etc.) , And the recurrence rate of the brain tumor can be remarkably reduced by such inhibition of tumor stem cell.

Accordingly, another example provides a pharmaceutical composition for inhibiting tumor stem cells of a brain tumor, which contains a midkine inhibitor as an active ingredient, or for inhibiting stem cell function of tumor cells.

Another example is a method for inhibiting tumor stem cells in a brain tumor, inhibiting stem cellization of a tumor cell, or a method for inhibiting tumor cell proliferation in a brain tumor comprising administering a midkine inhibitor to a subject in need thereof for inhibiting tumor stem cells of a brain tumor or inhibiting stem cellization of tumor cells, Thereby providing a method for preventing recurrence of a brain tumor.

The tumor stem cell inhibition means to numerically or quantitatively reduce or exterminate the induction of tumor cell death and proliferation inhibition of brain tumor (e.g., glioblastoma). Said inhibition of stem cellization means that tumor cells of a brain tumor (e. G., Glioblastoma) inhibit stem cellization. Prevention of recurrence of a brain tumor means preventing the brain tumor (e.g., glioblastoma) from being regenerated or deteriorated after treatment or improvement.

In the above pharmaceutical compositions and kits, the midkine inhibitor and the temozolomide may each be included in a pharmaceutically effective amount to obtain a desired pharmacological effect.

Also, the method for preventing and / or treating brain tumors, which comprises administering the midkine inhibitor to a subject in need of prevention and / or treatment of a brain tumor, may be administered before, concurrently with, or after the step of administering the midkine inhibitor, The method comprising the steps of:

Another example provides a method for preventing and / or treating brain tumors, comprising coadministering a midkine inhibitor and temozolomide to a subject in need of prevention and / or treatment of a brain tumor. The conjoint administration may be carried out either simultaneously with the midkine inhibitor and temozolomide, or sequentially, irrespective of the order (for example, the first step comprising the midkine inhibitor and the second administration step of administering temozolomide) In order to achieve the desired result. The method for preventing and / or treating brain tumors may further include irradiating the subject with radiation before, simultaneously with, or after the step of administering the combination of the midkine inhibitor and temozolomide. The midkine inhibitor and the temozolomide may each be administered in a pharmaceutically effective amount. The method may further comprise identifying a subject in need of prevention and / or treatment of a brain tumor prior to the administering step.

The brain tumor that is the subject of the prevention and / or treatment may be a glioma (e. G., Glioblastoma) that is resistant to conventional chemotherapy treatments such as glioblastoma or temozolomide and / or radiation therapy. The treatment of the brain tumor may include treatment of tumor cell proliferation, apoptosis, and / or inhibition of stem cell function and / or recurrence of brain tumor and / Overcome resistance to chemotherapy (e.g., radiation therapy and / or temozolomide therapy, etc.) (increased responsiveness (sensitivity)), and the like.

The subject to whom administration and / or irradiation (i. E., A subject in need of prevention and / or treatment of a brain tumor) may be a subject suffering from brain tumor (e. G., Glioblastoma) And mammals including rodents including mice, rats, and the like, cells and tissues isolated therefrom, and cultures thereof. In particular, the subject may be a mammal, including primates, including humans, monkeys, etc., having a birth or acquisition resistance to temozolomide and / or radiation therapy, rodents including mice, rats, etc., Cells and tissues, and cultures thereof.

As used herein, the term " midkine inhibitor " may be used generically to mean all compounds and compositions that target a midkine protein or gene to decrease binding and / or activity and / or loss of activity.

For example, the midkine inhibitor may be a midkine protein or a protein (specifically binding) to a gene (a molecule comprising more than 100 amino acids; e.g., an antibody), a peptide (a molecule comprising 1 to 100 amino acids; (E.g., siRNA, shRNA, microRNA, aptamer, etc.), small molecule compounds, and pharmaceutically acceptable salts thereof, and the like. The antibody may have one or more, two or more, three or more, four or more, or five or more (for example, one to thirty , 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 2 to 30, 2 to 25, 2 to 20, 2 to 15, 2 to 10 , 2 to 5, 3 to 30, 3 to 25, 3 to 20, 3 to 15, 3 to 10, 3 to 5, 4 to 30, 4 to 25, 4 to 20 , 4 to 15, 4 to 10, 4 to 5, 5 to 30, 5 to 25, 5 to 20, 5 to 15, 5 to 10, or 5 to 7 amino acid residues (For example, IgA, IgD, IgE, IgG, IgG2, IgG3, IgG4, IgM, etc.) in the form of all subtypes of immunoglobulins scFv, (scFv) 2, scFv-Fc, Fab, Fab ', F (ab') 2, etc.). The antibody may be a monoclonal antibody or a polyclonal antibody. The antibody may be a mouse antibody, a chimeric antibody, a humanized antibody, or a human antibody. The antibody may be derived from a hybridoma or recombinantly or chemically synthesized. The aptamer may have 5 to 100 (for example, 5 to 90, 5 to 80, 5 to 70, 5 to 60, 5 to 50, and 5, (E.g., 5 to 90 nt, 5 to 80 nt, 5 to 70 nt, 5 to 60 nt, 5 to 20 nt) of the peptide molecule or 5 to 10 nt (nucleotide) 50 nt, 5 to 40 nt, 5 to 30 nt, or 5 to 20 nt) oligonucleotide molecules. The oligonucleotide may be a sequence of three or more, four or more, or five or more (e.g., 3 to 50, 3 to 45, and 3, 3 to 15, 3 to 35, 3 to 30, 3 to 25, 3 to 20, 3 to 15, 3 to 10, 3 to 5, 4 to 50, 4 to 45, 4 From 4 to 35, from 4 to 35, from 4 to 30, from 4 to 25, from 4 to 20, from 4 to 15, from 4 to 10, from 4 to 5, from 5 to 50, from 5 to 45, 5 to 20, 5 to 15, 5 to 10, or 5 to 7 nucleotides) that specifically bind to the nucleotide region of SEQ ID NO: 3 to 80, 3 to 70, 3 to 60, 3 to 50, 5 to 100, 5 to 90, 5 to 80, 5 to 70, 5 to 100, 3 to 90, To 60, 5 to 50, 10 to 100, 10 to 90, 10 to 80, 0.0 > 70 < / RTI > nucleotides, 10 to 60 nucleotides, or 10 to 50 nucleotides.

