KR101984702B1 - Method of detecting target materials using nucleic acid structure complex having nucleic acid, Raman-active molecule and metal particle - Google Patents

Method of detecting target materials using nucleic acid structure complex having nucleic acid, Raman-active molecule and metal particle Download PDF

Info

Publication number
KR101984702B1
KR101984702B1 KR1020120135563A KR20120135563A KR101984702B1 KR 101984702 B1 KR101984702 B1 KR 101984702B1 KR 1020120135563 A KR1020120135563 A KR 1020120135563A KR 20120135563 A KR20120135563 A KR 20120135563A KR 101984702 B1 KR101984702 B1 KR 101984702B1
Authority
KR
South Korea
Prior art keywords
nucleic acid
acid construct
raman
construct complex
polyhedron
Prior art date
Application number
KR1020120135563A
Other languages
Korean (ko)
Other versions
KR20140067821A (en
Inventor
김명순
금정원
박종면
허남
Original Assignee
삼성전자주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 삼성전자주식회사 filed Critical 삼성전자주식회사
Priority to KR1020120135563A priority Critical patent/KR101984702B1/en
Priority to US14/067,825 priority patent/US9551025B2/en
Publication of KR20140067821A publication Critical patent/KR20140067821A/en
Application granted granted Critical
Publication of KR101984702B1 publication Critical patent/KR101984702B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/65—Raman scattering
    • G01N21/658—Raman scattering enhancement Raman, e.g. surface plasmons
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308—Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites

Abstract

일 양상에 따른 표적 물질 검출 방법에 의하면, 재현성 있는 라만 분광을 할 수 있다. 또한 다양한 표적 물질의 분석을 할 수 있다. According to one aspect of the present invention, a reproducible Raman spectroscopy can be performed. In addition, various target substances can be analyzed.

Description

핵산, 라만 활성 분자 및 금속 입자를 포함하는 핵산 구조체 복합체를 이용하여 표적 물질을 검출하는 방법{Method of detecting target materials using nucleic acid structure complex having nucleic acid, Raman-active molecule and metal particle}BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for detecting a target substance using a nucleic acid construct complex comprising a nucleic acid, a Raman active molecule and a metal particle,

라만 분광법(Raman Spectroscopy)에 사용될 수 있는 핵산 구조체 복합체를 이용한 표적 물질 검출 방법에 관한 것이다. The present invention relates to a method for detecting a target substance using a nucleic acid construct complex that can be used for Raman spectroscopy.

라만 산란은 입사되는 빛의 에너지가 변하는 비탄성 산란으로 빛을 특정 분자체에 가하면 분자체 고유의 진동 전이에 의해 조사된 빛과는 파장이 약간 다른 빛이 발생하는 현상을 말한다. 그러나, 라만 분광기술의 많은 응용 가능성에도 불구하고 그 신호의 세기가 약하고 재현성이 낮아 현재까지 상용화되지 못하고 있다. Raman scattering is an inelastic scattering in which the energy of incident light is changed. When light is applied to a specific molecular sieve, light having slightly different wavelengths from the light irradiated by the inherent vibration transition of the molecular sieve is generated. However, despite the many applicability of the Raman spectroscopic technique, the intensity of the signal is weak and the reproducibility is low.

이러한 문제를 극복할 수 있는 방법으로 표면증강 라만 산란(Surface Enhanced Raman Spectroscopy, Surface Enhanced Raman Scattering, SERS)이 있다. 이는 은 전극에 산화-환원을 반복시킨 후 수용액 상에서 피리딘 분자가 흡착된 후 약 106 배 정도 세기가 증가하는 것을 관찰하였다. 그러나 SERS 현상은 정확하게 구조적으로 정의되어 있는 나노 물질 합성 및 제어의 어려움이 있다. 또한, 재현성 및 신뢰성 측면에서 해결해야할 문제가 많아 SERS 현상의 응용에 대한 연구가 진행되고 있다.Surface enhanced Raman spectroscopy (SERS) is a method that can overcome this problem. It was observed that the intensity of about 10 6 -fold increase after pyridine molecules were adsorbed in the aqueous solution after repeated oxidation-reduction to the silver electrode. However, the SERS phenomenon is difficult to synthesize and control nanomaterials that are structurally defined. In addition, there are many problems to be solved in terms of reproducibility and reliability, so that the application of SERS phenomenon is being studied.

일 양상은 라만 분광법에 이용되는 핵산 구조체 복합체를 이용하여 표적 물질을 검출하는 방법을 제공한다. One aspect provides a method for detecting a target substance using a nucleic acid construct complex used in Raman spectroscopy.

일 양상은 단일가닥과 단일가닥이 혼성화되어 있는 혼성화 영역을 포함하는 핵산, 상기 핵산에 포함된 라만 활성 분자(Raman-active molecule), 및 상기 핵산에 부착된 금속입자를 포함하는 핵산 구조체 복합체를 제공한다. One aspect provides a nucleic acid construct complex comprising a nucleic acid comprising a hybridization region in which a single strand and a single strand are hybridized, a Raman-active molecule contained in the nucleic acid, and metal particles attached to the nucleic acid do.

라만 산란은 빛이 어떤 매질을 통과할 때 빛의 일부는 진행 방향에서 이탈해 다른 방향으로 진행하는 현상을 의미한다. 용어 "SERS(surface enhanced Raman spectroscopy, surface enhanced Raman scattering)"는 금속 나노구조의 주변에 분자가 존재할 경우, 그 분자의 라만 산란의 세기가 크게 증가되는 현상을 의미하며, 표면 증강 라만 산란법 및/또는 분광법이라 한다. Raman scattering refers to the phenomenon that when light passes through a medium, part of the light travels in the other direction away from the traveling direction. The term " SERS (surface enhanced Raman spectroscopy) " means a phenomenon in which the intensity of Raman scattering of a molecule is greatly increased when molecules are present around the metal nanostructure. The surface enhanced Raman scattering method and / Or a spectroscopic method.

상기 핵산 구조체 복합체에 있어서, 상기 핵산 구조체는 하나 이상의 올리고뉴클레오티드로부터 제조될 수 있다. 상기 핵산 구조체를 이루는 핵산은 단일가닥과 단일가닥이 혼성화되어 있는 혼성화 영역을 포함할 수 있다. 상기 혼성화 영역을 포함하는 핵산이 서로 혼성화되어 이중 가닥의 핵산이 형성될 수 있다. 상기 이중 가닥 핵산은 올리고뉴클레오티드와 자신과의 혼성화 또는 다른 올리고뉴클레오티드와의 혼성화를 통해 형성될 수 있다. 상기 올리고뉴클레오티드는 하나 이상의 혼성화 영역을 포함할 수 있다. 하나의 올리고뉴클레오티드가 복수의 혼성화 영역을 포함할 수 있다. 상기 올리고뉴클레오티드는 동일한 뉴클레오티드 및/또는 다른 올리고뉴클레오티드의 혼성화 영역과 혼성화될 수 있다. 상기 핵산 구조체는 자기 조립될 수 있다. 용어 "자기 조립(self-assembly)"은 원자간 공유 결합 혹은 분자 상호인력에 의하여 자발적으로 나노구조를 형성하여 특정 구조를 이루는 현상을 의미한다. 상기 하나 이상의 올리고뉴클레오티드는 다른 올리고뉴클레오티드와 혼성화될 수 있는 상보적인 뉴클레오티드 서열을 포함할 수 있다. 핵산은 상보적인 서열간의 혼성화를 통하여 자기 조립될 수 있다. In the nucleic acid construct complex, the nucleic acid construct may be prepared from one or more oligonucleotides. The nucleic acid constructing the nucleic acid construct may include a hybridization region in which a single strand and a single strand are hybridized. The nucleic acids including the hybridization region may be hybridized with each other to form a double stranded nucleic acid. The double-stranded nucleic acid may be formed by hybridization of an oligonucleotide with itself or hybridization with another oligonucleotide. The oligonucleotide may comprise one or more hybridization regions. One oligonucleotide can comprise multiple hybridization regions. The oligonucleotides may be hybridized with the same nucleotide and / or hybridization region of another oligonucleotide. The nucleic acid construct may be self-assembled. The term " self-assembly " refers to a phenomenon in which a nanostructure is spontaneously formed by interatomic covalent bonding or molecular intertwining to form a specific structure. The one or more oligonucleotides may comprise a complementary nucleotide sequence that can be hybridized with another oligonucleotide. The nucleic acid can be self-assembled through hybridization between complementary sequences.

상기 핵산 구조체는 상기 핵산 구조체 복합체 중의 핵산으로부터 형성된 다면체일 수 있다. 상기 다면체는 핵산 다면체(nucleic acid polyhedron)일 수 있다. 상기 핵산 다면체는 어떠한 개수의 면(face), 변(edge) 및/또는 꼭지점(vertex)을 갖도록 설계될 수 있다. 상기 핵산 다면체는 적어도 2개 이상의 면, 변 및/또는 꼭지점을 가질 수 있다. 상기 핵산 다면체의 각 변의 일부는 이중 가닥 핵산일 수 있다. 상기 핵산 다면체의 각 변의 대부분은 이중 가닥 핵산일 수 있다. 각 변의 모든 부분이 이중 가닥 핵산으로 이루어질 수 있다. 상기 핵산 다면체는 예를 들면, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 또는 그 이상의 면을 갖도록 설계될 수 있다. 상기 핵산 다면체는 예를 들면, 사면체, 육면체, 피라미드, 양추(dipyramid), 또는 팔면체일 수 있다. 상기 핵산 다면체는 정다면체(regular polyhedron) 또는 비정다면체(irregular polyhedron)일 수 있다. 상기 핵산 다면체는 경성(rigid)일 수 있다. 핵산 구조체에 있어서, 핵산 구조체를 이루는 각각의 올리고뉴클레오티드는 자가조립되어 각각의 올리고뉴클레오티드의 5' 말단 및/또는 3' 말단이 상기 핵산 다면체의 꼭지점에 배치될 수 있다. 상기 다면체는 사면체(tetrahedron), 팔면체(octahedron), 12면체(dodecahedron), 삼각 쌍뿔(trigonal bipyramid), 및 쌍뿔로 이루어진 군으로부터 선택된 하나 이상일 수 있다. 상기 핵산 구조체는 어느 크기를 갖도록 선택될 수 있다. 상기 핵산 구조체의 크기는 모이어티의 크기에 근거하여 선택될 수 있다. 상기 핵산 다면체의 변은 5 이상, 10 이상, 20 이상, 30 이상, 40 이상, 50 이상의 염기쌍 길이를 가질 수 있다. The nucleic acid construct may be a polyhedron formed from a nucleic acid in the nucleic acid construct complex. The polyhedron may be a nucleic acid polyhedron. The nucleic acid polyhedron can be designed to have any number of faces, edges and / or vertices. The nucleic acid polyhedron may have at least two sides, sides and / or apexes. A part of each side of the nucleic acid polyhedron may be a double-stranded nucleic acid. Most of each side of the nucleic acid polyhedron can be a double-stranded nucleic acid. All parts of each side can be made of double-stranded nucleic acids. The nucleic acid polyhedra can be designed to have, for example, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more faces. The nucleic acid polyhedron can be, for example, a tetrahedron, a hexahedron, a pyramid, a dipyramid, or an octahedron. The nucleic acid polyhedron may be a regular polyhedron or an irregular polyhedron. The nucleic acid polyhedron may be rigid. In the nucleic acid construct, each oligonucleotide constituting the nucleic acid construct may be self-assembled and the 5 'end and / or the 3' end of each oligonucleotide may be arranged at the apex of the nucleic acid polyhedron. The polyhedron may be at least one selected from the group consisting of tetrahedron, octahedron, dodecahedron, trigonal bipyramid, and dichromatic. The nucleic acid construct can be selected to have any size. The size of the nucleic acid construct may be selected based on the size of the moiety. The side of the nucleic acid polyhedron may have a base pair length of 5 or more, 10 or more, 20 or more, 30 or more, 40 or more, 50 or more.

