KR101953977B1 - Method for generation of salivary organoids using three-dimensional co-culture of stem cells - Google Patents

Abstract

The present invention relates to a method of forming a salivary gland organoid through three-dimensional stem cell culture, and more particularly, to a method of regenerating a salivary gland by co-culturing adult salivary stem cells and vascular endothelial stem cells isolated from human salivary glands (Organoids) of the like. When the salivary stem cells and the vascular endothelial stem cells were co-cultured, the organoid was observed, and it was confirmed that the organoid was formed without being affected by the cell proliferation. The organoid was found to be involved in disease modeling, pathological studies, drug screening, Toxicity assessment, and genetic engineering.

Description

[0001] The present invention relates to a method for forming salivary gland organoids by three-

The present invention relates to a method of forming a salivary gland organoid through three-dimensional stem cell culture, and more particularly, to a method of regenerating a salivary gland by co-culturing adult salivary stem cells and vascular endothelial stem cells isolated from human salivary glands (Organohydrogens). ≪ / RTI >

Stem cells are cells that have the ability to differentiate into all kinds of cells that constitute living organisms such as nerves, blood, and cartilage, while maintaining their specificity without any differentiation. There are two ways to obtain such stem cells.

The first is to obtain embryos from embryos (embryonic stem cells), and the second is to collect stem cells (adult stem cells) that are retained in various parts of the adult body. Although there are functional differences, embryonic stem cells and adult stem cells are characterized by their ability to differentiate into various types of cells. These cells have pluripotency and self-renewal ability to make self-resident cells indefinite.

Adult stem cells are not as totipotency as embryonic stem cells, but have multipotency. They do not have any ethical problems because they do not use oocytes. They extract the cells of the patients themselves and tailor them to individual patients. The greatest advantage is that there is no immune rejection because it is used as a treatment. Representative adult stem cells include mesenchymal stem cells, which can be isolated from bone marrow, fat, placenta, and umbilical cord. Such stem cells are capable of differentiating bones, cartilage, and fat, which are mesenchymal (mesenchymal) tissues, which can be cured by immune regulation and secretion of various therapeutic factors. However, there is a disadvantage in that the engraftment rate in the tissue is low and the differentiation into constitutive cells in the tissue is small.

It has been confirmed that tissue stem cells existing in salivary gland tissue are present and can be separated using various separation techniques. Previously reported salivary stem cells exhibited epithelial stem cell characteristics or mesenchymal stem cell characteristics, but no salivary stem cells capable of differentiating into all salivary gland tissue cells were found. The present inventors analyzed the characteristics of high-purity stem cells obtained by isolating and culturing single clonal stem cells, and found that the epithelial cells of the epithelium (LGR5) and mesenchymal stem cell markers (CD90) at the same time as differentiation into mesenchymal cells and differentiation into spermatogonial cells. There are also multiple differentiated salivary mesenchymal stem cells that can express the epithelial stem cell markers (LGR5) and mesenchymal stem cell markers (Scientific Report, 2016 Nov 8; 6: 36303).

The formation of pseudogenes (organoid) is typically performed by using promoters in LGR5 + single stem cells, which are intestinal stem cells. However, it has been reported that single adult stem cells capable of producing salivary gland organisms . Therefore, in order to produce salivary gland organoid, co-culture of salivary epithelial stem cells and salivary mesenchymal stem cells, mixed culture of salivary duct conduit scaffold or fetal salivary epithelial cells with mesenchyme, adult mesenchymal stem cells and salivary gland cells . In the mixed culture system of salivary gland cells, the isolated cells are co-cultured with unequal mixed cell types, resulting in low purity, irregular organoid form, and large volume There is a problem that cultivation is impossible. Therefore, there is a demand for a method using monoclonal adipose stem cells, which can be obtained in a more evenly distributed manner and has enhanced salivary gland tissue characteristics.