In one example, the midkine inhibitor may be selected from the group consisting of RNA Aptamer (see for example British Journal of Pharmacology (2014) 896-904), midkine target Antisense (see, for example, US 2011-0159022 A1 ), Antimedic antibodies (e.g., CELLMID limited products (see e.g., US 9163081), midkine inhibitory compounds (e.g., Axon Medchem's iMDK (CAS no. 881970-80-5), Calbiochem's iMDK - (4-Fluorobenzyl) imidazo [2,1-b] thiazol-6-yl) -2H-chromen-2- 3] thiazol-6-yl) -2H-chromen-2-one) and shRNA for the midkine gene (for example, SEQ ID NO: 1 and SEQ ID NO: 2) But is not limited thereto.

Another example provides a pharmaceutical composition for radiation therapy comprising a midkine inhibitor as an active ingredient and / or for overcoming or increasing resistance to temozolomide.

Another example is a method of overcoming resistance to temozolomide and / or radiation therapy and / or a method of overcoming resistance to temozolomide and / or radiation therapy, comprising administering a midkine inhibitor to a subject in need of radiation therapy and / or resistance to or resistance to temozolomide. Or a reactive enhancement method.

The resistance to temozolomide and / or radiation therapy may be resistance to temozolomide and / or radiation therapy of a brain tumor (e. G., Glioblastoma).

The resistance to the temozolomide and / or radiation therapy is believed to be due to the anticancer effects such as reduction of tumor cells, loss of tumor cells, reduction of tumor size / volume and / or extinction at the time of treatment with brain tumors by administration of temozolomide and / It does not appear to be therapeutically significant even though it does not appear or appears, or it may mean that the anticancer effect does not appear depending on the dose of the temozolomide and / or the dose of radiation.

Resistance to the above temozolomide and / or radiation therapy is overcome because the anticancer effects such as reduction of tumor cells, disappearance, reduction of tumor size / volume, and the like are not resistant at the time of treatment of brain tumor by administration of temozolomide and / May be indicative of a similar or therapeutically significant level as in brain tumors or an anticancer effect depending on the dosage and / or radiation dose of temozolomide (i. E., Proportional to dose and / or dose) have.

As used herein, unless otherwise stated, overcoming resistance to temozolomide and / or radiation therapy may be used synonymously with the enhancement of sensitivity to temozolomide and / or radiation therapy.

Another example provides a pharmaceutical composition for enhancing the efficacy of temozolomide and / or radiation therapy comprising a midkine inhibitor as an active ingredient.

Another example provides a method of enhancing the efficacy of temozolomide and / or radiation therapy comprising the step of administering a midkine inhibitor to a subject in need of increasing the efficacy of the temozolomide and / or radiation therapy.

The efficacy enhancement means that the anticancer efficacy against brain tumors such as glioblastoma is enhanced compared to the case where each of the administration of temozolomide or radiotherapy is performed alone, and the anticancer efficacy is enhanced by the administration of brain tumor (for example, glioblastoma) (S) selected from the group consisting of a decrease in the number of tumor cells (increase in proliferation inhibition and / or apoptosis), disappearance, reduction in tumor size / volume and / or extinction, inhibition of stem cell function, prevention of recurrence of brain tumors Or more.

A subject in need of such an increase in the efficacy of the temozolomide and / or radiation therapy may be a brain tumor patient, such as a glioblastoma patient, or a brain tumor patient with resistance to temozolomide and / or radiation therapy, such as a glioblastoma patient have.

The radiation treatment refers to radiation therapy applied to conventional brain tumor treatment. The dose of radiation is various factors such as patient age, patient's health condition, brain tumor type, lesion site, lesion size, tumor grade, Can be prescribed. For example, the radiation therapy can be used to treat a lesion with a radiation dose of about 1 Gy to about 6 Gy, about 1 Gy to about 4 Gy, about 1 Gy to about 2 Gy, about 2 Gy to about 6 Gy, about 2 Gy to about 4 Gy, About 10 Gy to about 40 Gy, about 10 Gy to about 35 Gy, about 10 Gy to about 50 Gy, about 10 Gy to about 45 Gy, about 10 Gy to about 40 Gy, about 10 Gy to about 35 Gy, From about 10 Gy to about 30 Gy, from about 10 Gy to about 25 Gy, or from about 10 Gy to about 20 Gy, but is not limited thereto.

In addition to the active ingredient (midkine inhibitor and / or temozolomide), the above-mentioned pharmaceutical composition, the combination, the first pharmaceutical composition and / or the second pharmaceutical composition may contain additives such as a pharmaceutically acceptable carrier, diluent, and / . ≪ / RTI >

The pharmaceutically acceptable carriers are those conventionally used for the formulation of drugs and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, calcium silicate, It may be at least one selected from the group consisting of cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. But is not limited thereto. The pharmaceutically acceptable additives may be at least one selected from the group consisting of diluents, excipients, lubricants, wetting agents, sweeteners, flavoring agents, emulsifying agents, suspending agents, preservatives and the like commonly used in the production of pharmaceutical compositions.

The combination or pharmaceutical composition may be administered orally or parenterally. In the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, muscle injection, intraperitoneal injection, endothelial administration, topical administration, intranasal administration, intrapulmonary administration and intrathecal administration. When administered orally, the protein or peptide is extinguished and the oral composition should be formulated to coat the active agent or protect it from degradation from above. In addition, the composition may be administered by any device capable of transferring the active agent to the target cell.

As used herein, " pharmaceutically effective amount " means the amount by which a drug can exhibit a pharmaceutically significant effect. The pharmaceutically effective amount of the midkine inhibitor for single administration and the pharmaceutically effective amount of temozolomide can be determined by the method of formulation, the manner of administration, the age, weight, sex, pathological condition, food, administration time, The route of administration, the rate of excretion, and the responsiveness of the drug. For example, the pharmaceutically effective amount of each of the midkine inhibitor and temozolomide for a single dose may be in the range of 0.001 to 100 mg / kg, or 0.01 to 10 mg / kg, but is not limited thereto.