상기 핵산 구조체는 DNA, RNA, PNA(peptide nucleic acids), LNA(locked nucleic acids), 핵산 유사 구조(nucleic acid-like structures), 이들의 조합, 및 이들의 유사체로 구성된 군으로부터 선택된 핵산을 포함할 수 있다. 상기 핵산은 천연 뉴클레오티드와 유사하거나 향상된 결합 성질을 가진 유사체를 포함한다. 상기 핵산 구조체는 합성 백본(backbone)을 갖는 핵산 유사 구조체를 포함할 수 있다. 상기 합성 백본 유사체는 포스포디에스테르, 포스포로티오에이트, 포스포로디티오에이트, 메틸포스포네이트, 포스포라미데이트, 알킬 포스포트리에스테르, 설파메이트, 3′-시오아세탈, 메틸렌(메틸이미토)(methylene(methylimino)), 3′-N-카바메이트, 모폴리노 카바메이트, 펩티드 핵산(PNAs), 변형된 포스포디에스테르, 또는 변형된 메틸포스포네이트 결합을 포함할 수 있다. 상기 핵산 구조체를 제조하는 데 사용되는 상기 DNA는 자연적으로 발생하는 DNA, 변형된 DNA, 또는 합성 DNA일 수 있다. Wherein the nucleic acid construct comprises a nucleic acid selected from the group consisting of DNA, RNA, peptide nucleic acids (PNA), locked nucleic acids (LNA), nucleic acid-like structures, combinations thereof, . Such nucleic acids include analogs having similar or improved binding properties as natural nucleotides. The nucleic acid construct may comprise a nucleic acid-like construct having a synthetic backbone. The synthetic backbone analog may be a phosphodiester, phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, alkylphosphotriester, sulfamate, 3'-thioacetal, methylene (methylimido) (methylene (methylimino)), 3'-N-carbamate, morpholino carbamate, peptide nucleic acids (PNAs), modified phosphodiester, or modified methylphosphonate linkages. The DNA used to prepare the nucleic acid construct may be naturally occurring DNA, modified DNA, or synthetic DNA.

상기 핵산 구조체는 검출가능하게 표지될 수 있다. 상기 표지는 형광 분자, 방사성 동위 원소, 효소, 항체, 또는 링커 화합물을 포함할 수 있다. 용어 "링커 화합물"은, 올리고뉴클레오티드를 상기 금속 입자에 부착시키기 위해 각 올리고뉴클레오티드의 서열에 연결시킨 화합물을 의미한다. 상기 링커 화합물은 각 올리고뉴클레오티드의 5' 말단 및/또는 3' 말단에 연결될 수 있다. 상기 링커 화합물을 통하여 상기 금속 입자를 결합시키는 방법은 당업계에 공지되어 있다. 상기 링커 화합물의 한 말단은 상기 금속 입자 표면에 부착되는 관능기를 포함할 수 있다. 상기 관능기는 예를 들면, 티올기 또는 설프히드릴기를 포함하는 황-함유기일 수 있다. 상기 관능기는 알코올 및/또는 페놀의 유도체로서 산소 자리에 황이 포함된 RSH의 식을 가지는 화합물일 수 있다. 또한, 상기 관능기는 각각 RSSR' 또는 RSR'의 식을 가지는 티올 에스테르(thiol ester) 또는 다이티올 에스테르(dithiol ester)일 수 있다. 또한, 상기 관능기는 아미노기(-NH2) 또는 카르복실기일 수 있다. 상기 링커 화합물을 통해 상기 핵산 구조체에 상기 금속 입자가 부착될 수 있다. 상기 금속 입자는 각 올리고뉴클레오티드의 5' 말단 및/또는 3' 말단에 연결된 링커 화합물을 통해 상기 핵산 구조체의 꼭지점에 부착될 수 있다. The nucleic acid construct may be detectably labeled. The label may comprise a fluorescent molecule, a radioactive isotope, an enzyme, an antibody, or a linker compound. The term " linker compound " refers to a compound linked to the sequence of each oligonucleotide to attach an oligonucleotide to the metal particle. The linker compound may be linked to the 5 ' end and / or the 3 ' end of each oligonucleotide. Methods of binding the metal particles through the linker compound are well known in the art. One end of the linker compound may include a functional group attached to the surface of the metal particle. The functional group may be, for example, a sulfur-containing group including a thiol group or a sulfhydryl group. The functional group may be a compound having a formula of RSH in which sulfur is contained at the oxygen site as an alcohol and / or a derivative of phenol. In addition, the functional groups may be thiol esters or dithiol esters having a formula of RSSR 'or RSR', respectively. The functional group may be an amino group (-NH2) or a carboxyl group. The metal particles may be attached to the nucleic acid construct through the linker compound. The metal particles may be attached to the apex of the nucleic acid construct through a linker compound linked to the 5 ' end and / or the 3 ' end of each oligonucleotide.

상기 핵산 구조체 복합체에 있어서, 상기 금속 입자는 라만 신호를 측정하기 위한 신호물질일 수 있다. 상기 금속 입자는 광학 활성 분자일 수 있다. 상기 금속 입자는 Au, Ag, Cu, Na, Al, Cr, Pt, Ru, Pd, Fe, Co, Ni 및 이들의 조합으로 구성되는 군으로부터 선택될 수 있다. 상기 금속 입자는 금속 나노입자일 수 있다. 또한, 금속 이온 또는 금속 이온의 킬레이트를 사용할 수도 있다. 본 발명에서 사용되는 신호물질은 라만 활성 분자, 형광유기분자, 비형광유기분자, 무기나노입자, 를 포괄하는 광의의 개념으로, 발색이 가능한 표지물질을 제한없이 포함할 수 있다. 본 발명에서 사용되는 용어 "라만 활성 분자"는, 본 발명의 나노입자가 하나 이상의 분석물에 부착되었을 때 라만 검출 장치에 의한 분석물의 검출 및 측정을 용이하게 하는 분자를 의미한다. 상기 라만 활성 분자는 표면 강화 라만 활성 분자, 표면증강 공명 라만 활성 분자, 하이퍼 라만 활성 분자, 또는 코히런트 반 스토크스 라만 활성 분자를 포함할 수 있다. 상기 라만 활성 분자는 날카로운 스펙트럼 피크를 발생시킬 수 있다. 상기 라만 활성 분자는 라만 활성 태그(Raman-active tags)를 포함할 수 있다. 상기 라만 활성 분자는 시아닌 (cyanines), 플루오레세인 (fluorescein), 로다민(rhodamine), 7-니트로벤젠-2-옥사-1,3-디아졸 (7-nitrobenz-2-oxa-1,3-diazole: NBD), 프탈산, 테레프탈산, 아이소프탈산, 크레실 패스트 바이올렛 (cresyl fast violet), 크레실 블루 바이올렛 (cresyl blue violet), 브릴리언트 크레실 블루 (brilliant cresyl blue), 파라아미노벤조산, 에리쓰로신, 비오틴, 디옥시제닌 (digoxigenin), 프탈로시아닌, 아조메틴, 크산틴, N,N-디에틸-4-(5′-아조벤조트리아졸일)-페닐아민, 아미노아크리딘, 및 이들의 조합으로 이루어지는 군으로부터 선택될 수 있다. 시아닌의 예에는 Cy3, Cy3.5, 또는 Cy5가 포함될 수 있다. 플로오레세인의 예에는, 카복시플루오레세인 (carboxyfluorescein: FAM), 6-카복시-2',4,4′,5′,7,7′-헥사클로로플루오레세인 (6-carboxy-2′,4,4′,5′,7,7′-hexachlorofluorescein: HEX), 6-카복시-2′,4,7,7′-테트라클로로플루오레세인 (6-carboxy-2′,4,7,7′-tetrachlorofluorescein: TET), 5-카복시-4′,5′-디클로로-2′,7′-디메톡시 플루오레세인, 6-카복시-4′,5′-디클로로-2′, 7′-디메톡시플루오레세인 (6-carboxy-4′,5′-dichloro-2′, 7′-dimethoxyfluorescein: Joe) 5-카복시-2′,4′,5′,7′-테트라클로로플루오레세인, 5-카복시플루오레세인, 또는 석신일플루오레세인이 포함될 수 있다. 로다민의 예에는 테트라메틸로다민 (tetramethylrhodamine: Tamra), 5-카복시로다민, 6-카복시로다민로다민, 6G (Rhodamine 6G: R6G), 테트라메틸 로다민 이소티올 (tetramethyl rhodamine isothiol: TRIT), 술포로다민 101 산 클로라이드 (sulforhodamine 101 acid chloride: Texas Red dye), 카복시-X-로다민 (carboxy-X-rhodamine: Rox), 또는 로다민 B (rhodamine B)가 포함될 수 있다. In the nucleic acid construct complex, the metal particles may be a signal material for measuring Raman signals. The metal particles may be optically active molecules. The metal particles may be selected from the group consisting of Au, Ag, Cu, Na, Al, Cr, Pt, Ru, Pd, Fe, Co, Ni and combinations thereof. The metal particles may be metal nanoparticles. A chelate of a metal ion or a metal ion may also be used. The signal material used in the present invention may include, without limitation, a colorable labeling substance in the light of the concept including Raman active molecules, fluorescent organic molecules, non-fluorescent organic molecules, and inorganic nanoparticles. The term " Raman active molecule " as used herein refers to a molecule that facilitates the detection and measurement of an analyte by a Raman detection device when the nanoparticles of the present invention are attached to one or more analytes. The Raman active molecule may comprise a surface-enhanced Raman active molecule, a surface enhancement resonance Raman active molecule, a hyper-Raman active molecule, or a coherent anti-Stokes Laman active molecule. The Raman active molecule can generate sharp spectral peaks. The Raman-active molecule may comprise Raman-active tags. The Raman active molecule may be selected from the group consisting of cyanines, fluorescein, rhodamine, 7-nitrobenz-2-oxa-1,3 -diazole NBD), phthalic acid, terephthalic acid, isophthalic acid, cresyl fast violet, cresyl blue violet, brilliant cresyl blue, p-aminobenzoic acid, (5'-azobenzotriazolyl) -phenylamine, aminoacridine, and combinations thereof, as well as combinations thereof. ≪ / RTI > Examples of cyanines may include Cy3, Cy3.5, or Cy5. Examples of fluorescein include carboxyfluorescein (FAM), 6-carboxy-2 ', 4,4', 5 ', 7,7'-hexachlorofluorescein (6-carboxy- 4,4 ', 5', 7,7'-hexachlorofluorescein: HEX), 6-carboxy-2 ', 4,7,7'-tetrachlorofluorescein -Tetrachlorofluorescein: TET), 5-carboxy-4 ', 5'-dichloro-2', 7'-dimethoxyfluorescein, 6-carboxy-4 ', 5'-dichloro- Carboxy-4 ', 5'-dichloro-2', 7'-dimethoxyfluorescein: Joe) 5-carboxy-2 ', 4', 5 ', 7'-tetrachlorofluorescein, 5'- -Carboxyfluorescein, or succinylfluorene. ≪ / RTI > Examples of rhodamine include tetramethylrhodamine (Tamra), 5-carboxyhodamine, 6-carboxyhodamine rhodamine, 6G (Rhodamine 6G: R6G), tetramethyl rhodamine isothiol (TRIT) Sulforhodamine 101 acid red chloride, carboxy-X-rhodamine Rox, or rhodamine B may be included.