On the other hand, the salivary gland consists of endoderm cells, mesodermal epithelial cells, and epidermal cells, and is composed of cytoskeletal - interstitial ductal cells - striated ductal cells - secretory vascular cells and myoepithelial cells. Therefore, it is impossible to regenerate the salivary gland tissue as an adult cell. In order to regenerate the complexity of the salivary gland tissue, a stem cell treatment agent capable of inducing multiphasic differentiation is required, and a functional stem cell treatment technique It can be useful. In particular, to restore the function of a chronic salivary gland dysfunction disease with a wide range of tissue damage, stem cell transplantation is more effective than the single-graft strategy of stem cells, resulting in increased stem cell proliferation and differentiation through intracellular stem cell transplantation, Technology development can be a new solution. In the case of decreased saliva secretion due to tissue damage caused by radiation, reduction of tissue regeneration and resilience due to depletion of stem cells in salivary tissue is known to be the main mechanism of permanent injury. Therefore, for the fundamental treatment, reconstruction and replacement of damaged tissue It is necessary to develop a tissue restoration technique capable of inducing differentiation into cells and tissue regeneration through therapeutic factor secretion).

In addition, in order to discover and develop a new therapeutic drug, it is essential to develop a model that can simulate the living body and well characterize the disease. To date, the most accurate and reliable biological analysis is animal experimentation and animal analysis has high accuracy advantages in biological analysis such as toxicology and drug screening, but it also has several disadvantages. In the case of the primary culture cell model currently used in the laboratory, cells derived from the organ or tissue are artificially immortalized or two-dimensionally cultured to verify the efficacy and toxicity of the candidate substance. However, two-dimensionally artificially cultured cells are separated from the tissues and then cultured. In addition, the cell functions of the tissue units are partially lost as well as changes in the original cell morphology, and the connection with the extracellular environment (ECM, microenvironment) It has a fatal disadvantage that it does not reflect the phenomenon actually occurring in the living body. In addition, in the case of non-human cells, due to species differences, the action and mechanism of the drug are often not the same as those of human, which hinders the development of effective drug development and requires a lot of time and cost. Recently, development of stem cell organogenesis technology has been attracting attention as a means of solving this problem by producing similar organs derived from patients and using them for disease modeling, pathology research, drug screening, toxicity evaluation, and gene manipulation.

PCT International Publication No. WO 2016/168950 (published Oct. 27, 2016)

An object of the present invention is to provide a method for producing a salivary gland organoid by co-culturing adult salivary gland stem cells and vascular endothelial stem cells isolated from human salivary glands. More particularly, Among salivary monoclonal adult stem cells, salivary mesenchymal stem cells having both epithelial stem cells and mesenchymal stem cells were isolated and cultured in the extracellular matrix (Matrigel) The present invention provides a method for producing a three-dimensional salivary gland organoid having the characteristics of various salivary gland cells by co-culturing with stem cells.

In order to accomplish the above object, the present invention provides a method for producing a stem cell comprising the steps of: (1) co-culturing a stem cell and a vascular endothelial stem cell; And (2) forming an organoid through the co-culture.

The present invention relates to a method of forming a salivary gland organoid through three-dimensional stem cell culture, and more particularly, to a method of regenerating a salivary gland by co-culturing adult salivary stem cells and vascular endothelial stem cells isolated from human salivary glands (Organoids) of the like. When the salivary stem cells and the vascular endothelial stem cells were co-cultured, the organoid was observed, and it was confirmed that the organoid was formed without being affected by the cell proliferation. The organoid was found to be involved in disease modeling, pathological studies, drug screening, Toxicity assessment, and genetic engineering.

FIG. 1 shows the result of confirming cell morphology and cell proliferation by Live / Dead and viability after co-culturing salivary stem cells and vascular endothelial stem cells. When salivary stem cells were cultured alone, spoloid formation was observed. However, when co-cultured with salivary stem cells and vascular endothelial stem cells, organoids were observed and organogenes were formed without being affected by cell proliferation.
FIG. 2 and FIG. 3 show the results of three-dimensional co-culture of salivary stem cells and vascular endothelial stem cells using serum-free hepato-STIM medium, 5 μg EGF, 2 mM L-glutamine and 1% penicillin / streptomycin The results of PCR and Western blot analysis show the change of marker expression in salivary gland cells, vascular epithelial cells and neuronal cells after culturing. When salivary stem cells and vascular endothelial stem cells were co-cultured, the expression of markers in salivary gland cells, vascular epithelial cells and neuronal cells was increased by PCR signals and Western blotting.
FIG. 4 is a graph showing the results of three-dimensional co-culture of salivary stem cells and vascular endothelial stem cells, followed by incubation with a serum-free hepato-STIM medium, 5 μg EGF, 2 mM L-glutamine and 1% penicillin / streptomycin The function of the salivary gland organoid formed later is shown in the analysis result after measurement of amylase activity, intracellular pH activity and intracellular calcium. When salivary stem cells and vascular endothelial stem cells were co-cultured, the function of salivary gland organoid was found to be higher than that of salivary stem cells alone.