The pharmaceutically effective amount for the single administration may be formulated into a single dosage form in unit dosage form, formulated in an appropriate amount, or introduced into a multi-dose container. In the kit, the pharmaceutical effective amount of the midkine inhibitor for single administration and the pharmaceutically effective amount of temozolomide may be contained in the packaging container as basic units, respectively.

The administration interval between co-administrations, which is defined as the period from the combination administration of the midkine inhibitor to the temozolomide to the next combination administration after combination administration is 6 to 30 days, such as 8 to 30 days, 12 to 30 days , 24 hours to 30 days, 3 days to 30 days, or 7 days to 14 days, but is not limited thereto. When the above-mentioned coadministering is to sequentially administer a first pharmaceutical composition comprising a midkine inhibitor as an active ingredient and a second pharmaceutical composition comprising temozolomide as an active ingredient, the first pharmaceutical composition and the second pharmaceutical composition The administration interval may be simultaneous, or 0.1 to 60 minutes (for example, 0.1 to 30 minutes, 0.1 to 10 minutes, 1 to 30 minutes, or 1 to 10 minutes), and the administration order may be mutually different.

Such a mixture or pharmaceutical composition may be in the form of a solution, suspension, syrup, or emulsion in an oil or aqueous medium, or may be formulated in the form of an excipient, powder, granule, tablet, or capsule, A stabilizer may additionally be included.

Another example is

Contacting the candidate compound with a brain tumor test group cell;

Measuring the amount of the midkine protein and / or the expression amount (mRNA amount) of the midkine gene in the test group cells after the candidate compound is contacted; And

Comparing the measured amount of the midkine protein amount and / or the expression amount of the midkine gene with the amount of the midkine protein and / or the amount of the midkine gene in the brain tumor comparison cell group before or during the contact with the candidate compound step

And a method for screening a therapeutic agent for brain tumors resistant to temozolomide and / or a medicament for overcoming resistance to temozolomide and / or radiation therapy and / or temozolomide.

The screening method may further include the step of measuring the amount of the midkine protein and / or the expression amount (mRNA amount) of the midkine gene in the brain tumor comparison group cells.

The screening method is characterized in that when the amount of the midkine protein and / or the expression amount of the midkine gene of the test group cells is decreased as compared with that of the comparative group cells after the comparing, the candidate compound is treated with radiation therapy of brain tumors and / Or as a candidate for a therapeutic agent for radiation therapy and / or temozolomide-resistant brain tumor.

The brain tumor test cell and the brain tumor comparison cell may be (brain) brain tumor cells or culture thereof derived from the same brain tumor patient. The brain tumor may be a glioblastoma, and the brain tumor cell may be a glioblastoma cell.

The candidate compound may be selected from the group consisting of various compounds such as proteins, polypeptides, oligopeptides, polynucleotides, oligonucleotides, various chemical substances, and extracts.

In one embodiment, the expression amount of the midkine protein amount or the midkine gene can be measured by a conventional method.

For example, the amount of the midkine protein can be measured by a conventional enzyme reaction, fluorescence, luminescence and / or radiation detection using a compound that binds to the midkine protein, an antibody, an aptamer, etc. Specifically, Immunochromatography, immunohistochemical staining, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay (EIA), fluorescence immunoassay FIA, LIA, Western blotting, microarray method, and the like, but the present invention is not limited thereto.

Also, the expression level of the gene encoding the midkine (full-length DNA, cDNA, or mRNA) can be measured by the mRNA level, and the mRNA level can be measured using a conventional gene analysis method. For example, (PCR), fluorescent in situ hybridization (FISH), microarray method, or the like using a conventional gene analysis method using primers, probes, or aptamers, for example, a polymerase chain reaction It is not. In one embodiment, the primer detects a gene segment of 5-1000 bp, such as 10-500 bp, 20-200 bp, or 50-200 bp in the nucleotide sequence of the gene encoding the midkine (full-length DNA, cDNA, or mRNA) (E. G., Complementary) to a consecutive 5-100 bp, such as 5-50 bp, 5-30 bp, or 10-25 bp sites of each of the 3'- and 5'-ends of the gene fragment, It may be a pair of primers including a base sequence. The probe or the aptamer may have a total length of 5 to 100 bp, 5 to 50 bp, 5 to 30 bp, or 5 to 25 bp. The probe or the aptamer may be a continuous sequence of a gene encoding a midkine (full-length DNA, cDNA or mRNA) (For example, complementary) to a gene fragment of 5 to 100 bp, 5 to 50 bp, 5 to 30 bp, or 5 to 25 bp, The term " hybridizable " means that the gene can bind to the gene site by chemical and / or physical bonding such as covalent bond, and the 'hybridization possible' means that the base sequence of the gene region is 80 Or more, such as 90%, 95%, 98%, 99%, or 100% complementarity.

In this study, we investigated the effect of midcain, the autocrine growth factor of glioblastoma cell, on the proliferation of tumor cells, and showed usability as a target for the treatment of new glioblastoma. do. It is also possible to obtain an elevated anticancer effect by using the midkine inhibitor alone or in combination with temozolomide and / or radiation therapy for the treatment of brain tumors, such as glioblastoma, and to treat existing brain tumors such as temozolomide and / (E. G., Glioblastoma) that is resistant to < / RTI >