상기 금속 입자는 화학적으로 환원될 수 있거나 레이적 삭마를 거친 것일 수 있다. The metal particles may be chemically reduced or may be subjected to a ray ablation.

상기 핵산 구조체 복합체에 있어서, 상기 금속 입자의 표면에 표적 물질이 결합될 수 있다. 상기 표적 물질은 유기 분자, 무기 분자 또는 생체 분자로 이루어진 물질이 결합될 수 있다. 상기 생체분자는 단백질, 핵산, 당 또는 이들의 조합일 수 있다. 상기 생체분자는 병원체일 수 있다. In the nucleic acid construct complex, the target substance may be bound to the surface of the metal particle. The target material may be a material comprising organic molecules, inorganic molecules, or biomolecules. The biomolecule may be a protein, a nucleic acid, a sugar, or a combination thereof. The biomolecule may be a pathogen.

상기 핵산 구조체 복합체에 있어서, 상기 올리고뉴클레오티드는 관능기 또는 표적 핵산과 상보적인 서열을 포함하는 올리고뉴클레오티드를 더 포함할 수 있다. 상기 관능기는 상기 핵산 구조체 복합체에 표적 물질에 결합하는 제1 물질을 결합하기 위한 것일 수 있다. 상기 관능기는 상기 올리고뉴클레오티드의 일 말단에 부착될 수 있다. 상기 관능기는 예를 들면, 티올기 또는 설프히드릴기를 포함하는 황-함유기일 수 있다. 상기 관능기는 알코올 및/또는 페놀의 유도체로서 산소 자리에 황이 포함된 RSH의 식을 가지는 화합물일 수 있다. 또한, 상기 관능기는 각각 RSSR' 또는 RSR'의 식을 가지는 티올 에스테르 또는 다이티올 에스테르일 수 있다. 또한, 상기 관능기는 아미노기 또는 카르복실기일 수 있다. 상기 관능기는 상기 핵산 구조체 복합체의 면 또는 꼭지점으로부터 돌출될 수 있다. 상기 표적 핵산과 상보적인 서열을 포함하는 올리고뉴클레오티드는 상기 표적 물질에 포함된 표적 핵산을 이루는 올리고뉴클레오티드의 일부 서열과 혼성화될 수 있는 서열일 수 있다. In the nucleic acid construct complex, the oligonucleotide may further include an oligonucleotide including a functional group or a sequence complementary to the target nucleic acid. The functional group may be one for binding a first substance binding to a target substance to the nucleic acid construct complex. The functional group may be attached to one end of the oligonucleotide. The functional group may be, for example, a sulfur-containing group including a thiol group or a sulfhydryl group. The functional group may be a compound having a formula of RSH in which sulfur is contained at the oxygen site as an alcohol and / or a derivative of phenol. The functional groups may be thiol esters or dithiol esters having the formula of RSSR 'or RSR', respectively. The functional group may be an amino group or a carboxyl group. The functional group may protrude from the face or apex of the nucleic acid construct complex. An oligonucleotide comprising a sequence complementary to the target nucleic acid may be a sequence capable of hybridizing with a partial sequence of an oligonucleotide constituting the target nucleic acid contained in the target substance.

상기 표적 물질에 결합하는 물질은 표적 물질에 특이적으로 결합하는 것일 수 있다. 상기 특이적으로 결합하는 것은, 예를 들면, 표적 물질에 대하여 넓은 의미의 리간드와 수용체의 관계에 있는 것일 수 있다. 항원에 대하여 항체, 리간드에 대한 수용체, 효소와 기질 또는 억제인자 등이 포함될 수 있다. 상기 표적 물질에 결합하는 물질은 핵산에 결합하는 물질로서, 임의의 알려진 물질일 수 있다. 핵산에 결합하는 물질은 특이적 결합물질일 수 있다.
The substance binding to the target substance may be specifically binding to the target substance. The specifically binding may be, for example, a ligand-receptor relationship in a broad sense with respect to the target substance. Antibodies to the antigen, receptors for ligands, enzymes and substrates or inhibitors, and the like. The substance binding to the target substance may be any known substance as a substance binding to the nucleic acid. The substance binding to the nucleic acid may be a specific binding substance.

다른 양상은 핵산 구조체 복합체를 제조하는 단계로서; 상기 핵산 구조체 복합체를 제조하는 단계는 적어도 한 쌍 이상의 상보적인 뉴클레오티드 서열을 포함하는 올리고뉴클레오티드를 제공하는 단계, 상기 올리고뉴클레오티드를 혼성화시켜 핵산 구조체를 형성하는 단계, 및 상기 핵산 구조체에 금속 입자를 부착시키는 단계를 포함하는 핵산 구조체 복합체 제조 단계; 상기 핵산 구조체 복합체를 표적 물질을 포함하는 시료에 노출시키는 단계; 및 라만 분광법을 이용하여 상기 라만 신호를 검출하는 단계를 포함하는 표적 물질 검출 방법을 제공한다. Another aspect is a method for preparing a nucleic acid construct comprising the steps of: Wherein the step of preparing the nucleic acid construct complex comprises the steps of providing an oligonucleotide comprising at least one or more complementary nucleotide sequences, hybridizing the oligonucleotide to form a nucleic acid construct, and attaching the metal particle to the nucleic acid construct A nucleic acid construct complex preparation step comprising; Exposing the nucleic acid construct complex to a sample containing the target material; And detecting the Raman signal using Raman spectroscopy.

상기 핵산 구조체 복합체를 제조하는 단계는 적어도 한 쌍 이상의 상보적인 뉴클레오티드 서열을 포함하는 올리고뉴클레오티드를 제공하는 단계, 상기 올리고뉴클레오티드를 혼성화시켜 핵산 구조체를 형성하는 단계, 및 상기 핵산 구조체에 금속 입자를 부착시키는 단계를 포함할 수 있다. 상기 핵산 구조체 및 금속 입자에 대한 내용은 상기 핵산 구조체 및 금속 입자에 관해 기술한 바와 같다. 상기 올리고뉴클레오티드를 제공하는 단계에 있어서, 상기 올리고뉴클레오티드에 링커 화합물을 부착시킬 수 있다. 상기 올리고뉴클레오티드에 라만 활성 분자를 부착시킬 수 있다. 상기 라만 활성 분자에 대한 내용은 상기 라만 활성 분자에 관해 기술한 바와 같다. 상기 핵산 구조체를 형성하는 단계에 있어서, 상기 핵산 구조체는 자기 조립될 수 있다. 상기 핵산 구조체 제조방법에 있어서, 상기 금속 입자를 환원시키는 단계를 더 포함할 수 있다. 상기 금속 입자는 화학적으로 환원시키거나 레이적 삭마(laser ablation)을 거칠 수 있다.Wherein the step of preparing the nucleic acid construct complex comprises the steps of providing an oligonucleotide comprising at least one or more complementary nucleotide sequences, hybridizing the oligonucleotide to form a nucleic acid construct, and attaching the metal particle to the nucleic acid construct Step < / RTI > The contents of the nucleic acid construct and the metal particle are as described for the nucleic acid construct and the metal particle. In providing the oligonucleotide, the linker compound may be attached to the oligonucleotide. Raman active molecules can be attached to the oligonucleotides. The content of the Raman active molecule is as described for the Raman active molecule. In the step of forming the nucleic acid construct, the nucleic acid construct may be self-assembled. In the nucleic acid construct manufacturing method, the method may further include reducing the metal particles. The metal particles may be chemically reduced or subjected to laser ablation.