The present invention relates to (1) co-culturing neural stem cells and vascular endothelial stem cells; And (2) forming an organoid through the co-culture.

Preferably, the precursor cells are isolated from the intact tissue, and the vascular endothelial stem cells may be isolated from the normal maternal umbilical artery, but are not limited thereto.

Preferably, the step (1) may be performed by co-culturing the cells with the ratio of the number of cells of the stem cell and the vascular endothelial stem cells to 2: 3: 1, but is not limited thereto.

Preferably, the co-culture can be three-dimensionally cultured in an extracellular matrix (Matrigel) capable of cell cluster formation, and more preferably, the three-dimensional culture is performed using a differentiation induction medium for 3 to 5 days But is not limited thereto.

Preferably, the above-described sunorganotypes are capable of increasing amylase activity and intracellular calcium concentration, but are not limited thereto.

The lineal tissue that can be used in the present invention may be one selected from among the linear organs having similar origins, such as salivary glands, liver, pancreas, and kidney. In one embodiment of the present invention, salivary glands were used.

The salivary stem cells isolated from the salivary gland tissue used in the present invention can express the epithelial stem cell marker LGR5 and the mesenchymal stem cell marker CD90 at the same time and can differentiate into salivary gland cells which are epithelial cells, It is a multipotential stem cell capable of differentiating into cells, bone cells and adipocytes.

The vascular endothelial stem cells used in the present invention are pluripotent stem cells capable of expressing CD44, CD90, and CD146 isolated from the artery obtained from normal maternal umbilical cord without enzymatic treatment and capable of differentiating into chondrocytes, bone cells, and adipocytes. Vascular stem cells can be used as an important factor in the formation of functional organotypes because they regulate the microenvironment controlling hematopoietic differentiation of mesenchymal stem cells or hematopoietic stem cells present in various tissues.

In the present invention, the three-dimensional culture includes a culture method using an extracellular matrix (Matrigel) capable of forming cell clusters, a floating culture method in which the cells are floated in the culture medium and flocculated, And a culture method of forming cell clusters in a micropatterned nanofiber scaffold.

In one embodiment of the present invention, the production of salivary gland organoid was induced by culturing for 3 to 5 days using a Hepato-STIM culture medium which induces cell differentiation during the production of the three-dimensional organotypes.

The terms used in the present invention are defined as follows.

&Quot; Saliva " is a mixed liquid secreted from parotid glands present in the parotid gland, submandibular gland, sublingual gland, and oral mucosa. Saliva is a key component of the human body and is produced in salivary glands and released into the oral cavity. Saliva is an essential component of the human body and contains bioactive proteins, digestive enzymes, mucus, immunoglobulins, various salts and the like.

Saliva plays an important role not only in oral health but also in maintaining the homeostasis of the human body. For example, mucin and immunoglobulin, which are the main components of saliva, play a primary defense against external infections and protect oral mucosa and teeth through lubrication and moisture retention and pH neutralization of mouth and teeth. do. In addition, saliva has digestive enzymes such as amylase, such as ptyalin, and it functions to promote digestion by decomposing starch into maltose units. The secretion of saliva can also control the body's water metabolism and body temperature, and it can also excrete toxic substances (I, Hg, Pb, etc.).

"Salivary gland" is an organ that produces and secretes saliva. It is a major salivary gland such as the parotid gland, submaxillary gland, sublingual gland, And mucous glands in the mucous membrane of the oral cavity, such as the mucous glands. The mucous glands are classified as minor salivary glands distributed in various parts of the oral mucosa.