FIG. 1 is an image (bar: 100um) showing the results of immunohistochemistry staining of midcain protein in tumor tissue and normal tissue of a glioblastoma patient.
FIG. 2 is an image showing the result of observing the level of midkine protein expression in tumor cells of a glioblastoma patient with a West blot.
FIG. 3 is a graph showing the relative absorbance of the N827 glioblastoma cell culture medium when treated with midkine (MDK) neutralizing antibody and IgG (control) according to antibody treatment concentration.
FIG. 4 is a graph showing the results of measuring the degree of cell proliferation in MDC neutralizing antibody treatment and IgG (control) treatment in three types of glioblastoma cell cultures of N131, 047T, and N827.
FIG. 5 shows the results of microscopic observation of cell morphology (right side) and number of tumor cells on day 11 after treatment of MDK neutralizing antibody and IgG (control group) on three types of glioblastoma cells of N131, 047T and N827 Graph (left).
Figure 6 shows Western blot results for shRNA treatment of MDK in two glioma cell types N131 and N827.
FIG. 7 is a graph showing the cell proliferation rate (expressed as relative ATP) in the case of treating MDK with shRNA in N827 glioblastoma cells compared with the case (NT) in which shRNA was not treated.
FIG. 8 shows a graph (middle) showing the tumor shape (top), the number of cells in which no tumor sphere was formed, and a numerical result (bottom) of shRNA treatment of MDK on N131 glioblastoma cells.
FIG. 9 shows a graph (middle) showing the tumor shape (top), the number of cells in which no tumor sphere was formed, and a numerical result (bottom) of shRNA treatment of MDK on N827 glioblastoma cells.
FIG. 10 shows graphs of cell proliferation and microscopic observation images of three types of glioblastoma cells of N131, 047T, and N827 when MDK-targeted neutralizing antibody and TMZ were treated alone .
FIG. 11 is a photograph showing the cell formation state of the glioblastoma when the irradiation alone (control) and the irradiation with the midkine target antibody are combined (anti-MDK) by irradiation dose.
FIG. 12 is a graph showing the cell counts of anti-MDK in the case of glioblastoma treated only with radiation and control with a midkine target antibody (anti-MDK) by irradiation dose.
FIG. 13 is an image showing the results of observing the brains of mouse brain model injected with midkine knockdown (shMDK infected) N827 cells and N827 cells (no midkine knockdown) through H & E (Hematoxylin and Eosin) staining.
14 is a graph showing the survival period of a brain mouse model injected with midkine knockdown (shMDK infected) N827 cells and N827 cells (without midkine knockdown), respectively.

Hereinafter, the present invention will be described in detail with reference to examples.

However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  1: in glioblastoma patient tissue Midkine ( MDK ) Expression confirmation

Immunohistochemistry revealed the expression level of midkine protein in cancer tissues and normal tissues of glioblastoma patients. The tumor tissues (NS234 Tumor & NS320 Tumor, provided by Samsung Medical Center) and normal tissues (NS234 Normal & NS320 Normal, provided by Samsung Medical Center) were fixed in paraffin and treated with xylene for 15 minutes to obtain deparaffinization , And then hydrated by treatment with 100% (v / v) ethanol for 10 minutes, 95% (v / v) ethanol for 10 minutes, and dH2O for 5 minutes. The hydrated tissue was boiled for 10 minutes to proceed with antigen unmasking.

Then, the cells were washed three times for 5 minutes each with dH2O, treated with 3% (v / v) hydrogen peroxide for 10 minutes, washed once with dH2O for 5 minutes, and then washed with wash buffer for 5 minutes. 1XTBS / 0.1% (v / v) Tween-20 (1XTBST) was used as the wash buffer. After washing, the cells were washed with blocking solution (1% (v / v) BSA (Bovine Serum Albumin, cat. A2153-100G, Sigma- Aldrich) in PBS (cat. 10-010-049, Gibco) v) for 30 min at room temperature with 300 ul of Triton X100 (cat. T8787, Sigma-Aldrich) + 5% (v / v) 2 'Ab host serum (normal goat serum, cat. After removing the blocking solution, the Midkine primary antibody (Abcam, ab52637) was diluted 1: 250 in 1% (v / v) BSA in PBS + 0.025% (v / v) TritonX100 and treated at 4 overnight.

After the primary antibody treatment, the antibody was removed and washed with wash buffer 5 times 3 times. The goat anti-rabbit antibody (BA-1000, Abcam) + 0.025% (v / v) Triton X100 diluted 1: 1000 and treated at room temperature for 1 hour. After 1 hour, washing was performed 3 times for 5 minutes with wash buffer, and 1-2 drops of SignalStain Boost IHC Detection Reagent (HRP, Rabbit, # 8114) was added to each tissue and incubated at room temperature for 30 minutes. At the end of incubation, the detection reagent was removed, washed 3 times for 5 minutes in wash buffer, and then 1/10 diluted DAB (diaminobenzidine) solution was applied to each tissue in an amount of 200 ul. After staining, the cells were washed with dH2O, stained with hematoxylin for 30 seconds, and then washed twice with dH2O for 5 minutes. After that, the cells were treated with 80% (v / v) ethanol twice for 10 seconds, 95% (v / v) ethanol twice for 10 seconds, 100% (v / v) ethanol for 10 seconds, dehydration and mounting.

Immunohistochemistry results obtained are shown in Fig. FIG. 1 shows MDK expression level in normal brain tissue and brain tumor tissue of the same patient through immunochemical staining, and it can be confirmed that MDK is specifically elevated in brain tumor tissue.

In addition, 11 types of tumor cells derived from glioblastoma patients (named as N131, 096, 047, 022, 783, 464, 352-1, 352-2, 559, 448 and N827, Lt; / RTI >

The western blot was gel-loaded (100 V) for 12 h in SDS PAGE gel, and each cell lysate was loaded in an amount of 30 ug. Blocking was performed for 1 h at room temperature with 5% (v / v) BSA after transfer . Anti-rabbit HRP-linked secondary antibody (cell signaling, 7074S) was incubated at room temperature for 2 hours at room temperature, washed three times for 10 minutes each with 1XTBST, and then treated with Midkine (Abcam, ab52637) and GAPDH For 1 hour. After washing three times for 10 min at 1 × TBST, the membrane was developed by spraying SuperSignal West Dura Extended Duration Substrate (Termo scientific, 34075) solution.

The results obtained are shown in Fig. As shown in FIG. 2, MDK expression was confirmed in 9 kinds of cells except for 464 and 352-2 cells among 11 types of tumor cells, and it was confirmed that MDK expression was highly related to glioblastoma.