상기 핵산 구조체 복합체를 표적 물질을 포함하는 시료에 노출시키는 단계에 있어서, 상기 시료는 표적 물질을 포함하는 것이면 어느 것이나 될 수 있다. 상기 표적 물질은 생물 또는 비생물 유래 물질일 수 있다. 생물 유래 물질은 바이러스 또는 생물로부터 유래된 물질일 수 있다. 생물 유래 물질은 세포, 또는 그 성분을 포함한다. 상기 세포는 진핵 세포 또는 원핵 세포를 포함할 수 있다. 예를 들면, 그람 양성 또는 음성 박테리아 세포일 수 있다. 상기 생물 세포 성분은 단백질, 당 지방, 핵산 및 이들의 조합일 수 있다. 상기 시료는 예를 들면, 생물학적 물질을 포함하는 시료일 수 있다. 예를 들면, 혈액, 뇨, 점막 스왑, 타액, 체액, 조직, 생검물 및 이들의 조합일 수 있다.   In the step of exposing the nucleic acid construct complex to a sample containing a target substance, the sample may be any one including a target substance. The target material may be a biological or non-biological material. The biologically-derived material may be a virus or a material derived from an organism. The biologically-derived material includes a cell, or a component thereof. The cell may comprise eukaryotic cells or prokaryotic cells. For example, it may be a gram-positive or negative bacterial cell. The biological cell component may be a protein, a sugar chain, a nucleic acid, or a combination thereof. The sample may be, for example, a sample containing a biological substance. For example, blood, urine, mucous membrane swabs, saliva, body fluids, tissues, biopsies and combinations thereof.

상기 라만 분광법을 이용하여 상기 라만 신호를 검출하는 단계에 있어서, 상기 라만 분광법은 표면 증강 라만 분광법 (SERS), 표면증강 공명 라만 분광법 (surface enhanced resonance Raman spectroscopy: SERRS), 하이퍼 라만 분광법(Hyper Raman Scattering), 또는 코히런트 반 스토크스 라만 분광법 (Coherent Anti-Stokes Raman Scattering: CARS)일 수 있다. In the Raman spectroscopy, the Raman spectroscopy may be performed using surface enhanced Raman spectroscopy (SERS), surface enhanced resonance Raman spectroscopy (SERRS), Hyper Raman scattering ), Or Coherent Anti-Stokes Raman Scattering (CARS).

상기 방법은 관능기에 표적 물질에 결합하는 제1 물질을 결합시키는 단계를 더 포함할 수 있다. 상기 관능기에 관한 내용은 상술한 바와 같다. 표적 물질에 결합하는 제1 물질은 아미노기 또는 카르복실기를 포함할 수 있다. 제1 물질은 아미노기 또는 카르복실기를 제1 물질의 말단에 포함할 수 있다. 제1 물질은 아미노산, 단백질, 또는 항체일 수 있다. The method may further comprise the step of binding the functional material to a first material that binds to the target material. The content of the functional group is as described above. The first substance that binds to the target substance may comprise an amino group or a carboxyl group. The first substance may include an amino group or a carboxyl group at the end of the first substance. The first substance may be an amino acid, a protein, or an antibody.

상기 방법은 상기 표적 핵산과 혼성화될 수 있는 영역을 포함하는 올리고뉴클레오티드를 표적 핵산을 포함하는 시료에 노출시키는 단계를 더 포함할 수 있다. 상기 표적 핵산과 혼성화될 수 있는 영역을 포함하는 올리고뉴클레오티드는 표적 핵산과 서로 혼성화되어 이중 가닥의 핵산을 형성할 수 있다. The method may further comprise exposing an oligonucleotide comprising a region capable of hybridizing with the target nucleic acid to a sample comprising the target nucleic acid. An oligonucleotide comprising a region hybridizable with the target nucleic acid may be hybridized with a target nucleic acid to form a double stranded nucleic acid.

상기 방법은 표적 물질에 결합하는 제2 물질을 포함하는 지지체에 표적 물질을 포함하는 시료를 노출시키는 단계를 더 포함할 수 있다. 상기 지지체는 수소 결합 공여능을 갖는 관능기를 갖는 것으로, 기판 재질의 특성상 그러한 관능기를 가지고 있거나, 코팅과 같은 화학적 또는 물리적 처리에 의하여 그러한 관능기가 부가된 것을 포함할 수 있다. 상기 관능기는 바이오틴일 수 있다. 제2 물질은 생물로부터 유래하는 화합물로서, 예를 들면, 핵산, 단백질, 다당류 및 그의 조합으로 이루어지는 분자로 구성되는 군으로부터 선택되는 것일 수 있다. 상기 핵산에는, DNA 또는 RNA가 포함된다. 제2 물질은 일반적으로 분석하고자 하는 표적 물질과 특이적으로 반응하는 특성을 가지고 있을 수 있다. 예를 들면, 제2 물질이 핵산인 경우 상보적인 뉴클레오티드 서열을 갖는 표적 핵산과 혼성화 반응을 통하여 상호반응할 수 있다. 제2 물질이 단백질인 경우, 항원 및 항체 반응, 리간드 및 수용체 사이의 상호반응, 효소와 기질 사이의 상호 반응을 통하여 서로 특이적으로 상호작용할 수 있다. 또한, 제2 물질이 다당류인 경우, 다당류를 인지하는 렉틴(lectin)과 같은 단백질 또는 항체에 의하여 특이적으로 인지될 수 있다. The method may further comprise exposing a sample comprising the target material to a support comprising a second material that binds to the target material. The support has a functional group having a hydrogen bond donating ability and may contain such a functional group due to the nature of the substrate material or may be added with such a functional group by chemical or physical treatment such as coating. The functional group may be biotin. The second substance may be a compound derived from an organism, for example, selected from the group consisting of nucleic acids, proteins, polysaccharides, and combinations thereof. The nucleic acid includes DNA or RNA. The second substance may generally have the characteristics of specifically reacting with the target substance to be analyzed. For example, if the second material is a nucleic acid, it can interact with a target nucleic acid having a complementary nucleotide sequence through a hybridization reaction. When the second substance is a protein, it can specifically interact with each other through antigen and antibody reaction, interaction between the ligand and the receptor, and interaction between the enzyme and the substrate. In addition, when the second substance is a polysaccharide, it can be specifically recognized by a protein or an antibody such as lectin that recognizes a polysaccharide.

상기 노출시키는 단계는 상기 지지체에 상기 핵산 구조체를 주입하는 단계를 더 포함할 수 있다. 상기 핵산 구조체는 상기 지지체에 고정된 표적 물질과 특이적으로 결합될 수 있다. The step of exposing may further comprise injecting the nucleic acid construct into the support. The nucleic acid construct may be specifically bound to a target substance immobilized on the support.

상기 방법은 고체 지지체에 결합된 표적 물질을 세척하는 단계를 더 포함할 수 있다. 상기 세척하는 방법은 고체 지지체에 결합된 표적 물질을 실질적으로 제거하지 않으면서, 상기 고체 지지체에 결합하지 않은 물질 또는 약하게 결합된 물질을 제거하는 것일 수 있다. 세척액 및 세척 조건은 당업자가 적절하게 선택할 수 있다. The method may further comprise washing the target material bound to the solid support. The method of cleaning may be to remove materials that are not bonded to the solid support or weakly bonded materials, without substantially removing the target material bound to the solid support. The washing liquid and the washing conditions can be appropriately selected by those skilled in the art.

일 양상에 따른 표적 물질 검출 방법에 의하면, 재현성 있는 라만 분광을 할 수 있다. 또한 다양한 표적 물질의 분석을 할 수 있다. According to one aspect of the present invention, a reproducible Raman spectroscopy can be performed. In addition, various target substances can be analyzed.

도 1은 일 구체예에 따른 DNA 구조체, 금속 입자, 및 라만 활성 분자를 제조하는 방법을 나타낸 도면이다.
도 2는 일 구체예에 따른 라만 활성 분자를 포함하는 DNA 구조체의 모식도를 나타낸 도면이다.
도 3은 일 구체예에 따른 핵산 구조체 복합체의 모식도를 나타낸 도면이다.
도 4는 일 구체예에 따른 여러 종류의 라만 활성 분자를 도입하여 SERS 측정할 수 있음을 나타낸 도면이다.
도 5는 일 구체예에 따른 핵산 구조체 복합체의 금속입자를 환원시켜 금속입자를 은으로 코팅하는 방법을 나타낸 도면이다.
도 6은 일 구체예에 따른 관능기를 포함하는 핵산 구조체 복합체를 제조하는 단계를 나타낸 도면이다.
도 7은 일 구체예에 따른 관능기를 포함하는 핵산 구조체 복합체와 표적 물질에 결합하는 제1 물질의 결합을 나타낸 도면이다.
도 8은 일 구체예에 따른 핵산 구조체 복합체와 표적 물질과의 결합을 나타낸 도면이다.
도 9는 일 구체예에 따른 지지체에 고정된 표적 물질과 핵산 구조체 복합체의 결합을 나타낸 도면이다.
도 10은 일 구체예에 따른 표적 핵산과 상보적인 서열을 포함하는 올리고뉴클레오티드를 포함하는 핵산 구조체 복합체를 제조하는 단계를 나타낸 도면이다.
도 11은 일 구체예에 따른 표적 핵산과 상보적인 서열을 포함하는 올리고뉴클레오티드를 포함하는 핵산 구조체 복합체와 표적 핵산의 결합을 나타낸 도면이다.
도 12는 일 구체예에 따른 지지체에 고정된 표적 핵산과 핵산 구조체 복합체의 결합을 나타낸 도면이다.
도 13은 합성된 핵산 구조체를 겔을 이용하여 확인한 결과를 나타내는 도면이다.
도 14 및 15는 핵산 구조체 복합체를 STEM으로 확인한 결과를 나타낸 도면이다.
도 16 및 17은 시료, 대조군을 이용하여 측정한 SERS 스펙트럼 결과를 나타낸 도면이다.BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a diagram illustrating a method for preparing a DNA construct, metal particles, and Raman active molecules according to one embodiment.
FIG. 2 is a schematic diagram of a DNA construct comprising a Raman active molecule according to one embodiment. FIG.
Figure 3 is a schematic diagram of a nucleic acid construct complex according to one embodiment.
FIG. 4 is a graph showing that SERS can be measured by introducing various kinds of Raman-active molecules according to one embodiment.
FIG. 5 is a view illustrating a method of coating metal particles with silver by reducing metal particles of the nucleic acid construct complex according to one embodiment.
6 is a view showing a step of preparing a nucleic acid construct complex containing a functional group according to an embodiment.
7 is a view showing the binding of a nucleic acid construct complex comprising a functional group according to an embodiment to a first substance binding to a target substance.
8 is a view showing the binding of a nucleic acid construct complex and a target substance according to one embodiment.
Figure 9 is a diagram illustrating the binding of a nucleic acid construct complex with a target substance immobilized to a support according to one embodiment.
10 illustrates a step of preparing a nucleic acid construct complex comprising an oligonucleotide comprising a sequence complementary to a target nucleic acid according to one embodiment.
11 is a diagram illustrating the binding of a target nucleic acid to a nucleic acid construct complex comprising an oligonucleotide comprising a sequence complementary to a target nucleic acid according to one embodiment.
Figure 12 is a diagram illustrating the binding of a nucleic acid construct complex with a target nucleic acid immobilized on a support according to one embodiment.
13 is a diagram showing the result of confirming the synthesized nucleic acid construct using a gel.
FIGS. 14 and 15 are diagrams showing the result of STEM observation of the nucleic acid construct complex. FIG.
16 and 17 are SERS spectral results obtained by using a sample and a control group.