In the present invention, the term "organoid" means that cells derived from embryonic stem cells or tissues can be used for culturing the cells in the form of 3D to make them as artificial organs. The organoid is a suffix with the same meaning as organs of organs and has the term 'similar to organs'. The organotypes have a better organization and function of cells and cells through the three - dimensional culture method. Oganoids have been developed with stem cell research and 3D cell culture, and have attracted attention with optimization studies of growth and differentiation factors that can differentiate into various tissues.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the present invention is not limited by these examples.

< Example  1 > separated from salivary gland tissue And Vascular epithelial stem cells  Through co-cultivation Organoid  formation

The organotypes were cultured by co-culture of human precursor cells and vascular endothelial stem cells. The cells were co-cultured at a ratio of 2 to 3: 1 in the number of cells of the stem cell and vascular endothelial stem cells. The cells were cultured in Matrigel for 3 days using a differentiation medium (Serum-free hepato-STIM medium, 5 μg EGF, 2 mM L-glutamine, 1% penicillin / streptomycin) and examined by optical microscopy and LIVE / Nodules were observed. Calcein AM (calcein acetoxymethyl ester) and ethidium homodimer-1 were used to observe living cells and dead cells when inducing the production of organoids through a fluorescence microscope. As a result of the co-culture of neural stem cells and vascular endothelial cells, it was confirmed that an organoid was formed. The images were confirmed by LIVE / DEAD staining, and it was confirmed that the organoid was well formed (FIG. 1).

< Example  2> Characterization of organotypes formed by co-cultivation of stem cells with vascular endothelial stem cells

1. Salivary gland cells, Vascular envelope stem cells , Neuronal  Character analysis

The organotypes formed by co-culturing the mesenchymal stem cells from the salivary gland tissue with vascular endothelial stem cells were cultured in a differentiation medium (Serum-free hepato-STIM medium, 5 μg EGF, 2 mM L-glutamine, 1% penicillin / streptomycin) The results of PCR and Western blot analysis show the marker differences between salivary gland cells, vascular epithelial cells and neuronal cells. When co - culture of stem cells with vascular endothelial stem cells, salivary gland cells and neuronal cell markers were increased, and vascular epithelial cells were not changed. These marker changes were confirmed by real-time PCR and western blotting (FIGS. 2 and 3).

2. Real time PCR  Used mRNA  Expression analysis

Cells collected for real-time PCR are processed in a solution of Trizol solution and then completely prepared in solution. After 0.2 ml of chloroform was added, the mixture was stirred for 15 seconds and left at room temperature for 15 minutes. After centrifugation at 12,000 rpm for 15 minutes at 4 ° C, only the transparent layer was extracted and the same volume of 80% isopropanol was treated, left at 4 ° C for 10 minutes, and centrifuged again. After removing the supernatant, the supernatant was placed in 1 ml of 75% ethanol and allowed to stand at 4 ° C for 3 minutes. The supernatant was removed, and the supernatant was removed for 10 minutes.

1 [mu] l of RNA was determined according to the manufacturer's method using real-time PCR on an ABI PRISM 7000 Sequence Detection System using SYBR Green I. PCR reactions were performed using 5 μM cDNA, 10 μM SYBR Green PCR master mix, and 10 μM sense and antisense primers for a final volume of 20 μM per reaction (FIG. 2). The sense and antisense primer sequences used are shown in Table 1.

α-Amylase (AMY1A) F AATTGATCTGGGTGGTGAGC R CTTATTTGGCGCCATCGATG Aquaporin 5 (AQP5) F ACTGGGTTTTCTGGGTAGGG R GTGGTCAGCTCCATGGTCTT CK7 (KRT7) F CAGGATGTGGTGGAGGAC R AACTTGGCACGCTGGTTCT CK18 (KRT18) F GGAGGCTGGAGAGCAAAATC R AGTCATCAGCAGCAAGACGG E-Cadherin (CDH1) F CGCATTGCCACATACACTCT R TTGGCTGAGGATGGTGTA AG ZO-1 (TJP) F TTTGGCCGAGGGATAGAAGT R TATTGCCATCTCTTGCTGCC MCAM F CAGACCAGTCTCCCAGGAGG R CAGCCCTCGGAGGTTCTGTA NG2 F AATTGATCTGGGTGGTGAGC R CTTATTTGGCGCCATCGATG PDGFR-beta F CACCAAGACCACCTTCTCGC R GGTCTTGGGTGTGCTGGATG GFAP F GCTCTCAGACACCAGGTTGC R GTCTTCATGGGCTGTTGGGG Nestin F CTGATTGGAGGGACCGGACT R CTCGAGGCTGGGAGAAGTCA PECAM-1 F AGCCAGGTCCCTCAGTCAAG R GTGCAGAGGGCTTTATGGGC VEGF F AGCTGTGCTATGTTGCCCTG R AGGAAGCAAGGCTGGAAGAG

3. Western Blat  Analysis of stem cells Marker  Confirm

First, a protein sample was separated from a cell lysate (30 μg), mixed with a reducing buffer, heated, transferred to a 10% SDS-PAGE gel, and then subjected to electroblotting to remove the protein from polyvinylidene difluoride (Polyvinylidene difluoride) membrane. The membranes were blocked with 5% wt / vol nonfat dry milk in TBS for 30 min at room temperature and incubated overnight at 4 ° C with the primary antibody against the antigen: α-amylase, AQP5, ZO-1, CK7, CK18 and β-actin (Santa Cruz Biotechnology, CA, USA); E-cadherin (BD Pharmingen, San Diego, CA, USA); Occludin (Thermo Scientific, San Diego, CA, USA); After washing the blots with Mist-1, CD146, GFAP and CD31 (Abcam, Cambridge, UK), PBS, Tween 20, blots were incubated with horseradish peroxidase- conjugated secondary antibody corresponding to each primary antibody Followed by enhanced chemiluminescence detection (Santa Cruz Biotechnology). Positive immunoreactive bands were quantified by densitometry and compared with human β-actin expression (FIG. 3).

< Example  3> Functional analysis of organotypes formed by co-culture of stem cells with vascular endothelial stem cells

One. Organoid  Functional evaluation: Measurement of α-amylase activity

Amylase activity was measured to measure the function of the organoid. Amylase activities were measured using α-amylase activity assay kit (Abcam, Cambridge, Mass., USA) after collecting the culture medium of organotypes formed by co-culture of adenocarcinoma cells and vascular endothelial cells. It was confirmed that the activity of amylase was increased in the organotypes according to the co-culture (Fig. 4).

2. Organoid  Functional evaluation: intracellular pH measurement

To measure the function of the organoid, intracellular pH in the organoid was measured using BCECF-AM (Molecular Probe, Carlsbad, Calif., USA). BCECF-AM was added to the formed organoid and stained at 37 ° C for 1 hour. A fluorescence value was measured using a fluorescence microscope, and a fluorescence value was measured by adding a buffer containing HCO3 &lt; - &gt; into a buffer containing no HCO3 &lt; - &gt; in the stained organotypes. It was confirmed that the intracellular pH was changed by co-culture (FIG. 4).

3. Organoid  Functional assessment: intracellular calcium measurement

To measure the function of the organoid, intracellular calcium was measured in the organotypes using Fluo-4AM (Molecular Probe, Carlsbad, Calif., USA). Fluo-4AM was added to the formed organotin and stained for 1 hour at 37 ° C. Then, calcium indicator ATP (adenosine triphosphate, 100 μM), TG (thapsigargin, 1 μM) and CChol (Carbachol, 10 μM) , MO, USA) and fluorescence was measured by a fluorescence microscope. It was confirmed that calcium secretion was increased according to co-culture (Fig. 4).

Claims (8)

(1) three-dimensionally co-culturing an extracellular matrix (Matrigel) capable of forming a cell cluster with a ratio of the number of cells of salivary stem cells and vascular endothelial stem cells to 2: 3: 1; And
(2) an amylase activity comprising the step of forming an organoid through the co-culture, and a method of forming salivary gland organisms with increased intracellular calcium concentration. The method according to claim 1, wherein the salivary glandular stem cells are separated from salivary gland tissue. The method according to claim 1, wherein the vascular endothelial stem cells are isolated from a normal maternal umbilical artery. delete delete The method according to claim 1, wherein the three-dimensional co-culture is cultured for 3 to 5 days using a differentiation induction medium. delete delete

Images