Example  2: for glioblastoma tumor cells Midkine  Neutralizing antibody treatment effect

In order to determine the treatment concentration of the midkine neutralizing antibody, the ELISA was carried out using the culture medium of N827 glioblastoma cells prepared in Example 2 above. The ELISA was carried out using the Human Midkine Standard ELISA Development Kit (PeproTech, 900-K190; the reagents used in the following tests and the antibody used in this kit).

For ELISA plate preparation, the capture antibody was diluted to 1 μg / ml in PBS, and 100ul (microliter) per well was sealed and incubated at room temperature overnight. After incubation, Suction was added and 300 μl wash buffer (0.05% (v / v) Tween-20 in PBS per well) was added to wash 4 times. After the last washing, the plate was placed on a paper towel, dried to remove the buffer completely, and 300 μl of block buffer (1% (v / v) BSA in PBS) was added to each well and incubated at room temperature for 1 hour. After that, it was suctioned again and then washed 4 times with 300 μl wash buffer per well.

The experimental group was designed to calculate only the absorbance of the pure cell itself except for the standard values (2 ng, 1 ng, 0.5 ng, 0.25 ng, 0.125 ng, 0 ng) and media only ), And Midkine target neutralizing antibody (MK (H-65)), IgG (normal Rabbit IgG (cat. AB-105-C, (0, 0.156, 0.625, 2.5, 10 ug / ml) treated with Antibody (cat.sc-20715, SANTA CRUZ BIOTECHNOLOGY) well preparation) and incubated at room temperature for 2 hours. After incubation, the sample was suctioned and washed 4 times with 300 μl wash buffer per well.

For detection, the detection antibody was diluted to 1 ug / ml and dispensed at 100 μl per well, followed by incubation at room temperature for 2 hours. After 2 hours, it was suctioned and washed 4 times with 300 μl wash buffer per well. 5.5 μl of Avidin-HRP was diluted 1: 2000 in 11 ml of diluted solution, and 100 μl of each dilution was dispensed into each well. The Avidin-HRP was conjugated by incubation at room temperature for 30 minutes. Samples were washed and washed 4 times with 300 μl wash buffer per well, and 100 μl of substrate solution was added to each well. Color development was confirmed by ELISA plate reader at 405 nm with wavelength correction set at 650 nm.

The obtained results are shown in Fig. The Y axis in FIG. 3 represents relative absorbance, and the absorbance of each group measured in the above test is a relative value to the absorbance (calculated as '1') at 0 g / ml IgG treatment. As shown in FIG. 3, it was confirmed that the case where the relative absorbance difference in the IgG-treated group and the midkine neutralizing antibody-treated group was the highest was the case where the antibody treatment concentration was 10 ug / ml, and then the neutralized antibody The treatment concentration was determined to be 10 ug / ml.

Next, in order to confirm the effect of midkine neutralization on the proliferation of the glioblastoma cells, N131 (indicated as 'N131' in FIG. 4, 047T (indicated as '047' in FIG. 4) and N827 ) Were seeded into each 100 well cell culture medium containing 3,000 cells per well containing 5,000 cells per well and incubated with IgG (10 ug / ml) and Midkine Target Neutralizing Antibody (MK (H) Cytox (EZ-cytox Cell Viability Assay Kit, Daeil Biotech Co., Ltd.) was treated with 1 well After incubation for 1 hour at 37 ° C, the absorbance at 450 nm was measured to determine cell proliferation.

The results obtained are shown in Fig. As shown in FIG. 4, when the midkine neutralizing antibody was treated to suppress the expression of midkine (anti-MDK Ab: □), compared with the IgG-treated control (Control: The survival rate (4-day survival rate) was remarkably decreased. These results indicate that midkine is directly related to the growth of glioblastoma tumor cells.

In order to measure neurosphere formation associated with stem cell stem cells, three types of glioblastoma cells of N131, 047 and N827 were cultured in a 96-well plate in a 100ul cell culture medium (Neurobasal-A 17504-044, life technologies) + B-27 Supplement (50X) (cat. 17504-044, life technologies) + human FGF- (Cat. AF-100-18B, Peprotech) + human EGF (cat. AF-100-15, Peprotech) + Penicillin-Streptomycin (cat. 15140-163, gibco) + L- glutamine 200mM ), 100 seeds of N131 (N131) cells and N827 (N827) cells were seeded to contain 500 cells, and 047 (047) cells were seeded (5 wells per cell) ) And Midkine target neutralizing antibody (MK (H-65) Antibody (cat.sc-20715, SANTA CRUZ BIOTECHNOLOGY) (10 ug / ml; After 11 days, the number of tumors formed by observation with a microscope was confirmed and compared.

The results are shown in Fig. In FIG. 5, the photograph on the right side is a photograph (200X) of the formed tumor taken by a microscope, and the graph on the left is a graph showing the number of tumors observed per well.

As shown in FIG. 5, when the MDK expression was inhibited by the MDK neutralizing antibody antibody treatment, the tumor-forming ability of the cells derived from the glioblastoma-treated cells was decreased, compared with the control (IgG treated) And the size of the sphere is also reduced. These results demonstrate that MDK expression affects the oncogenesis of tumor cells. Treatment of glioblastoma by treatment with MDK target antibody, in particular, more fundamental treatment and / or recurrence of glioblastoma through inhibition of stem cell function of glioblastoma It can be used for prevention.

Example  3: in glioblastoma cells Midkine  Gene Knockdown  effect

To test the effect of a decrease in the gene level of midkines on glioblastoma cells, the midkine gene was knocked down. Specifically, Midkine knockdown virus was infected into N131 and N827 cells (infecting 5X10 ⁶ cells with 40ul of virus), and the protein expression level was confirmed by Western blot. The Midkine knockdown virus (Lentivirus) contains the following two types of shRNAs, respectively:

shRNA 210 (denoted as shRNA①): CCGGCGACTGCAAGTACAAGTTTGACTCGAGTCAAACTTGTACTTGCAGTCGTTTTTG (SEQ ID NO: 1),

ShRNA252 (denoted as shRNA②): CCGGAGGGAAGGGAAAGGACTAGACCTCGAGGTCTAGTCCTTTCCCTTCCCTTTTTTG (SEQ ID NO: 2).