이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다. Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

도 1은 일 구체예에 따른 DNA 구조체, 금속 입자, 및 라만 활성 분자를 제조하는 방법을 나타낸 도면이다. 도 1에 의하면, 상보적인 뉴클레오티드 서열을 포함하는 4 개의 올리고뉴클레오티드를 제공할 수 있다. 상기 올리고뉴클레오티드는 라만 활성 분자를 포함할 수 있다. 상기 올리고뉴클레오티드는 그 내부에 상기 라만 활성 분자를 포함할 수 있다. 상기 올리고뉴클레오티드는 뉴클레오티드 간의 사이에 상기 라만 활성 분자를 포함할 수 있다. 상기 라만 활성 분자를 표면 강화 라만 활성 분자를 포함할 수 있다. 상기 올리고뉴클레오티드는 링커 화합물을 포함할 수 있다(도시되지 않음). BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a diagram illustrating a method for preparing a DNA construct, metal particles, and Raman active molecules according to one embodiment. According to FIG. 1, four oligonucleotides can be provided that contain a complementary nucleotide sequence. The oligonucleotides may comprise Raman active molecules. The oligonucleotide may comprise the Raman active molecule therein. The oligonucleotide may comprise the Raman active molecule between the nucleotides. The Raman active molecule may comprise a surface enhanced Raman active molecule. The oligonucleotide may comprise a linker compound (not shown).

상기 올리고뉴클레오티드는 하나 이상의 혼성화 영역을 포함할 수 있다. 상기 혼성화 영역은 단일가닥과 단일가닥이 혼성화되거나, 혼성화될 수 있는 영역을 포함할 수 있다. 상기 올리고뉴클레오티드를 혼성화시켜 DNA 사면체를 형성할 수 있다. 상기 올리고뉴클레오티드는 상기 혼성화를 통하여 자기 조립되어 DNA 사면체를 형성할 수 있다. The oligonucleotide may comprise one or more hybridization regions. The hybridization region may comprise regions where a single strand and a single strand may hybridize or hybridize. The oligonucleotide may be hybridized to form a DNA tetrahedron. The oligonucleotide may self-assemble through the hybridization to form a DNA tetrahedron.

형성된 DNA 사면체에 금 입자를 부착시켜 핵산 구조체 복합체를 제조할 수 있다. 상기 DNA 사면체를 이루는 올리고뉴클레오티드에 포함된 링커 화합물을 통해 상기 DNA 사면체에 금 입자가 부착될 수 있다. 경직성(rigidity)을 갖는 DNA 구조체를 이용하여 국소 영역에 강한 전자기장이 발생하는 핫 스팟(hot spot)의 거리를 조절할 수 있어, 재현성 있게 증가된 라만 신호를 얻을 수 있다. The nucleic acid construct complex can be prepared by attaching gold particles to the formed DNA tetrahedron. The gold particle may be attached to the DNA tetrahedron through a linker compound included in the oligonucleotide constituting the DNA tetrahedron. By using a rigid DNA structure, the distance of a hot spot where strong electromagnetic fields are generated in the local region can be controlled, thereby obtaining a reproducibly increased Raman signal.

도 2는 일 구체예에 따른 라만 활성 분자를 포함하는 DNA 구조체의 모식도를 나타낸 도면이다. 도 2에 의하면, 라만 활성 분자 A, B, 및 C 모두가 DNA 구조체에 도입될 수 있다. 상기 라만 활성 분자는 상기 DNA 구조체를 이루는 올리고뉴클레오티드에 도입될 수 있어, DNA 구조체의 어느 곳에나 도입될 수 있다. 또한 상기 도입될 수 있는 라만 활성 분자의 수는 다양할 수 있다. 상기 DNA 사면체를 이루는 올리고뉴클레오티드에 포함된 SH를 포함하는 링커 화합물을 통해 상기 DNA 사면체에 금 입자가 부착될 수 있다. 상기 SH는 탄화수소와 결합된 SH일 수 있다. 상기 SH는 -(SH)2를 포함할 수 있다. 상기 금 입자는 상기 SH를 포함하는 링커 화합물이 위치한 DNA 사면체의 꼭지점에 부착될 수 있다. 상기 SH를 포함하는 링커 화합물은 디티올기일 수 있다. FIG. 2 is a schematic diagram of a DNA construct comprising a Raman active molecule according to one embodiment. FIG. According to Fig. 2, both Raman active molecules A, B, and C can be introduced into the DNA construct. The Raman active molecule can be introduced into an oligonucleotide constituting the DNA construct and introduced anywhere in the DNA construct. Also, the number of Raman active molecules that can be introduced may vary. The gold particle may be attached to the DNA tetrahedron through a linker compound containing SH contained in an oligonucleotide constituting the DNA tetrahedron. The SH may be an SH combined with a hydrocarbon. The SH may comprise - (SH) 2 . The gold particles may be attached to the apex of a DNA tetrahedron in which the linker compound containing SH is located. The linker compound comprising SH may be a dithiol group.

도 3은 일 구체예에 따른 핵산 구조체 복합체의 모식도를 나타낸 도면이다. 도 3에 의하면, 금속 입자는 라만 활성 분자를 포함하는 DNA 사면체의 꼭지점에 부착될 수 있다. 상기 DNA 구조체와 금속 입자간의 부착은 링커 화합물을 통하여 이루어질 수 있다. 상기 링커 화합물은 DNA 구조체를 이루는 올리고뉴클레오티드의 어느 위치에나 연결될 수 있다. 금속 입자는 올리고뉴클레오티드에 도입된 링커 화합물이 있는 곳에 부착될 수 있다. Figure 3 is a schematic diagram of a nucleic acid construct complex according to one embodiment. According to Fig. 3, the metal particles can be attached to the apexes of a DNA tetrahedron containing Raman active molecules. Attachment between the DNA construct and the metal particle can be achieved through a linker compound. The linker compound may be linked to any position of the oligonucleotide constituting the DNA construct. The metal particles may be attached to the linker compound introduced into the oligonucleotide.

도 4는 일 구체예에 따른 여러 종류의 라만 활성 분자를 도입하여 SERS 측정할 수 있음을 나타낸 도면이다. 도 4에 의하면, 3 종류의 라만 활성 분자인 SERS 활성 리포터를 도입하여 총 7개의 표적 물질을 구별할 수 있다. 핵산 구조체를 이루는 뉴클레오티드에 도입할 수 있는 라만 활성 분자의 수는 다양하므로 많은 종류의 표적 물질을 동시에 검출할 수 있다. 상기 라만 활성 분자는 날카로운 스펙트럼 피크를 발생시킬 수 있다. 상기 라만 활성 분자는 좁은 반치폭(hlaf width)을 가지므로 다양한 라만 활성 분자를 동시에 사용할 수 있다.FIG. 4 is a graph showing that SERS can be measured by introducing various kinds of Raman-active molecules according to one embodiment. 4, a total of seven target substances can be distinguished by introducing three kinds of RERS active molecules, SERS-active reporter. Since the number of Raman active molecules that can be introduced into nucleotides constituting the nucleic acid construct varies, many kinds of target substances can be detected at the same time. The Raman active molecule can generate sharp spectral peaks. Since the Raman active molecule has a narrow half width, various Raman active molecules can be used at the same time.

도 5는 일 구체예에 따른 핵산 구조체 복합체의 금속입자를 환원시켜 금속입자를 은으로 코팅하는 방법을 나타낸 도면이다. 도 5에 의하면, 상기 금속입자에 화학적 환원 과정을 거쳐 은으로 금속입자를 코팅할 수 있다. 상기 코팅된 금속 입자를 포함한 핵산 구조체는 증가된 라만 신호를 재현성 있게 얻을 수 있다.FIG. 5 is a view illustrating a method of coating metal particles with silver by reducing metal particles of the nucleic acid construct complex according to one embodiment. Referring to FIG. 5, the metal particles may be coated with silver through a chemical reduction process. The nucleic acid construct including the coated metal particles can reproducibly obtain an increased Raman signal.

도 6은 일 구체예에 따른 관능기를 포함하는 핵산 구조체 복합체를 제조하는 단계를 나타낸 도면이다. 도 6에 의하면, 핵산 구조체 복합체를 이루는 핵산에 관능기를 부착하여 관능기를 포함하는 핵산 구조체 복합체를 제조할 수 있다. 상기 관능기는 상기 핵산의 어느 부분에도 부착될 수 있다. 상기 관능기는 올리고뉴클레오티드의 일 말단에 부착될 수 있다. 상기 핵산 구조체 복합체는 복수의 관능기를 포함할 수 있다. 상기 관능기는 상기 핵산 구조체 복합체에 표적 물질에 결합하는 제1 물질을 결합하기 위한 것일 수 있다. 상기 관능기는 예를 들면, 아민기, 카르복실기, 또는 티올기일 수 있다. 상기 관능기는 상기 핵산 구조체 복합체의 면 또는 꼭지점으로부터 돌출될 수 있다. 6 is a view showing a step of preparing a nucleic acid construct complex containing a functional group according to an embodiment. Referring to FIG. 6, a nucleic acid construct complex containing a functional group can be prepared by attaching a functional group to a nucleic acid constituting the nucleic acid construct complex. The functional group may be attached to any part of the nucleic acid. The functional group may be attached to one end of the oligonucleotide. The nucleic acid construct complex may include a plurality of functional groups. The functional group may be one for binding a first substance binding to a target substance to the nucleic acid construct complex. The functional group may be, for example, an amine group, a carboxyl group, or a thiol group. The functional group may protrude from the face or apex of the nucleic acid construct complex.

