KR101958078B1 - Method for Increasing the content of Saponin in Kalopanax septemlobus - Google Patents

Abstract

The present invention provides a method for increasing the saponin content in the raisins. The method provides an inducer for increasing the saponin content in the rains and their optimum conditions. The present invention provides a method for increasing the saponin content in the rabbit comprising the step of increasing the expression of the KsbAS gene by identifying the KsbAS gene associated with an increase in saponin content in the rabbit .

Description

Methods for Increasing the Saponin Content in Rice Trees {

The present invention relates to a method for increasing the saponin content in the rice.

Pine ( Kun , Kalopanax septemlobus or Kalopanax pictus ) is a deciduous tree traditionally used as a remedy (Hyun and Kim, 2009; Park et al., 2016). In recent years, extracts of stem stem barks have inhibited the phosphorylation and degradation of IκB-α, an inhibitor of NF-κB (nuclear factor- κB), and have been shown to inhibit the phosphorylation and degradation of NF -KB into the nucleus and showed anti-inflammatory activity (Bang et al., 2010). In addition, extracts of the seedlings include saponin (saponin), polyacetylene, isoquinoline alkaloid, lignan, phenylpropanoid glycoside, phenolic glycoside, etc. It has been reported that a variety of secondary metabolites are contained and a wide range of physiological activities against antioxidant, antimicrobial, antidiabetic, anti-inflammatory, and anti-cancer have been reported (Hu et al., 2012; et al., 2014; Moon et al., 2015; Park et al., 2016). Although the possibility of being a herb medicine or a health supplement of a pine tree is raised, it is difficult to prove that the seedling or wild plants cultivated in a farmhouse have difficulty in proliferating such as low germination rate, a long growing period as a herbaceous tree, And is not economically useful due to a number of limiting factors such as the production of metabolites (Moon et al., 2005). The development of economically viable and environmentally friendly resources for the production of stable secondary metabolites is a challenge in the industrial crop industry.

Producing valuable secondary metabolites through plant cell or tissue culture will be an attractive alternative to traditional methods (Murthy et al., 2014). An important advantage of the plant suspension culture system is that it allows simultaneous cultivation of the same cells and is capable of sustained maintenance and production without being affected by spatial, seasonal and environmental changes (Ochoa-Villarreal et al., 2016). This advantage will be an important system in the production of natural materials related to the cosmetics, food and pharmaceutical industries (Ochoa-Villarreal et al., 2016).

However, this system for the production of secondary metabolites has limited practical applications due to the low production yield and mass production of useful materials (Wilson and Roberts, 2012). To overcome these limitations, various strategies have been introduced, such as elicitation or metabolic engineering using genetic engineering techniques.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The inventors of the present invention have found that a variety of physiological active species, such as Kalopanax septemlobus ) to increase the content of available secondary metabolites. As a result, the present inventors have completed the present invention by confirming that the content of saponin in the intracellular cells is increased when the embryonic cells are subjected to suspension culture and coronatine treatment by the inducible substance treatment method.

Accordingly, an object of the present invention is to provide a method for increasing the saponin content in the raisins.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a method for increasing the saponin content in a rind comprising the steps of:

(a) Suspension culturing of the stem cells; And

(b) treating the culture with coronatine.

The present inventors have sought to find a method for increasing the content of the useful secondary metabolites of a variety of physiologically active rice. As a result, it was confirmed that the content of saponin in the intracytoplasmic chambers was increased when the inducible substance treatment method was used to suspend and cultivate the embryonic cells.

The method of increasing the saponin content in the rice according to the present invention will be described step by step.

Step (a): Culture of the ovule cells

First, the male cells are suspended.

The seedling cells may be derived from, but not limited to, callus, protoplast, hyocotyl, seed, cotyledon, shoot of a tree.

Specifically, the above-mentioned ommunocyte is derived from calli.

As used herein, the term " callus " is an amorphous tissue or cell mass that has lost the ability to induce normal organogenesis or tissue differentiation, and is mostly flowcytosed, and the tissue cut from the plant may be cultured in various media such as auxin or cytokine Refers to a specific tissue or cell mass produced when cultured in a tissue culture medium containing cytokinin, injured in a plant, or treated with auxin of a plant body.