The Midkine knockdown virus was purchased from Sigma-Aldrich in the form of shRNA Glycerol stock (shRNA 210 (denoted as shRNA (TRCN0000331210) and ShRNA252 (denoted as shRNA (TRCN0000331252)).

Western Blot was loaded with 30 μg of each sample lysate in a 12% (w / v) SDS PAGE gel. The cells were transferred to 100 V for 1 hour and then washed with 5% (v / v) Blocking for 1 hour. Anti-rabbit HRP-linked secondary antibody (cell signaling, 7074S) was incubated at room temperature for 2 hours at room temperature, washed three times for 10 minutes each with 1XTBST, and then treated with Midkine (Abcam, ab52637) and GAPDH For 1 hour. After washing three times for 10 min at 1 × TBST, the membrane was developed by spraying SuperSignal West Dura Extended Duration Substrate (Termo scientific, 34075) solution.

The results are shown in Fig. As shown in Fig. 6, it can be seen that the expression of midkine is inhibited in the cell line treated with shRNA for midkine (denoted by shMDK? And shMDK?), Which means that the MDK gene has been successfully knocked down.

Subsequently, in order to confirm the effect of the inhibition of expression at the gene level of midkine on the proliferation of glioblastoma cells, N827 glioblastoma cells in which the obtained midkine gene was knocked down and N827 cells not knocked down (NT (Cat10888-022, gibco) + N-2 Supplement (100X) (cat.17502-048, life technologies) + B-27 Supplement (50X) (cat. (Cat.AF-100-15, Peprotech) + Penicillin-Streptomycin (cat.15140-163, gibco), human FGF-basic (cat.AF-100-18B, Peprotech) + L-glutamine 200mM (cat. 25030, gibco)) were seeded so as to contain 1000 cells (3wells per cell line). Cell proliferation was measured by measuring the relative amount of ATP immediately after seeding, 4 days, and 8 days using ATPlite (ATPlite 1 step 1,000 ml luminescent reagent, cat.6016739, PerkinElmer).

The obtained results are shown in Fig. 7 (shRNA?: ShRNA? (SEQ ID NO: 1) to knock down the midkine gene; shRNA?: ShRNA? (SEQ ID NO: 2) to knock down the midkine gene). As shown in FIG. 7, when the midkine gene is knocked down, the survival rate of the glioblastoma cell is significantly reduced as compared with the case where the midkine gene is knocked down.

N131 and N827 glioblastoma cells that did not knockdown (Midkine knockdown virus infected) and non-knockdown (Midkine knockdown virus infected cells) were used to measure the tumorigenicity of the glioblastoma cell line, And the Limiting Dilution Assay was performed. (100X) (cat.17502-048, life technologies) + B-27 Supplement (50X) (cat. 17504-044, life technologies) + human FGF-basic (cat.AF-100-18B, Peprotech) + human EGF (cat.AF-100-15, Peprotech) + Penicillin-Streptomycin (cat.15140-163, gibco) + L-glutamine 10 wells per group were seeded on a 96-well plate containing 12, 25, 50, and 100 cells in 200 mM (cat.25030, gibco)). After 13 days, the number of wells without tumor formation was checked by a microscope Respectively.

In addition, the measured cell counts were statistically analyzed using a SPSS statistical program (IBM), and it was confirmed whether an average number of cells in each group was enough to form a tumor.

FIG. 8 shows the results obtained for the N131 cell line (top: microscope photograph (200X); middle: graph showing the number of cells in which no tumor sphere was formed; bottom: statistical analysis result). As can be seen from the top and middle of FIG. 8, the ability of tumor formation ability after treatment of the MDK gene target inhibitor (shRNA for MDK) was significantly reduced as compared to the comparative group (shRNA untreated group for MDK: NT) Can be confirmed. In addition, 'Estimate' in the table below means the average number of cells that can form a tumor. (MDK K / D ①) treated with shRNA (1) was able to form 1830 cells, shRNA (2) treated group (MDK K / / D ②), 229.2 cells were able to form tumors. Therefore, tumor formation ability of MDK treated with shRNA (ie, inhibition of MDK expression) compared to untreated group (NT) It can be judged that it is significantly reduced.

FIG. 9 shows the results obtained for the N827 cell line (upper: microscopic photograph (200X); middle: graph showing the number of cells in which no tumor sphere was formed; lower: statistical analysis result). As can be seen from the top and middle of FIG. 9, the ability of tumor formation after treatment of the MDK gene target inhibitor (shRNA for MDK) was significantly reduced compared to the comparative group (shRNA untreated group for MDK: NT) Can be confirmed. In addition, the results of 'Estimate', which means the average number of cells that can form tumor nodules at the bottom of the table, showed that 53.3 cells in the shRNA-untreated group (NT) On the other hand, the MDK K / D (1) and shRNA (2) treated group (MDK K / D2) were able to form tumor parenchyma with 575.7 cells, (That is, when MDK expression was inhibited) was significantly decreased in comparison with the untreated group (NT).

As can be seen from Fig. 8 and Fig. 9, the tumor cell growth ability was compared with that of the comparative group (shRNA-free treatment group against MDK) after treatment with MDK gene target inhibitor (shRNA against MDK) Respectively. This result implies that stem cell function of glioblastoma tumor cells is reduced by the inhibition of MDK gene level in glioblastoma tumor cells (for example, shRNA treatment for MDK). It is considered that MDK gene level inhibitor is a more fundamental treatment of glioblastoma And / or to prevent recurrence.