도 7은 일 구체예에 따른 관능기를 포함하는 핵산 구조체 복합체와 표적 물질에 결합하는 제1 물질의 결합을 나타낸 도면이다. 도 7에 의하면, 상기 관능기를 포함하는 핵산 구조체 복합체는 표적 물질에 결합하는 제1 물질과 상기 관능기를 통하여 결합될 수 있다. 상기 관능기는 아미노기 또는 카르복실기일 수 있다. 7 is a view showing the binding of a nucleic acid construct complex comprising a functional group according to an embodiment to a first substance binding to a target substance. According to FIG. 7, the nucleic acid construct complex containing the functional group may be bonded to the first substance binding to the target substance through the functional group. The functional group may be an amino group or a carboxyl group.

도 8은 일 구체예에 따른 핵산 구조체 복합체와 표적 물질과의 결합을 나타낸 도면이다. 도 8에 의하면, 표적 물질에 결합하는 제1 물질을 포함하는 핵산 구조체 복합체는 표적 물질과 결합할 수 있다. 상기 표적 물질에 결합된 핵산 구조체 복합체로부터 라만 신호를 측정할 수 있다.8 is a view showing the binding of a nucleic acid construct complex and a target substance according to one embodiment. According to FIG. 8, a nucleic acid construct complex comprising a first substance that binds to a target substance can bind to the target substance. The Raman signal can be measured from the nucleic acid construct complex bound to the target material.

도 9는 일 구체예에 따른 지지체에 고정된 표적 물질과 핵산 구조체 복합체의 결합을 나타낸 도면이다. 도 9에 의하면, 표적 물질에 결합하는 제2 물질을 포함하는 지지체에 표적 물질을 노출하여, 상기 지지체에 표적 물질을 고정화할 수 있다. 상기 고정화된 표적 물질에 제1 표적 물질을 포함하는 상기 핵산 구조체 복합체를 노출시켜, 상기 복합체는 상기 표적 물질과 결합할 수 있다. 상기 표적 물질에 결합된 핵산 구조체 복합체로부터 라만 신호를 측정할 수 있다. Figure 9 is a diagram illustrating the binding of a nucleic acid construct complex with a target substance immobilized to a support according to one embodiment. According to FIG. 9, the target substance can be immobilized on the support by exposing the target substance to a support containing a second substance that binds to the target substance. By exposing the nucleic acid construct complex comprising the first target material to the immobilized target material, the complex can bind to the target material. The Raman signal can be measured from the nucleic acid construct complex bound to the target material.

도 10은 일 구체예에 따른 표적 핵산과 상보적인 서열을 포함하는 올리고뉴클레오티드를 포함하는 핵산 구조체 복합체를 제조하는 단계를 나타낸 도면이다. 도 10에 의하면, 핵산 구조체 복합체를 이루는 핵산은 상기 표적 핵산과 상보적인 서열을 포함하는 올리고뉴클레오티드를 더 포함할 수 있다. 상기 올리고뉴클레오티드는 핵산의 어느 부분에도 포함될 수 있다. 상기 올리고뉴클레오티드는 상기 핵산의 일 말단에 부착될 수 있다. 상기 핵산 구조체 복합체는 복수의 표적 핵산과 상보적인 서열을 포함하는 올리고뉴클레오티드를 포함할 수 있다. 상기 표적 핵산과 상보적인 서열을 포함하는 올리고뉴클레오티드는 상기 핵산 구조체 복합체와 표적 물질에 포함된 표적 핵산을 결합하기 위한 것일 수 있다. 상기 표적 핵산과 상보적인 서열을 포함하는 올리고뉴클레오티드는 상기 핵산 구조체 복합체의 면 또는 꼭지점으로부터 돌출될 수 있다. 10 illustrates a step of preparing a nucleic acid construct complex comprising an oligonucleotide comprising a sequence complementary to a target nucleic acid according to one embodiment. Referring to FIG. 10, the nucleic acid construct of the nucleic acid construct complex may further include an oligonucleotide including a sequence complementary to the target nucleic acid. The oligonucleotide may be included in any part of the nucleic acid. The oligonucleotide may be attached at one end of the nucleic acid. The nucleic acid construct complex may comprise an oligonucleotide comprising a sequence complementary to a plurality of target nucleic acids. An oligonucleotide comprising a sequence complementary to the target nucleic acid may be one for binding the nucleic acid construct complex to a target nucleic acid contained in the target material. An oligonucleotide comprising a sequence complementary to the target nucleic acid may be protruded from the face or apex of the nucleic acid construct complex.

도 11은 일 구체예에 따른 표적 핵산과 상보적인 서열을 포함하는 올리고뉴클레오티드를 포함하는 핵산 구조체 복합체와 표적 핵산의 결합을 나타낸 도면이다. 도 11에 의하면, 표적 핵산과 상보적인 서열을 포함하는 올리고뉴클레오티드는 표적 핵산의 일부와의 혼성화 영역을 통하여 결합될 수 있다. 상기 표적 핵산은 DNA 또는 RNA일 수 있다. 11 is a diagram illustrating the binding of a target nucleic acid to a nucleic acid construct complex comprising an oligonucleotide comprising a sequence complementary to a target nucleic acid according to one embodiment. According to FIG. 11, oligonucleotides comprising a sequence complementary to a target nucleic acid can be joined through a hybridization region with a portion of the target nucleic acid. The target nucleic acid may be DNA or RNA.

도 12는 일 구체예에 따른 지지체에 고정된 표적 핵산과 핵산 구조체 복합체의 결합을 나타낸 도면이다. 도 12에 의하면, 표적 핵산을 포함하는 지지체에 상기 핵산 구조체 복합체를 노출시켜, 상기 복합체는 상기 표적 핵산과 결합할 수 있다. 상기 표적 핵산에 결합된 핵산 구조체 복합체로부터 라만 신호를 측정할 수 있다.
Figure 12 is a diagram illustrating the binding of a nucleic acid construct complex with a target nucleic acid immobilized on a support according to one embodiment. According to Figure 12, the nucleic acid construct complex is exposed to a support comprising a target nucleic acid, and the complex can bind the target nucleic acid. The Raman signal can be measured from the nucleic acid construct complex bound to the target nucleic acid.

실시예Example 1: 사면체 모양의  1: tetrahedral DNADNA 나노 구조체 합성 Nano structure synthesis

한 변의 길이가 7 nm인 DNA 다면체를 형성할 수 있도록 4개의 단일가닥 DNA의 서열을 디자인하고 표 1에 나타내었다. 상기 4개의 서열의 올리고뉴클레오티드부분의 서열을 서열번호 1 내지 4에 나타내었다. 4개의 서열은 서로 상보적인 서열을 가지며, 각 서열은 3개의 혼성화 영역을 가진다. 상기 DNA의 서열 중 4번 서열에 Cy3 라만 염료를 도입하였다. 1 내지 3번 서열의 5' 말단에 디설피드, HS2-CH(CH2)5-를 관능화하였다. The sequence of four single-stranded DNAs was designed to form a DNA polymorph with a length of 7 nm on one side and is shown in Table 1. The sequences of the oligonucleotide portions of the four sequences are shown in SEQ ID NOS: 1 to 4. The four sequences have complementary sequences, and each sequence has three hybridization regions. A Cy3 Raman dye was introduced into the 4th sequence of the DNA sequence. Disulfide, HS 2 -CH (CH 2 ) 5 - was functionalized at the 5 'end of Sequence 1 to 3.

서열
번호 1order
Number 1 Disulfide-TCCCATGTGTCTCGTCGTAAATTATATCATTCGGACGTTCCAGCTTCCCTGTTAAGTTCTACDisulfide-TCCCATGTGTCTCGTCGTAAATTATATCATTCGGACGTTCCAGCTTCCCTGTTAAGTTCTAC 서열
번호 2order
Number 2 Disulfide-TTACGACGAGACACATGGGAACCGAACAATGTCGGAACGGCAGGCCAATGCTCACGGCGGAGDisulfide-TTACGACGAGACACATGGGAACCGAACAATGTCGGAACGGCAGGCCAATGCTCACGGCGGAG 서열
번호 3order
Number 3 Disulfide-GGAACGTCCGAATGATATAAACTCCGCCGTGAGCATTGGCCATGAAACTCCCAGCGAGCAGCDisulfide-GGAACGTCCGAATGATATAAACTCCGCCGTGAGCATTGGCCATGAAACTCCCAGCGAGCAGC 서열
번호 4order
Number 4 GCCGTTCCGACATTGTTCGGAGTAGAACTTA/iCy3/ACAGGGAAGCAGCTGCTCGCTGGGAGTTTCAGCCGTTCCGACATTGTTCGGAGTAGAACTTA / iCy3 / ACAGGGAAGCAGCTGCTCGCTGGGAGTTTCA

10 uM의 4개의 각 DNA를 1 uL 넣고, 버퍼로 100 uL로 채웠다. 상기 버퍼의 조성은 다음과 같다: 20 mM Tris (pH 7.6), 2 mM EDTA, 12.5 mM MgCl2 . Thermocycler를 이용해 DNA 혼합물의 온도를 95℃에서 5분 동안 유지한 후 4℃로 낮추었다. 겔을 이용하여 DNA 나노 구조체의 합성을 확인하였다. 이는 시료를 5% TBE 겔에 넣고 70V 로 한 시간 영동시킨 후, SYBR 그린으로 염색하여 확인하였다. 표 2에 시료에 첨가된 DNA 서열 번호를 표시하였다. One uL of each of the four DNAs of 10 uM was added and the buffer was filled with 100 uL. The composition of the buffer is as follows: 20 mM Tris (pH 7.6), 2 mM EDTA, 12.5 mM MgCl 2 . The temperature of the DNA mixture was maintained at 95 ° C for 5 minutes using a thermocycler and then lowered to 4 ° C. The gel was used to confirm the synthesis of the DNA nanostructure. This was confirmed by staining with SYBR green after putting the sample in 5% TBE gel for one hour at 70V. Table 2 shows the DNA sequence numbers added to the samples.