In the present invention, induction of the callus can be carried out through conventional methods known in the art. More specifically, the induction of callus is carried out by culturing a plant tissue or a fragment thereof in a tissue culture medium. As the tissue culture medium, various media such as MS (Murashige and Skoog, 1962), N6 (Chu et al., 1975), B5 (Gamborg et al., 1968), NN (Nitschand Nitsch, 1967) Plant basal medium can be used. It is preferable that the culture medium for tissue culture is one in which a plant growth regulator is added. The plant growth regulator may be selected from the group consisting of 2,4-D (2,4-dichlorophenoxyacetic acid), 2,4,5-T (2,4,5-trichlorophenoxyacetic acid 2-methoxy-3,6-dichlorobenzoic acid, indole-3-acetic acid, indole-3-butyric acid, MCPA (2-methyl-4-chlorophenoxyacetic acid), NAA Auxin such as 1-naphthylacetic acid, 2-naphthyloxyacetic acid and 4-amino-2,5,6-trichloropicolinic acid; Bip (6-benzylaminopurine), 2iP (N6- (2-isopentyl) adenine), Kinetin (6-furfurylaminopurine), Thidiazuron (1-phenyl- 3- (1,2,3-thiadiazol- (4-hydroxy-3-methyl-trans-2-butenylaminopurine), and derivatives thereof. In addition, the tissue culture medium may further contain alkaloids, terpenoids, carotenoids, phenol compounds, and natural extracts that act on differentiation and proliferation of cells.

In the present invention, the 'callus' is any one selected from the group consisting of leaves, stems, branches, fruits and roots, preferably leaves, stems, branches and fruits Or more, and more preferably from a callus derived from any one or more sites selected from the group consisting of leaves, branches and fruits.

As one specific example, the calli of the present invention can be obtained by separating and disinfecting the branches of the Japanese apricot, and then disinfecting the branches of the Japanese apricot with an organic component (e.g., carbohydrate, amino acid etc.), inorganic nutrients (e.g. nitrogen, phosphoric acid, potassium, Acetic acid, oxine, etc.) for 5 to 8 weeks to separate the callus, which is a cell mass, from the medium. After the callus is separated from the medium, it is placed on a fresh solid medium, Followed by subculture.

As demonstrated in the following examples, a male cell culture in which the callus-derived male callus cells are suspended and cultured is prepared.

Step (b): Treatment of the Inductive Substance

Next, the culture is treated with coronatine.

The step (b) may be carried out on the exponential growth stage of the callus of the callus.

Specifically, the step (b) is carried out on days 1-15 of culturing in step (a). More specifically, the step (b) is carried out at 2 to 13 days in culture of step (a). More specifically, the step (b) is performed on the 3rd to 10th days of culturing in step (a). More particularly still, the step (b) is carried out 4-8 days after the culturing of step (a).

The coronetin (COR) mimics the chemical structure of the plant hormone Jasmonic acid isoleucine, a non-host plant toxin produced by Pseudomonas syringae. Is represented by the following formula (1).

[Chemical Formula 1]

Concretely, the coronetin is treated at a concentration of 0.1-3.0 μM. More specifically, the coronetin is treated at a concentration of 0.2-2.8 [mu] M. More specifically, the coronetin is treated at a concentration of 0.3-2.6 μM.

As demonstrated in the following examples, when the coronetin was treated at a concentration of 0.5 μM, 1.0 μM and 2.5 μM, the saponin content was 159%, 160% and 133%, respectively, as compared to the case without co- Respectively.

It is preferable that the treatment of the inducer is performed during a period in which the saponin-producing ability of the callus is high.

Specifically, the step (b) is carried out for 2 to 8 days. More specifically, the step (b) is carried out for 2.5 to 7.5 days. More specifically, for 3 to 7 days.

The saponin in the rachis increased by the method of the present invention is oleic acid. The oleanolic acid is represented by the following formula (2).