Example  4: in glioblastoma cells Midkine  Target neutralizing antibody Temozolomide  Combined effect

Proliferation assays were performed to compare the effect of the midcain target neutralizing antibody and temozolomide on the growth of glioblastoma cells. Three types of glioblastoma cells, N131, 047 and N827, were added to a 96-well plate in a 100ul cell culture medium (Neurobasal-A Medium (cat10888-022, gibco) + N-2 Supplement (100X) (cat.17502-048, life technologies ) + B-27 Supplement (50X) (cat.17504-044, life technologies) + human FGF-basic (cat.AF-100-18B, Peprotech) + human EGF (cat.AF- Penicillin-Streptomycin (cat.15140-163, gibco) + L-glutamine 200mM (cat.25030, gibco)) was seeded with 3,000 wells per cell group. The test group consisted of a group containing the culture medium (control: in this case, IgG as a control antibody was treated together at a concentration of 5 ug / ml), Temozolomide (cat.T2577, Sigma-Aldrich) (MK (H-65) Antibody (cat. Sc-1, 3.9, 15.6, 62.5, 250, 1000umol; in this case, IgG as a control antibody was treated together at a concentration of 5 ug / ml) 1, 3.9, 15.6, 62.5, 250, 1000umol (treatment concentration: 5 ug / ml), and the temozolomide and midkine target antibody treatment groups (concentration of treatment with temozolomide: (micromole); concentration of midkine target antibody: 5 ug / ml).

In the case of treatment with the midkine target antibody alone, the antibody was treated at a concentration of 10 ug / ml based on the result of ELISA (see Example 2), but when the midkine target antibody was treated with temozolomide, the proliferation of the glioblastoma cell was reduced The amount of antibody treatment was adjusted to 5 ug / ml in consideration of the effect to be exerted. EZ-Cytox (EZ-cytox Cell Viability Assay Kit, Daeil Biotech Co., Ltd.) was treated with 10ul per well immediately after seeding, 4 days and 6 days, incubated at 37 for 1 hour, and cell proliferation was measured .

The obtained results are shown in Fig. 10 shows the absorbance ratio (relative value) of each experimental group to the absorbance ('1') of control (treated with control IgG alone in the medium). FIG. 10 shows a graph showing the degree of cell proliferation for each cell line and a microscope photograph of the cell. As shown in FIG. 10, when the combination of the midkine target neutralizing antibody and the temozolomide (TMZ) was administered, as compared with the case of administration of only temozolomide (represented by control IgG), the degree of temozolomide- (See graph presented for each cell line). In particular, in the case of the N827 and 047 cell lines, in view of the increase in the cancer cytotoxic effect due to an increase in the temozolomide concentration at a certain interval of the temozolomide concentration at the time of administration of the temozolomide alone (indicated by the control IgG) It is considered to be a cancer cell having resistance to temozolomide. In the case of treatment with a cancer cell-mediated target antibody having resistance to such temozolomide, the improvement effect of the cancer cell death-dependent effect on the temozolomide concentration is restored, It can be confirmed that the effect of the single treatment of zolomide is more remarkable than that of the treatment of cancer. These results show that the combined treatment of temozolomide with a midcain target therapeutic agent shows an anticancer effect against cancer cells having resistance to temozolomide as well as an elevated anticancer effect, Suggesting the use of a midkine target therapeutic.

In addition, as can be seen from the micrographs of the cells shown at the bottom of each cell line results, compared to the test group treated with the control and the temozolomide and the midkine target antibody, the combination of the temozolomide and the midkine target antibody The results show that the combined treatment of temozolomide and a midkine target antibody significantly inhibited the stem cell viability of the glioblastoma cells. The effect of this combination treatment on the stem cell cytotoxicity of the glioma cells was remarkable also in N827 and 047 cell lines which showed resistance to temozolomide.

Example  5: in the glioblastoma cells Midkine  Combination of target neutralizing antibody and radiation therapy

In order to confirm whether the modulation of midkine expression could reduce the radiation resistance of glioma cells, the cell viability of glioblastoma cells was compared with that of irradiated and irradiated and midkine target antibody.

N827 glioblastoma cells were plated at ⁵ × 10 ⁵ cells per well in a 6-well cell culture plate (cat.140675, Termo scientific) and incubated for 24 hours to stabilize the cells. After 24 hours, the prepared cells were irradiated with 0Gy, 2Gy, 4Gy, and 6Gy of radiation with an IBL 437C blood Irradiator (CIS US, Inc., Bedford, MA) (Cat.sc-20715, SANTA CRUZ BIOTECHNOLOGY) was treated with a 5 ng / ml concentration of a midkine target antibody. After incubation for 7 days, the cells were observed. The cell counts of each experimental group were counted, and the number of cells in the group treated with 0Gy of radiation alone (the group not treated with both radiation and midkine target antibody) was 1 The relative cell counts of the other experimental groups were compared as a reference.

FIG. 11 is an image obtained by microscopic observation of the tumor morphology obtained in the above test, and the degree of cell morphogenesis of the glioblastoma cell can be said to indicate stem cell function. As shown in the upper part of FIG. 11 (control (only radiotherapy is performed), when the radiation therapy is performed only, the stem cell ability of the glioblastoma cells does not decrease even when the radiation intensity is increased, but the radiation therapy and the midkine target antibody administration (Anti-MDK), it can be confirmed that the stem cell activity of the glioblastoma cells is remarkably reduced.

12 is a graph showing the number of cells obtained. As shown in FIG. 12, when the glioblastoma cells were only irradiated with radiation (control), there was no cell death (reduction) effect regardless of the dose of radiation (that is, resistance to radiation therapy) (Anti-MDK), the cancer cell death killing effect was found to increase in proportion to the radiation dose. In particular, even when the irradiation dose is 0 and only the midkine target antibody is administered, the cancer cell reduction effect is about 40%, and the anticancer effect against cancer cells having radiation resistance resistance by the midkine target treatment ) Can be obtained.

Example  6: Midkine  gene In knockdown  by in vivo tumor Inhibition  Confirm

When the midkine gene was knocked down, a mouse brain model was constructed to confirm the decrease in tumorigenicity. BALB / c-nude mice (Orient Bio, female) using a stereotactic injection device above the (coordinates AP 0.5mm, ML + 1.7mm, DV - 3.2mm) N827 cells (described below N827) to 1X10 ⁴ per individual cell For 10 minutes using a Hamilton syringe. At this time, N827 cells infected with shRNA (1) (shMDK) against midkine (see Example 3) were used as the N827 cells. As a control, mice were injected with N827 cells infected with a non-target vector (cat. SHC016, Sigma-Aldrich) virus. A total of 20 animals were prepared for each group. The mouse model prepared above was weighed once a day. When the body weight of the control group was reduced by 20% or more, the experimental group (injection of shMDK-infected N827 cells) and the control mouse model were sacrificed by 2 mice each, , And fixed with 4% paraformaldehyde solution (cat.HP2031, BioWorld), and the tumor size was confirmed by H & E (Hematoxylin and Eosin) staining.