레인lane 1One 22 33 44 55 66 77 첨가된 DNA 서열 번호The DNA sequence number added 1One 22 33 44 1 및 21 and 2 1, 2 및 31, 2, and 3 1, 2, 3 및 41, 2, 3, and 4

도 13은 합성된 핵산 구조체를 겔을 이용하여 확인한 결과를 나타내는 도면이다. 도 13에 의하면, 4개의 DNA 서열을 모두 첨가하였을 경우, DNA 나노 구조체가 제조되었음을 확인하였다. 13 is a diagram showing the result of confirming the synthesized nucleic acid construct using a gel. According to FIG. 13, when all four DNA sequences were added, it was confirmed that a DNA nanostructure was produced.

실시예Example 2:  2: DNADNA 나노 구조체와 금 입자의 결합 The combination of nanostructures and gold particles

5' 디설피드(Disulfide)로 관능화된, 동결 건조된 DNA를 3 % TCEP 용액 400 uL에 한 시간 동안 반응시켜 환원시켰다. 0.1 uM, 3 uL의 DNA 나노 구조체와 1 nM, 1.2 mL의 20 nm 금 입자를 섞은 후 실온에서 하룻밤 동안 교반하였다. 그 후, 이를 주사전자현미경(Scanning Electron Microscope; SEM), 구체적으로 UHR-SEM(S-5500)으로 확인하였다. 도 14 및 15는 핵산 구조체 복합체를 주사 투과형 전자현미경(Scanning Transmission Electron Microscope: STEM)으로 확인한 결과를 나타낸 도면이다. 도 14 및 15에 나타난 바와 같이, DNA 나노 구조체에 금 입자가 결합되었음을 확인하였다. The lyophilized DNA, functionalized with 5 'disulfide, was reduced by reacting with 400 μL of 3% TCEP solution for one hour. 0.1 uM, 3 uL of DNA nanostructure and 1 nM and 1.2 mL of 20 nm gold particles were mixed, followed by stirring at room temperature overnight. Thereafter, this was confirmed by a scanning electron microscope (SEM), specifically UHR-SEM (S-5500). FIGS. 14 and 15 are views showing the result of confirming the nucleic acid construct complex by a scanning transmission electron microscope (STEM). FIG. As shown in Figs. 14 and 15, it was confirmed that gold nanoparticles were bound to the DNA nanostructure.

실시예Example 3: 금 입자에의 은 코팅 3: silver coating on gold particles

25 ul 금 입자 용액에 안정제(stabilizer)인 10 ul 1% 폴리-N-비닐-2-피롤리돈, 환원제인 5ul 0.1M L-소듐 아스코베이트 존재 하에서, 1 mM AgNO3 용액을 실온에서 3시간 동안 반응시켰다. 이 용액을 0.3M PBS에 녹였다. 1 mM AgNO3 용액의 부피를 0 ul, 3 ul, 5 ul, 및 7 ul로 하여 반응 후, 이들 용액의 UV-VIS를 측정하여 그 결과를 표 3에 나타내었다.To 25 μl of the gold particle solution was added 1 mM AgNO 3 solution in the presence of 10 μl of 1% poly-N-vinyl-2-pyrrolidone as a stabilizer and 5 μl of 0.1 M L-sodium ascorbate as a reducing agent for 3 hours at room temperature Lt; / RTI > This solution was dissolved in 0.3M PBS. After the reaction, the volume of 1 mM AgNO 3 solution was adjusted to 0, 3, 5, and 7 μl, and the UV-VIS of these solutions was measured. The results are shown in Table 3.

1 mM AgNO3 1 mM AgNO 3 최대파장(nm)Maximum wavelength (nm) 0 ul0 ul 525525 3 ul3 μl 509509 5 ul5 μl 506506 7 ul7 μl 495495

실시예Example 4:  4: SERSSERS 측정 Measure

시료 및 대조군을 실리콘 시편에 1.5 ul 액적을 떨어뜨린 후 라만을 측정하였다. 대조군은 라만 염료가 첨가되지 않은 시료이다. 구체적으로, 인비아(inVia) 모델 장비(Renishaw 사)를 이용하여 514 nm 여기 레이저(excitation laser), 1초의 축적 시간(1's accumulation time), 레이저 파워 100%, 20X 배율로 측정하였다. 도 16 및 17은 시료, 대조군을 이용하여 측정한 SERS 스펙트럼 결과를 나타낸 도면이다. 도 16에 나타난 바와 같이, 시료의 라만 측정은 정확하게 나타나는 반면, 도 17에 나타난 바와 같이, 대조군의 라만 측정은 정확하게 나타나지 않음을 확인하였다. Samples and controls were plated on a silicon specimen with a drop of 1.5 μl and Raman was measured. The control group is a sample to which Raman dye is not added. Specifically, a 514 nm excitation laser, 1's accumulation time, 100% laser power, and 20X magnification were measured using an inVia model device (Renishaw). 16 and 17 are SERS spectral results obtained by using a sample and a control group. As shown in FIG. 16, the Raman measurement of the sample is shown accurately, whereas the Raman measurement of the control group is not accurately shown, as shown in FIG.

<110> Samsung Electronics Co. Ltd <120> Method of detecting target materials using nucleic acid structure complex having nucleic acid, Raman-active molecule and metal particle <130> PN098789 <160> 4 <170> KopatentIn 2.0 <210> 1 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> nucleotide for manufacturing a nucleic acid sturcture <400> 1 tcccatgtgt ctcgtcgtaa attatatcat tcggacgttc cagcttccct gttaagttct 60 ac 62 <210> 2 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> nucleotide for manufacturing a nucleic acid sturcture <400> 2 ttacgacgag acacatggga accgaacaat gtcggaacgg caggccaatg ctcacggcgg 60 ag 62 <210> 3 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> nucleotide for manufacturing a nucleic acid sturcture <400> 3 ggaacgtccg aatgatataa actccgccgt gagcattggc catgaaactc ccagcgagca 60 gc 62 <210> 4 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> nucleotide for manufacturing a nucleic acid sturcture <400> 4 gccgttccga cattgttcgg agtagaactt aacagggaag cagctgctcg ctgggagttt 60 ca 62 <110> Samsung Electronics Co. Ltd <120> Method of detecting target materials using nucleic acid structure          complex having nucleic acid, Raman-active molecule and metal          particle <130> PN098789 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> nucleotide for manufacturing a nucleic acid sturcture <400> 1 tcccatgtgt ctcgtcgtaa attatatcat tcggacgttc cagcttccct gttaagttct 60 ac 62 <210> 2 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> nucleotide for manufacturing a nucleic acid sturcture <400> 2 ttacgacgag acacatggga accgaacaat gtcggaacgg caggccaatg ctcacggcgg 60 ag 62 <210> 3 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> nucleotide for manufacturing a nucleic acid sturcture <400> 3 ggaacgtccg aatgatataa actccgccgt gagcattggc catgaaactc ccagcgagca 60 gc 62 <210> 4 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> nucleotide for manufacturing a nucleic acid sturcture <400> 4 gccgttccga cattgttcgg agtagaactt aacagggaag cagctgctcg ctgggagttt 60 ca 62

Claims (20)