(2)

Saponins are classified according to their structure into steroids or triterpenoid saponins, which are biosynthesized from IPP (isopentenyl diphosphate) produced by the methyl-erythritol phosphate (MEP) pathway and the mevalonate pathway . Both triterpenoids and steroidal aglycone backbones are synthesized from a linear C30 precursor squalene and are oxidized by 2,3-oxydosqualene by squalene epoxidase (SQE) (Moses et al., 2014a). Next, cycloartenol (a precursor of steroid saponin) is synthesized from 2,3-oxydosqualene by cycloartenol synthase (CAS), and β-amyrin synthase (bAS) Amylin (a basic precursor of oleanane-type saponin) or? -Amyrin (a ursane-type?) In 2,3-oxydosqualene by an oxidoreductase such as lupeol synthase ) Saponin) are synthesized (Moses et al., 2014b). Most of the triterpenoid saponins produced from the pomegranate are known as duckish saponins (Quang et al., 2011). This indicates that CAS, SQE and bAS are important enzymes involved in saponin biosynthesis in the wood. Therefore, in order to investigate the mechanism of action of COR in saponin biosynthesis, we have identified three SQEs from the SRA data set of the transcript sequence of the non-conidial calli, and four unigens, estimated as one bAS. However, the information in the CAS sequence could not be found from the assembled Uniin, which is presumably due to the low expression level of CAS in the non-vesicular callus.

According to another aspect of the present invention, the present invention provides a method for increasing the saponin content in the rabbit comprising the step of increasing the expression of the KsbAS gene.

Increasing the expression of the KsbAS gene in the rice can be carried out by treating the inducer in the oocyte .

The inductive material includes various materials. For example, the inducer includes, but is not limited to, chemicals, proteins, peptides, antibodies, nucleic acids and natural extracts. The inductive material analyzed by the method of the present invention may be a single compound or a mixture of compounds (e.g., a natural extract or a cell or tissue culture). Candidate materials can be obtained from libraries of synthetic or natural compounds. Methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are commercially available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich (USA), and libraries of natural compounds are available from Pan Laboratories ) And MycoSearch (USA). Samples can be obtained by various combinatorial library methods known in the art and include, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, , The " 1-bead 1-compound " library method, and the synthetic library method using affinity chromatography screening. Methods for synthesis of molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33,2059,1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994, and the like.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a method for increasing the saponin content in the raisins. The method provides an inducer for increasing the saponin content in the rains and their optimum conditions.

(c) The present invention provides a method of increasing the expression of the gene and increasing the saponin content in the rabbit by identifying the KsbAS gene associated with an increase in saponin content in the rabbit .

Figures 1A and 1B show changes in live body weight (A) and phenotype (B) by incubation time of the oocyte cell suspension.
2A and 2B show changes in the total saponin content (A) and the productivity (B) by incubation time of the oocyte cell suspension.
Figures 3A and 3B show the changes in the intramuscular (A) and total saponin content (B) for treatment of the concentration of the inductant.
FIG. 4 shows the expression levels of KsSE1 , KsSE2 , KsSE3 and KsbAS , genes related to triterpenoid saponin biosynthesis according to the treatment example of the inducer .

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Throughout this specification, "%" used to denote the concentration of a particular substance is intended to include solids / solids (wt / wt), solid / liquid (wt / Liquid / liquid is (volume / volume)%

Example

1. Experimental Method

1.1 Plant material and culture conditions

The callus of K. septemlobus was grown in Murashige and skoog (MS), 1.0 ㎎ / L 2,4-dichlorophenoxyacetic acid (2,4-D) according to Kim and Moon (2009) , 3% sucrose and 0.8% plant agar, and maintained at 24 ℃ in dark conditions. The flexible callus was subcultured into callus induction medium every 4 weeks and used for cell suspension culture.

1.2 Plant cell suspension  Establish culture system

In order to establish suspension cultivation of the oocyte, the flexible callus was transferred to a 300 ml Erlenmeyer flask and MS liquid medium (50 ml) containing 1.0 mg / L 2,4-D and 3% sucrose. All culture flasks were incubated under rock conditions, 120 rpm and 24 ° C rotary shaker. 2,4-D induced abnormal growth of the cells, despite increasing live weight and growth of the suspension-cultured cells. For stabilized cell growth, the content of 2,4-D was gradually decreased and cultured, and suspension cultivation was induced while inducing cell growth in a medium containing no 2,4-D. Suspension Cultured plant cells (10 ml) were transferred to an Erlenmeyer flask containing 50 ml of MS liquid medium containing 3% sucrose, and subculture was carried out once a week.

1.3 cells Analysis of growth and induction  process

Suspension cultures were harvested at different times until 15 days after culture to determine the growth curve of the cells. Approximately 0.7 g (fresh weight, FW) of cells 7 days after culture were cultured in a 10 ml subculture with the culture medium, and the fresh weight of the collected cells was checked by vacuum filtration over time. The harvested cells were then frozen and stored at -80 ° C until analysis.

For the treatment of the inducible substance, the cells were cultured in 6-day suspension culture at different concentrations of MeJA (methyl jasmonate) 50, 100 or 250 μM (in ethanol) and coronatine 0.5, 1 or 2.5 μM (in ethanol) , Or the control (mock control) was treated with ethanol and cultured for another 4 days. Cells were harvested using a vacuum filter and frozen in liquid nitrogen.

1.4 Measurement of total saponin amount

To determine the amount of total saponin, anisaldehyde reagent, modified by Vador et al. (2012), was used. A sample of 50 mg (FW) was immersed in hexane for lipid separation. Subsequently, the solvent was volatilized in the degreased sample, and saponin was extracted three times (6 h × 3 times) using 2 mL of methanol. The methanol extract was concentrated under reduced pressure. The concentrated saponin was dissolved in 1 ml of ethyl acetate. 500 μl of the sample was mixed with 250 μl of reagent A (0.5% (v / v) p-anisaldehyde in ethyl acetate) and 250 μl of reagent B (50% (v / v) H ₂ SO ₄ in ethyl acetate) Respectively. After incubation at 60 ℃ for 10 min, the solution was cooled at room temperature and absorbance was measured at 430 ㎚. The amount of total saponin was determined according to a standard curve of diosgenin, a saponin standard substance.

1.5 Measurement of oleanolic acid content

The oleanolic acid, a kind of triterpenoid saponin, was measured. The lyophilized cells (1 g) were immersed in methanol (MeOH (ml) at a weight of 1:15) for 1 hour and further extracted with an ultrasonic bath (DAIHAN-Sci, Wonju-si, South Korea) for 10 minutes. HPLC analysis was performed using an Agilent 1200 chromatograph (Agilent Technologies, Waldbronn, Germany) with a diode array-type detector to measure the concentration of oleanolic acid in the extract. The separation was carried out using a Shiseido CAPCELL PAK-C18 column (4.6 × 150 mm, particle diameter 5.0 μm) and a mobile phase of MeOH / H ₂ O (95: 5, v / v) at a flow rate of 0.4 ml / et al. ≪ / RTI > method (2012). Calibration curves of oleanolic acid standards were measured in the range of 100 ng to 10 μg (y = 159.09x - 5.8357, R² = 0.9999).

1.6 Expression Analysis of Gene Related to Saponin Biosynthesis

In order to identify genes involved in saponin biosynthesis, we downloaded the sequence read archive (SRA) dataset for transcript sequencing of non-primitive calli of the female. CLC Genomics workbench and Main Workbench (Insilicogen, Yongin-si, South Korea) were used for the creation and assembly of Local-BLAST database. Protein and mRNA sequences of squalene epoxidase (FJ393274), cycloartenol synthase (AB009029), and beta- amyrin synthase (AB014057) in Panax ginseng were determined by immunoassay And used as a query on the corpus data set. Total RNA was extracted according to the manual included with the FavorPrep ^™ plant total RNA purification mini kit (FAVORGEN Biotech Corporation, Ping-Tung, Taiwan). cDNA was synthesized according to the manual included with ReverTra Ace ^® qPCR RT Master Mix with qDNA Remover (TOYOBO, Co., Ltd, Osaka, Japan). qRT-PCR was performed with the default parameter in the ^{SYBR ® Green Real time PCR Master Mix} (TOYOBO, Co., Ltd, Osaka, Japan) for ^{CFX96 TM Real-time system (BIO} -RAD) use. The level of expression of each gene was repeated three times in each experiment on the expression level of the actin gene, an endogenous standard. Table 1 lists the primers used for qRT-PCR.

Primer name Sequence (5 'to 3') Sequence List KsSQE1-F CAAAGGTGGATGTGCCTTCT First sequence KsSQE1-R GGGTGATGGGTCTGCTAAGA Second sequence KsSQE2-F GCGATCTCCATGACTCATCA Third sequence KsSQE2-R TAAAGTGCACCTGCCAATGT Fourth sequence KsSQE3-F GTGTGAATGAAATCGATGCG Fifth sequence KsSQE3-R AGCTTCTGCCTGCTACATCC 6th sequence KsbAS-F TAAGCAGCCGATACCTTTGC Seventh sequence KsbAS-R TAATCAGGAATTCGGGCAAG Eighth sequence Act-F ATCATGAAGTGCGATGTGGA Ninth sequence Act-R TGCTCATACGATCCGCAATA Tenth sequence

2. Results

2.1. Cell culture

Cell suspension cultures were initiated from a callus-shaped callus grown on callus induction medium. Suspension cultured cells had a yellowish, scattering cell morphology, which resulted in cell suspensions that did not agglomerate and grow individually (Fig. 1). Cell growth on MS medium containing 3% sucrose was measured in live weight at 3 day intervals. As shown in Fig. 1, fresh weight was increased from 0.7 g to 4 g after 15 days of incubation. The growth curve was delayed until day 3 after the incubation, showing a typical growth curve with an exponential growth period showing a rapid growth curve from day 3 to day 12 (FIG. 1A). Fresh weight continued to increase until the 15th day of culture, but it was browned due to cell senescence or death (Fig. 1B).

2.2 Pomegranate In suspension culture  Production of saponin

In order to investigate the ability of saponin biosynthesis in the seed suspension culture, the total saponin content was analyzed during the incubation period. The total amount of saponin in the rum was significantly increased with the incubation period, and the total amount of saponin was the highest at the 15th day of culture (1.56 mg / 60 ml suspension) (Table 2 and Fig. 2A).

Day One 3 6 9 12 15 Saponin amount
(Mg / 60 ml) 0.27 ± 0.06 0.49 + 0.07 0.83 0.06 1.03 + - 0.01 1.41 + 0.03 1.57 + - 0.12

The amount of saponin production was increased about 6 times in the last stage of culture compared to the first. However, the highest total saponin productivity in the cells was observed after 6 days of culture (0.42 ㎍ / ㎎ FW) and decreased after 9 days of culture (0.37 ㎍ / ㎎ FW) (Table 3 and Fig. 2B).

Day One 3 6 9 12 15 Saponin amount
(Mg / 60 ml) 0.31 ± 0.06 0.41 + 0.02 0.43 + 0.02 0.37 ± 0.00 0.37 ± 0.003 0.37 + 0.03

This indicates that the increase in the body weight is related to the accumulation of saponin in the culture period, but the productivity of saponin in the cells may not be related to cell growth. The physiological state of the cells for the treatment of the inducer has an important influence on the regulation of the accumulation of secondary metabolites. In most cases, when cell growth is on the late or steady-state curve of the exponential growth phase, stimulation is the most likely response in the cell (Ramirez-Estrada et al., 2016). In the case of embryo culture, when the color of the cells began to change from yellow to dark brown, it was observed that the culturing was started for 12 days, that is, the period in which the cell number was kept constant. Therefore, it was confirmed that the highest saponin production was observed in the cells at the 6th day after the exponential growth phase, and this was used for the analysis.

2.2 In the production of saponin Coronetin  And MeJA's  effect

To investigate the effects of MeJA and COR on the production yield of saponin in the oocyte suspension culture, different concentrations of MeJA and COR were treated with 6 days cultured cells. The total amount of saponin in the building was analyzed at 4 days after treatment with each inducer. As shown in FIG. 3A, MeJA or COR did not inhibit cell growth at all treated concentrations, and it was observed that the amount of saponin was increased when COR was treated on the cells (Table 4 and FIG. 3B).

- Coronetin (COR, mu M)) MeJA ([mu] M) Control group 0.5 One 2.5 50 100 250 3.77 ± 0.64 3.86 ± 0.21 3.82 ± 0.13 4.19 + 0.40 3.98 ± 0.19 4.10 ± 0.2 4.34 ± 0.03

Total saponin levels were increased by 159% and 160% at 0.5 μM and 1 μM COR treatment concentrations, respectively, as compared with the control group. However, when the COR throughput was increased to 2.5 μM, the total saponin production decreased compared to 1 μM COR treatment.

 In the case of MeJA, the treatment of MeJA had little effect on total saponin production as compared to COR, and the total saponin production was increased up to 115% in MeJA-treated cell cultures (Table 5 and FIG. 3B). These results indicate that COR is a more potent inducer to improve saponin production in a finned suspension culture.

- Coronetin (COR, mu M)) MeJA ([mu] M) Control group 0.5 One 2.5 50 100 250 100 158.98
± 7.29 159.89
± 6.64 133.13
± 22.66 115.36
± 16.25 100.73
± 16.29 100.31
± 14.04

2.3 Effect of chorotatin on the expression of genes involved in biosynthesis

The expression patterns of KsSQE and KsbAS in inducible cell cultures were analyzed by qRT-PCR. Expression of the gene of KsSQE was significantly low or scarcely expressed in MeJA or COR treated cell cultures (FIG. 4). However, in the COR cultured cell culture, the transcription level of KsbAS was 5.9 times higher than that of the control, whereas in MeJA treated cultures, KsbAS The genes were not significantly expressed. The expression of these genes is responsible for the accumulation of saponins in the seedlings . KsbAS Suggesting that expression of the gene is required. In order to prove this hypothesis, we analyzed the effect of inducer treatment on the accumulation of oleanolic acid, an oleaginous triterpene saponin. COR treatment produced 2.3 ㎍ of oleanolic acid per mg of extract, while no or little oleanolic acid was detected in cell cultures treated with control and MeJA (Table 6). Indicating a clear relationship between the expression pattern of KsbAS and the production of oleanolic acid. As a result, COR is considered to be a strong inducer in the saponin biosynthesis in the oocyte culture, especially in the biotin of Oriental triterpen saponin.

Inducing substance Oleanolic acid (μg / mg of extract) Coronatin 2.369 ± 0.98 MeJA - ^a Control group - ^a

' ^A ' in Table 2 means 'not detected'.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Method for Increasing the Content of Saponin in Kalopanax          septemlobus <130> PN170056 <160> 10 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KsSQE1-F <400> 1 caaaggtgga tgtgccttct 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KsSQE1-R <400> 2 gggtgatggg tctgctaaga 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KsSQE2-F <400> 3 gcgatctcca tgactcatca 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KsSQE2-R <400> 4 taaagtgcac ctgccaatgt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KsSQE3-F <400> 5 gtgtgaatga aatcgatgcg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KsSQE3-R <400> 6 agcttctgcc tgctacatcc 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KsbAS-F <400> 7 taagcagccg atacctttgc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KsbAS-R <400> 8 taatcaggaa ttcgggcaag 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Act-F <400> 9 atcatgaagt gcgatgtgga 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Act-R <400> 10 tgctcatacg atccgcaata 20

Claims (7)

A method for increasing the saponin content in a stem ( Kalopanax septemlobus ) comprising the steps of:
(a) Suspension culturing of callus-derived cells using a medium containing no 2,4-dichlorophenoxyacetic acid (2,4-D); And
(b) treating the culture with coronatine.
delete 2. The method according to claim 1, wherein the step (b) is carried out on days 1-15 of culture of step (a).
2. The method of claim 1, wherein the step (b) of coronetin is treated at a concentration of 0.1-3.0 [mu] M.
The method of claim 1, wherein step (b) is performed for 1 to 8 days.
The method of claim 1, wherein the saponin is oleanolic acid.
delete

Images