H & E (Hematoxylin and Eosin) staining methods are as follows:

Sample slides were incubated in a 60 ° C slide warmer for 20 minutes, treated with Xylene I, II, and III for 10 minutes, treated with 100% (v / v) ethanol, 90% ethanol and 80% ethanol for 10 minutes each. After washing with dH2O for 5 minutes, Harris hematoxylin (Yeongdong Pharmaceutical, # S 2-1) was treated for 3 minutes and again washed with dH2O for 5 minutes; Dipping 5 times in 0.3% (w / v) HCl in ethanol and washing again with dH2O for 5 minutes; Dipping 5 times in 0.5% (w / v) ammonia in dH2O and washing again with dH2O for 5 minutes; After 3 seconds of treatment with Eosin Y (polyscience, # 09859), dipping 10 times in dH2O; After dipping five times in the order of 80% (v / v) ethanol, 90% ethanol and 100% ethanol, Xylene I, II and III were treated for 10 minutes each and then mounted (permount: xylene = 3: 1).

The rest of the brain model mice were continuously sacrificed when their body weight decreased by more than 20%, and brain was extracted and fixed in 4% paraformaldehyde solution (cat.HP2031, BioWorld) for further experiments.

FIG. 13 shows the results of histological examination of tumor size (H & E) (Hematoxylin and Eosin) (bars: 2 mm). As shown in FIG. 13, when the size of the tumor was examined, it was confirmed that the size of the tumor formed in the brain was significantly reduced in the shMDK-treated group (shMDK-treated group) compared to the control group (NT)

The survival period of each mouse model (the period until the weight of the last surviving mouse was reduced by 20%) was measured and is shown in Fig. As shown in Fig. 14, the survival period of the shMDK-treated group was prolonged to a significant extent as compared with the control group.

<110> SAMSUNG ELECTRONICS CO., LTD. <120> Pharmaceutical Composition for Treating or Preventing Brain Tumor          Comprising Midkine inhibitor <130> DPP20161324KR <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA210 for midkine <400> 1 ccggcgactg caagtacaag tttgactcga gtcaaacttg tacttgcagt cgtttttg 58 <210> 2 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> shRNA252 for midkine <400> 2 ccggagggaa gggaaaggac tagacctcga ggtctagtcc tttcccttcc cttttttg 58

Claims (19)

delete delete delete delete An antibody that binds to a midkine protein or gene, aptamer, siRNA, shRNA, microRNA, CAS no. 2-one, 3- (2- (4-Fluorobenzyl) imidazo [2,1-b] thiazol-6-yl) -2H-chromen- ) imidazo [2,1-b] [1,3] thiazol-6-yl) -2H-chromen-2-one, and pharmaceutically acceptable salts thereof, and at least one midkine inhibitor selected from the group consisting of A pharmaceutical composition for preventing or treating a brain tumor having resistance to radiation therapy or temozolomide, comprising zolomide as an active ingredient. 6. The pharmaceutical composition according to claim 5, wherein the pharmaceutical composition inhibits tumor stem cells of a brain tumor.  6. The pharmaceutical composition according to claim 5, wherein the brain tumor is a glioblastoma.  6. The pharmaceutical composition according to claim 5, wherein the brain tumor is a glioblastoma that is resistant to radiation therapy or temozolomide. 6. The pharmaceutical composition according to claim 5, wherein the shRNA is the shRNA of SEQ ID NO: 1 or the shRNA of SEQ ID NO: 2. An antibody that binds to a midkine protein or gene, aptamer, siRNA, shRNA, microRNA, CAS no. 2-one, 3- (2- (4-Fluorobenzyl) imidazo [2,1-b] thiazol-6-yl) -2H-chromen- ) imidazo [2,1-b] [1,3] thiazol-6-yl) -2H-chromen-2-one, and pharmaceutically acceptable salts thereof, A drug, including a combination of zolomide; And
A kit for the prevention or treatment of a brain tumor having resistance to radiation therapy or temozolomide, comprising a radiation irradiation apparatus. delete  11. The kit of claim 10, wherein the brain tumor is a glioblastoma.  11. The kit of claim 10, wherein the brain tumor is a glioblastoma that is resistant to radiation therapy or temozolomide. The kit according to claim 10, wherein the shRNA is the shRNA of SEQ ID NO: 1 or the shRNA of SEQ ID NO: 2. The kit according to any one of claims 10 and 12 to 14, wherein the radiation irradiation apparatus is capable of irradiating a radiation dose of 1 Gy to 6 Gy at a time. delete An antibody that binds to a midkine protein or gene, aptamer, siRNA, shRNA, microRNA, CAS no. 2-one, 3- (2- (4-Fluorobenzyl) imidazo [2,1-b] thiazol-6-yl) -2H-chromen- ) imidazo [2,1-b] [1,3] thiazol-6-yl) -2H-chromen-2-one, and a pharmaceutically acceptable salt thereof, and A pharmaceutical composition for enhancing anticancer efficacy against brain tumors of radiation therapy or temozolomide comprising temozolomide as an active ingredient. Contacting the candidate compound with radiation therapy or separate brain tumor test cell cells resistant to temozolomide,
Measuring the amount of the midkine protein or the expression amount of the midkine gene in the test group cells after the candidate compound is contacted;
The measured amount of the midkine protein or the expression amount of the midkine gene in the test group cells is compared with the amount of the midkine protein or the amount of the midkine gene expressed in the brain tumor comparison cell group before or after the contact with the candidate compound step; And
When the amount of the midkine protein or the expression amount of the midkine gene of the test group cells is decreased as compared with the cells of the comparative group, the candidate compound is selected as a candidate for a therapeutic agent for brain tumors resistant to radiation therapy or temozolomide doing,
A method of screening for a therapeutic agent for brain tumors which is resistant to radiation therapy or to temozolomide. 19. The method of claim 18, wherein the brain tumor is a glioblastoma.

Images