하나 이상의 이중가닥 혼성화 영역에서 서로 혼성화되고 6개 이상의 변(edge) 및 4개 이상의 꼭지점(vertex)을 포함하는 다면체의 형태를 이루는 복수의 핵산;
둘 이상의 금속 입자로서, 상기 다면체의 다른 꼭지점에 각각 부착된 금속 입자; 및
상기 금속 입자들이 부착된 꼭지점 사이에 위치한 상기 다면체의 변에 부착된 라만 활성 분자를 포함하고,
상기 다면체의 변의 어느 하나 이상의 부분은 핵산의 이중가닥 영역인 핵산 구조체 복합체.A plurality of nucleic acids hybridized to each other in at least one double-stranded hybridization region and in the form of a polyhedron comprising at least 6 edges and 4 or more vertices;
At least two metal particles, metal particles each attached to another vertex of the polyhedron; And
And a Raman active molecule attached to a side of the polyhedron located between the vertices to which the metal particles are attached,
Wherein at least one of the sides of the polyhedron is a double stranded region of a nucleic acid. 청구항 1에 있어서, 상기 핵산 구조체 복합체는 표적 물질에 특이적으로 결합하는 제1 물질을 더 포함하는 것인 핵산 구조체 복합체.The nucleic acid construct complex according to claim 1, wherein the nucleic acid construct complex further comprises a first substance that specifically binds to a target substance. 청구항 1에 있어서, 상기 다면체는 사면체(tetrahedron), 팔면체(octahedron), 12면체(dodecahedron), 삼각 쌍뿔(trigonal bipyramid), 또는 쌍뿔인 것인 핵산 구조체 복합체.The nucleic acid construct complex according to claim 1, wherein the polyhedron is tetrahedron, octahedron, dodecahedron, trigonal bipyramid, or a hornbone. 청구항 1에 있어서, 상기 핵산 구조체 복합체는 링커 화합물을 포함하는 것인 핵산 구조체 복합체.The nucleic acid construct complex according to claim 1, wherein the nucleic acid construct complex comprises a linker compound. 청구항 1에 있어서, 상기 금속 입자는 링커 화합물에 의해 상기 다면체에 연결된 것인 핵산 구조체 복합체.The nucleic acid construct complex according to claim 1, wherein the metal particles are connected to the polyhedron by a linker compound. 청구항 1에 있어서, 상기 금속 입자는 Au, Ag, Cu, Na, Al, Cr, Pt, Ru, Pd, Fe, Co, Ni 및 이들의 조합으로 구성되는 군으로부터 선택되는 것인 핵산 구조체 복합체.The nucleic acid construct complex according to claim 1, wherein the metal particles are selected from the group consisting of Au, Ag, Cu, Na, Al, Cr, Pt, Ru, Pd, Fe, Co, Ni and combinations thereof. 청구항 2에 있어서, 표적 물질에 결합하는 제1 물질은 단백질, 항체, 또는 표적 핵산과 상보적인 서열을 포함하는 올리고뉴클레오티드인 것인 핵산 구조체 복합체.The nucleic acid construct complex according to claim 2, wherein the first substance binding to the target substance is an oligonucleotide comprising a sequence complementary to a protein, an antibody, or a target nucleic acid. 청구항 1에 있어서, 상기 금속 입자는 화학적으로 환원될 수 있거나 레이저 삭마(laser ablation)를 거친 것인 핵산 구조체 복합체.The nucleic acid construct complex according to claim 1, wherein the metal particles can be chemically reduced or laser ablated. 청구항 1에 있어서, 상기 라만 활성 분자는 시아닌, 플루오레세인, 로다민 (rhodamine), 7-니트로벤젠-2-옥사-1,3-디아졸 (7-nitrobenz-2-oxa-1,3-diazole: NBD), 프탈산, 테레프탈산, 아이소프탈산, 크레실 패스트 바이올렛(cresyl fast violet), 크레실 블루 바이올렛(cresyl blue violet), 브릴리언트 크레실 블루(brilliant cresyl blue), 파라아미노벤조산, 에리쓰로신, 비오틴, 디옥시제닌(digoxigenin), 프탈로시아닌, 아조메틴, 크산틴, N,N-디에틸-4-(5'-아조벤조트리아졸일)-페닐아민, 아미노아크리딘, 및 이들의 조합으로 이루어지는 군으로부터 선택되는 것인 핵산 구조체 복합체.The method of claim 1, wherein the Raman active molecule is selected from the group consisting of cyanine, fluorescein, rhodamine, 7-nitrobenz-2-oxa-1,3- diazole (NBD), phthalic acid, terephthalic acid, isophthalic acid, cresyl fast violet, cresyl blue violet, brilliant cresyl blue, p-aminobenzoic acid, erythrosine , Biotin, digoxigenin, phthalocyanine, azomethine, xanthine, N, N-diethyl-4- (5'-azobenzotriazolyl) -phenylamine, aminoacridine, and combinations thereof &Lt; / RTI &gt; nucleic acid construct complex. 청구항 1의 핵산 구조체 복합체를 제조하는 방법으로서, 상기 방법은
적어도 한 쌍 이상의 상보적인 뉴클레오티드 서열을 포함하는 올리고뉴클레오티드를 제공하는 단계;
상기 상보적인 뉴클레오티드 서열을 포함하는 하나 이상의 올리고뉴클레오티드를 혼성화시켜 핵산 구조체를 형성하는 단계로서,
상기 핵산 구조체는 6개 이상의 변 및 4개 이상의 꼭지점을 포함하는 다면체의 형태이고, 상기 다면체의 변의 하나 이상의 부분은 핵산의 이중가닥 영역인 단계; 및
2개 이상의 금속을 각각 상기 다면체의 다른 꼭지점에 부착시키고 금속 입자가 부착된 꼭지점 사이에 위치한 하나 이상의 변에 하나 이상의 라만-활성 분자를 부착시켜 핵산 구조체 복합체를 제조하는 단계를 포함하는 방법.A method for producing the nucleic acid construct complex of claim 1,
Providing an oligonucleotide comprising at least one or more pairs of complementary nucleotide sequences;
Hybridizing one or more oligonucleotides comprising the complementary nucleotide sequence to form a nucleic acid construct,
Wherein the nucleic acid construct is in the form of a polyhedron comprising at least six sides and at least four vertices and at least one portion of the sides of the polyhedron is a double stranded region of nucleic acid; And
Attaching two or more metals to different vertexes of the polyhedron, respectively, and attaching at least one Raman-active molecule to one or more sides positioned between the vertices with attached metal particles to produce a nucleic acid construct complex. 표적 물질을 검출하는 방법에 관한 것으로서, 상기 방법은
청구항 2의 핵산 구조체 복합체를 표적 물질에 노출시켜 상기 표적 물질과 표적 물질에 특이적으로 결합하는 제1 물질을 결합시키는 단계; 및
라만 분광법을 이용하여 상기 핵산 구조체 복합체로부터 라만 신호를 검출하는 단계로서,
라만 신호의 검출은 시료 중 표적 물질의 존재를 나타내는 것인 방법.A method for detecting a target substance, the method comprising:
Exposing the nucleic acid construct complex of claim 2 to a target material to bind the target material and a first material that specifically binds to the target material; And
Detecting a Raman signal from the nucleic acid construct complex using Raman spectroscopy,
Wherein detection of the Raman signal is indicative of the presence of the target material in the sample. 청구항 11에 있어서, 상기 라만 분광법은 표면 증강 라만 분광법, 표면증강 공명 라만 분광법, 하이퍼 라만 분광법, 또는 코히런트 반 스토크스 라만 분광법인 것인 방법.12. The method of claim 11, wherein the Raman spectroscopy is surface enhanced Raman spectroscopy, surface enhancement resonance Raman spectroscopy, hyper-Raman spectroscopy, or coherent anti-Stokes Raman spectroscopy. 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete
KR1020120135563A 2012-10-30 2012-11-27 Method of detecting target materials using nucleic acid structure complex having nucleic acid, Raman-active molecule and metal particle KR101984702B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020120135563A KR101984702B1 (en) 2012-11-27 2012-11-27 Method of detecting target materials using nucleic acid structure complex having nucleic acid, Raman-active molecule and metal particle
US14/067,825 US9551025B2 (en) 2012-10-30 2013-10-30 Nucleic acid structure complex including nucleic acids, Raman-active molecules, and metal particles, method of preparing the same, and method of detecting target material by using the nucleic acid structure complex

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020120135563A KR101984702B1 (en) 2012-11-27 2012-11-27 Method of detecting target materials using nucleic acid structure complex having nucleic acid, Raman-active molecule and metal particle

Publications (2)

Publication Number Publication Date
KR20140067821A KR20140067821A (en) 2014-06-05
KR101984702B1 true KR101984702B1 (en) 2019-05-31

Family

ID=51123972

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020120135563A KR101984702B1 (en) 2012-10-30 2012-11-27 Method of detecting target materials using nucleic acid structure complex having nucleic acid, Raman-active molecule and metal particle

Country Status (1)

Country Link
KR (1) KR101984702B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003104851A2 (en) 2002-06-06 2003-12-18 Salafsky Joshua S Method using a nonlinear optical technoque for detection of interactions involving a conformational change
US20090227774A1 (en) 2006-04-20 2009-09-10 Isis Innovation Limited Polyhedral Nanostructures Formed from Nucleic Acids

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6972173B2 (en) * 2002-03-14 2005-12-06 Intel Corporation Methods to increase nucleotide signals by raman scattering
KR101059896B1 (en) * 2009-10-12 2011-08-29 한국과학기술원 Detection of biochemicals using surface enhanced Raman scattering

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060228725A1 (en) 2002-01-24 2006-10-12 Biodesy Llc Method using a nonlinear optical technique for detection of interactions involving a conformational change
WO2003104851A2 (en) 2002-06-06 2003-12-18 Salafsky Joshua S Method using a nonlinear optical technoque for detection of interactions involving a conformational change
US20090227774A1 (en) 2006-04-20 2009-09-10 Isis Innovation Limited Polyhedral Nanostructures Formed from Nucleic Acids

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MATCH Commun. Math. Comput. Chem. 62 (2009) 115-130
Small, 4(3): 310-325 (2008.03.03.)

Also Published As

Publication number Publication date
KR20140067821A (en) 2014-06-05

Similar Documents

Publication Publication Date Title
Dehghani et al. Aptamer-based biosensors and nanosensors for the detection of vascular endothelial growth factor (VEGF): A review
Fu et al. Highly sensitive detection of prostate cancer specific PCA3 mimic DNA using SERS-based competitive lateral flow assay
Bantz et al. Recent progress in SERS biosensing
Zhu et al. Application of nanomaterials in the bioanalytical detection of disease-related genes
Gerion et al. Sorting fluorescent nanocrystals with DNA
CN111781186B (en) SERS sensor for integrally detecting tumor protein and nucleic acid marker and preparation method thereof
KR101467667B1 (en) Nanoparticles in the shape of nanosnowman with a head part and a body part, a preparation method thereof and a detection method using the same
Gu et al. Enhanced electrochemical and SERS signals by self-assembled gold microelectrode arrays: A dual readout platform for multiplex immumoassay of tumor biomarkers
Zhang et al. Silicon nanodot-based aptasensor for fluorescence turn-on detection of mucin 1 and targeted cancer cell imaging
Lu et al. Plasmon-enhanced biosensors for microRNA analysis and cancer diagnosis
Lin et al. DNA functionalized gold nanoparticles for bioanalysis
CN101467045A (en) Increased specificity of analyte detection by measurement of bound and unbound labels
Farshchi et al. Nanomaterial based aptasensing of prostate specific antigen (PSA): recent progress and challenges in efficient diagnosis of prostate cancer using biomedicine
US20160266104A1 (en) Heterodimeric core-shell nanoparticle in which raman-active molecules are located at a binding portion of a nanoparticle heterodimer, use thereof, and method for preparing same
WO2013076143A1 (en) Detecting analytes
Chandrasekaran DNA nanobiosensors: an outlook on signal readout strategies
Ren et al. An aptamer based fluorometric assay for amyloid-β oligomers using a metal-organic framework of type Ru@ MIL-101 (Al) and enzyme-assisted recycling
RU2723160C1 (en) Method of detecting and determining dna with a given sequence using giant raman scattering spectroscopy
Ji et al. DNAzyme-functionalized porous carbon nanospheres serve as a fluorescent nanoprobe for imaging detection of microRNA-21 and zinc ion in living cells
Sun et al. Metallic nanostructures assembled by DNA and related applications in surface-enhancement Raman scattering (SERS) detection
Luo et al. Fluorescence and surface-enhanced Raman scattering dual-mode nanoprobe for monitoring telomerase activity in living cells
KR20140141880A (en) Interparticle spacing material including nucleic acid structures and use thereof
Lettieri et al. Copper nanoclusters and their application for innovative fluorescent detection strategies: An overview
Shamsipur et al. Determination of cDNA encoding BCR/ABL fusion gene in patients with chronic myelogenous leukemia using a novel FRET-based quantum dots-DNA nanosensor
He et al. All-in-one fractal nanoplasmonic array for visual discrimination of biomolecules and microorganisms

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E90F Notification of reason for final refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant