KR101948873B1 - Paper-based colorimtric sensor for high efficient, rapid and visual detection of bacterial pathogen and high efficient, rapid and visual detection of bacterial pathogen - Google Patents

Abstract

Provided is a paper-based colorimetric sensor kit for a rapid and simple naked eye diagnosis of pathogenic bacteria. The paper-based colorimetric sensor kit comprises: a complex conjugate solution where aptamers, capable of selectively binding to target bacteria and DNAzyme, are bound to a magnetic nanoparticle having enzyme-like action; a substrate causing a colorimetric reaction by the magnetic nanoparticle having the enzyme-like action and enzymatic action of the DNAzyme; and radial paper chromatography on which the complex conjugate and the substrate reacted with a test sample are provided on a surface and a colorimetric ring is formed when the target bacteria are in the test sample.

Description

TECHNICAL FIELD [0001] The present invention relates to a paper-based colorimetric sensor kit for rapid visual inspection of pathogenic bacteria, and a quick and simple visual detection method of pathogenic bacteria using the same. BACKGROUND ART < RTI ID = 0.0 > PAPER-BASED COLORIMTRIC SENSOR FOR HIGH EFFICIENT, RAPID AND VISUAL DETECTION OF BACTERIAL PATHOGEN AND HIGH EFFICIENT, RAPID AND VISUAL DETECTION OF BACTERIAL PATHOGEN}

The present invention relates to a sensor for diagnosing pathogenic microorganisms and a detection method using the same, and more particularly, to a paper-based colorimetric sensor kit for rapid and rapid diagnosis of pathogenic bacteria and a method for rapid detection of pathogenic bacteria using the same.

Microorganisms, especially pathogenic bacteria, are closely related to public health and are becoming a cause of various diseases and food poisoning accidents. In particular, food poisoning accidents of agricultural products have been increasing worldwide over the last 10 years. Accordingly, there is an increasing demand for diagnostic methods and sensors that can rapidly diagnose food poisoning bacteria contamination early, prevent the occurrence of food poisoning, and reduce the social cost of food poisoning.

In the case of the diagnostic method using conventional culture and biochemical tests, it is not suitable to prevent food poisoning accidents by pre-measurement and diagnosis before consumption of agriculture products, which is a time consuming method of about 3 to 5 days.

Conventional sensors include immunoassays using an antigen antibody using a radioisotope or a fluorescent substance as a label, a nonplanar biosensor, an optical biosensor such as a surface plasmon resonance biosensor, a total internal reflection microbiological sensor, an optical waveguide biosensor Are attracting attention. However, such a biosensor has a disadvantage in that expensive optical measuring equipment is required, and a demand for a method for measuring pathogenic bacteria in a more economical manner continues.

A paper-based colorimetric sensor kit for the diagnosis of pathogenic bacteria which can detect the pathogenic bacteria quickly and simply in real time in the field from the naked eye and does not require complicated and expensive optical measuring equipment, and a method for rapid detection of pathogenic bacteria using the kit .

Embodiments according to the present invention can be used to accomplish other tasks not specifically mentioned other than the above-described tasks.

The paper-based colorimetric sensor kit for rapid, visual visualization of pathogenic bacteria according to embodiments comprises a complex conjugate comprising a DNA-based enzyme (DNAzyme) and an aptamer capable of selectively binding to a target bacterium to a magnetic nanoparticle having an enzyme- A solution, a magnetic nanoparticle having the enzyme-like action and a substrate causing a colorimetric reaction by enzymatic action of the DNA-based enzyme (DNAzyme)

The conjugated conjugate solution reacted with the test sample and radial paper chromatography wherein the substrate is provided on a surface and a colorimetric ring is formed when the target sample is present in the test sample.

The rapid method of detecting pathogenic bacteria according to embodiments comprises reacting a test sample with a complex conjugate solution in which a magnetic nanoparticle having enzyme-like action is combined with a DNA-based enzyme (DNAzyme) and an aptamer capable of selectively binding to the target bacteria Providing the complex conjugate solution reacted with the test sample to paper chromatography, and providing a substrate for causing a colorimetric reaction by enzyme-like action of the magnetic nanoparticle of the complex conjugate and a DNA-based enzyme, And the presence or absence of the target bacteria is observed by observing whether a colorless ring is formed in the radial paper chromatography.

The paper-based colorimetric sensor kit according to the present disclosure enables rapid detection without incubation or culturing of pathogenic bacteria or only short incubation within 1 hour.

The paper-based colorimetric sensor kit according to the present disclosure can detect the presence of pathogenic bacteria visually without expensive optical measurement equipment.

1 is a conceptual diagram illustrating a method for detecting pathogenic bacteria using a paper-based colorimetric sensor kit according to an embodiment of the present invention.
2 is a conceptual diagram illustrating a separation process for increasing detection efficiency according to another embodiment of the present invention.
3 is a schematic view showing a separation process according to another embodiment of the present invention.
4 is a schematic view showing a separation process according to another embodiment of the present invention.
5 is a conceptual diagram illustrating a method for detecting pathogenic bacteria using a paper-based colorimetric sensing syringe according to another embodiment of the present invention.
FIG. 6 is a graph showing TEM images of synthesized magnetic nanoparticles and results of measurement of diameters of synthesized particles. FIG.
Figure 7 is a graph showing the results of SYBR Green < RTI ID = 0.0 > Ⅱ < / RTI > staining of synthesized particles.
FIG. 8 is a graph of absorbance of the synthesized particles measured for enzyme activity.
9 is an image showing the result of the colorimetric reaction.

Hereinafter, exemplary embodiments of the present invention will be described in detail with reference to the accompanying drawings, which will be readily apparent to those skilled in the art to which the present invention pertains. The present invention may be embodied in many different forms and is not limited to the embodiments described herein.

When an element is referred to as "including" an element throughout the specification, it means that the element may further include other elements unless specifically stated otherwise. The sizes and thicknesses of the respective components shown in the drawings are arbitrarily shown for convenience of explanation, and the present invention is not limited to the illustrated ones.

1 is a conceptual diagram for explaining a method for detecting pathogenic bacteria using a paper-based colorimetric sensor kit according to an embodiment.

First, a test object for testing whether a target bacteria exists is sampled (Fig. 1 (a)). Sampling can be done in a variety of ways, but using a swap portion 10 comprising a swab rod 12 and a swab 14 at one end of the rod 12 and a lid 16 at the other end, The surface of the object 1 can be swapped to sample the object to be detected.

When sampling the detection target using the swap unit 10, sampling can be performed over the entire area of the surface of the detection target very easily. However, the sampling is not necessarily limited to swap, and various other sampling methods such as stamping may be possible.

Subsequently, a complex conjugate 20 (hereinafter referred to as MNP-Apt / Apt) in which the magnetic nanoparticle 22 having enzyme-like action is bound with a DNA-based enzyme 23 and an aptamer 24 capable of selectively binding to the target bacteria 26, Dz) is mixed with the swap test sample sampled by the swap section 10 and reacted.

The reaction can be carried out at room temperature within 1 hour, preferably within 30 minutes, and in some cases, the reaction time may be further shortened.

The magnetic nanoparticles 22 with enzyme-like action may be magnetic nanoparticles exhibiting Peroxidase-like action. The magnetic nanoparticles exhibiting peroxidase-like action may be Fe ₃ O ₄ .

5'-GGGTTGGGCGGGATGGGTTT-3 '(Biosensors and Bioelectronics 78 (2016) 236-243), 5'-GGGTTAGGGTTAGGGTTAGGG-3' (Biosensors and Bioelectronics 77 (2016) 879-885), 5'- (Biosensors and Bioelectronics 73 (2015) 98-103), 5'-TTTGGGTAGGGCGGGTTGGG-3 '(Biosensors and Bioelectronics 73 (2015) 41-46), etc. may be used.

A magnetic nanoparticle 22 with enzyme-like action may be immobilized with streptavidin followed by reacting the biotin-conjugated aptamer to form MNP-Apt / Dz (20) capable of binding to the target bacteria have.

For example, when the target bacteria is E. coli O157: H7, 5'-CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG-3 '(Talanta 147 (2016) 177-183, Analytica Chimica Acta 861 (2015) 62-68, Nanoscale Research Letters 7 ) 658, etc.) is referred to as aptamer, and when the target bacteria is Staphylococcus aureus, 5'-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATCCCACAGCTACGTCAA

TACGTCAAAAGTGCACGCTCTTTGCTAA-3 '(ACS Appl. Mater. Interfaces 7 (2015) 2091920929, Nucleic Acids Res 37 (2009) 4621-4628, etc.) can be used as the aptamer.

However, the above target bacteria and aptamers are exemplary, and for most food poisoning bacteria, the already developed aptamer can be applied as it is. For example, a method for screening aptamers for each strain in various papers (eg, Soledad et al., Isolation of an Aptamer that binds specifically to E. coli, Plos one, (2016) To select the target bacteria and the corresponding aptamer.

It is enough to contain the aptamer as much as necessary for target cell targeting, and the more the DNAzyme is, the higher the enzyme activity becomes, and the detection sensitivity can be increased. Accordingly, the ratio of the DNA-based enzyme 23 binding to the magnetic nanoparticles 22 and the aptamer 24 selectively bindable to the target bacteria 26 may be preferably 20: 1 to 30: 1. It is possible to maintain the binding of the target bacteria 26 while maximizing the synergistic effect of the enzymatic affinities of the magnetic nanoparticles 22 and the DNA-based enzyme 23. The sweeper 10 is sealed at one end of the reactor 30 and the other end is formed in the shape of a drop provided with a lid 32 so that the reacted solution can be discharged to the outside The convenience of use can be improved.

1 (c), the MNP-Apt / Dz solution reacted with the test sample in the reactor 30 by opening the lid 32 at the end of the reactor 30 was subjected to a radial paper chromatography (40) phase .

The reactor 30 is provided on the radial paper chromatography 40 with the MNP-Apt / Dz solution 36 reacted with a certain amount of the test sample when a certain pressure is applied to the surface of the reactor 30.

1C shows an example in which the reactor 30 is made of a material capable of providing a predetermined amount of the solution 36 by providing a constant pressure to the structure of the lid 32 capable of discharging the reaction solution to the outside, But the reaction solution may be supplied to the outside by using a separate dropper or pipette from the reactor 30.

1 (d), a substrate 50 causing a colorimetric reaction by the enzyme-like action of the magnetic nanoparticles (MNP) and the DNA-based enzyme (DNAzyme) is further added on the radial paper chromatography 40 And the reaction proceeds at room temperature for a certain period of time.

The radial paper chromatography (40) drops the sample solution to be measured in the radial form rather than the lateral type, and the size and weight of the MNP-Apts and the target molecules (pathogenic bacteria) The presence or absence and the degree of the target molecule can be easily confirmed by the difference in degree of spread according to the weight difference.

Therefore, there is no need to immobilize a receptor such as an antibody on the surface of a paper, and it is advantageous in terms of cost reduction and storage stability. Further, since the aptamer is used instead of an antibody, sensitivity to environmental changes such as temperature change is more advantageous in terms of storage stability .

The resolution may vary depending on the material, pore size, hydrophilic or hydrophobic character of the radial paper chromatography 40, and the like.

The radial paper chromatography 40 may be paper chromatography comprising PVDF (polyvinylidene fluoride) NC (nitrocellulose) or the like.

A substrate 50 causing a colorimetric reaction by enzymatic similar action of the magnetic nanoparticles 22 and the DNA-based enzyme 23 is additionally provided on the radial paper chromatography 40, do.

By using the enzyme-like action of the DNA-based enzyme 23 of the magnetic nanoparticles 22 to induce a colorimetric reaction, it is possible to perform colorimetric sensing on a paper.

If the enzymatic affinities of the magnetic nanoparticles 22 and the DNA-based enzyme 23 are peroxidase-like, the substrate may contain substances that discolor while providing the hydrogen donor necessary for the reduction of hydrogen peroxide and hydrogen peroxide.

Examples of materials that discolor while providing a hydrogen donor include 3,3 ', 5,5'-tetramethylbenzidine (TMB), 3-aminophthalic acid hydrazide, 2,2 -Azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt, 2,2'azino-bis (3-ethylbenzothiazoline- 3,3'-Diaminobenzidine (DAB), and o-phenylenediamine dihydrochloride (OPD).

[Chemical Formula 1]

H ₂ O ₂ + TMB → 2H ₂ O + oxidized TMB (cyan)

H ₂ O ₂ + luminol → 2H ₂ O + oxidized luminol (green blue)

H ₂ O ₂ + ABTS → 2H ₂ O + oxidized ABTS (green)

H ₂ O ₂ + DAB → 2H ₂ O + oxidized DAB (brown)

H ₂ O ₂ + OPD → 2H ₂ O + oxidized OPD (yellow)

The reaction can proceed at room temperature for about 20 minutes so that the colorimetric reaction can take place sufficiently.

Referring to FIG. 1 (e), the degree of colorimetry is measured using a simple portable colorimeter 60. When a quantitative analysis is required, a colorimetric system is used, but the use of the colorimetric system 60 may be omitted when only the presence of pathogenic bacteria is to be confirmed. Of course, more precise colorimetric or precision optical measuring instruments than the portable colorimeter 60 can be used when more accurate quantitative analysis is required.

According to another embodiment, the cell lysis of the pathogenic bacteria present in the swap test sample can be further proceeded prior to reacting the swap test sample with MNP-Apt / Dz (20). Cell lysis can be applied to both physical and non-physical methods. Physical methods include agitation, sonication, and the like. As a nonphysical method, freezing thawing, osmotic shock, enzyme treatment, detergent treatment and the like can be used.

The cell crushing may be carried out using the reactor 30 shown in FIG. 1 or may be carried out in a separate reactor. The binding efficiency may be increased when the enzyme is treated with the enzyme-like MNP-Apt / Dz (20) after cell crushing.

Meanwhile, a separation process for increasing the detection efficiency can be additionally performed. Embodiments of various separation processes are described below.

Referring to FIG. 2, a reaction solution is reacted with a solution containing an enzyme-like MNP-Apt / Dz (20) (see FIG. 1 (b)) and provided on a radial paper chromatography 40 Apt / Dz and impurities (eg, non-target bacteria, proteins, etc.) bound to the target bacteria are separated using a magnet 70 prior to centrifugation (see Figure 1 (c)).

A number of enzyme-like MNP-Apt / Dz can be bound to the target bacteria. Thus, the target bacterial-enzyme-like MNP-Apt / Dz conjugate behaves like a particle of relatively large size relative to impurities (eg, non-target bacteria, proteins, etc.). Thus, the target bacterial-enzyme-like MNP-Apt / Dz complex has a larger magnetic force due to the magnetic field applied by the external magnet 70. Thus, the target bacteria-enzyme-like MNP-Apt / Dz conjugate can be collected at the bottom of the reactor 30 in which the magnets are arranged. The subsequent steps are the same as those described with reference to Fig.

3 is a schematic diagram illustrating a separation process according to another embodiment.

Referring to FIG. 3, a swap unit 10 is inserted into a first reactor 32 containing a MNP-Apt / Dz 20 so that a mixing reaction occurs. Test samples are mixed and reacted, The reaction solution is placed in the upper portion 36 of the second reactor 34, which is a magnetic separation reactor containing the magnetic particles 38. The second reactor 34 is provided with a magnet 70 at its lower end, and may preferably be provided as a lid at the lower end of the magnet 70.

The high viscosity solution 38 may be a liquid having a higher viscosity than water and the viscosity may be determined by the distance the target bacterial-enzyme-like MNP-Apt / Dz conjugate must travel and the magnetic force of the lower magnet 70 have. Preferably, the high viscosity solution 38 may be a liquid having a viscosity higher than that of water, and may have a viscosity of about 20 to 200 times that of water so that separation can take place more efficiently.

As the high-viscosity solution 38, for example, an aqueous solution of polyvinylpyrrolidone can be used. The molecular weight of polyvinylpyrrolidone may be from 5,000 to 30,000, preferably from 6,000 to 20,000. For example, polyvinylpyrrolidone having a molecular weight of about 10,000 may be used in a concentration of 10 to 60% by weight.

When the high viscosity solution 38 is used, the target bacterial-enzyme-like MNP-Apts complex easily migrates to the bottom along the viscous solution 38 due to its weight and magnetism, while the impurity (e.g., non-target bacteria, ) Are separated from each other by stopping in the middle.

4 is a schematic view showing a separation process according to another embodiment.

4 (a), the swap test sample is reacted with a solution containing the enzyme-like MNP-Apt / Dz (20) (see FIG. 1 (b) . The reaction vessel used in this case may consist of a syringe-like container 33 and a cartridge 39 which is fastened to the end of the container 33 and into which the filter 80 is inserted. The reaction solution may be fed into the syringe-type container 33, and then the reaction solution may be supplied to the filter 80 inserted in the cartridge 39 to perform filtering. The filter 80 filters the enzyme-like MNP-Apt / Dz (20), which is not associated with impurities such as non-target bacteria, proteins, target bacteria, and binds to the target bacterial-enzyme-like MNP-Apt / Remains in the filter (80). Therefore, the pore size of the filter 80 should be greater than the size of the MNP-Apt / Dz (20) and smaller than the size of the bacteria. Since the diameter of the MNP-Apt / Dz 20 is about 85 nm and the average size of the bacteria is 1 to 3 um, the pore size of the filter 80 can be made 450 to 500 nm or less. As a result, the enzyme-like MNP-Apt / Dz (20) that is not associated with the target bacterial can be sufficiently removed and the target bacterial-enzyme-like MNP-Apt / Dz conjugate 100 remains in the filter 80. When the size of the MNP-Apt / Dz 20 is small, a smaller pore size of the filter can be used. In this case, since the MNP-Apt / Dz (20) does not remain in the filter, it is possible to obtain a more accurate result. Therefore, it is desirable that the pore size is as large as possible within the range in which the bacteria can be filtered.

Subsequently, as shown in FIG. 4 (b), a substrate 50 causing a colorimetric reaction is injected into the container 33 by enzyme-like action of magnetic nanoparticles (MNP) and DNA-based enzyme (DNAzyme) The substrate 50 is supplied to the filter 80 inserted in the filter 80 to induce a colorimetric reaction.

In FIG. 4, the colorimetric reaction proceeds in a state where the filter 80 is inserted into the cartridge 39. However, if necessary, the filter 80 may be separated and a subsequent colorimetric reaction may be performed. That is, the filter 80 in which the target bacterial-enzyme-like MNP-Apt / Dz conjugate 100 remains is separated from the cartridge 39, placed on a flat container, and the substrate 50 is dropped to induce a colorimetric reaction. It can also be measured.

FIG. 5 is a conceptual diagram for explaining a method for detecting pathogenic bacteria using a paper-based colorimetric sensing syringe according to another embodiment.

The paper-based colorimetric sensing syringe 500 has a structure in which the target bacteria 26 is formed by a combination forming portion 510 into which the sampling pad 2 is inserted, a sensing portion 520 into which the detection pad 40 is inserted and a pumping portion 530 . The coupling forming portion 510, the sensing portion 520, and the pumping portion 530 are formed in a structure that can be easily separated from each other. When the sample solution is sucked from the container 540 containing the sample solution to be measured using the pumping unit 530, the target bacteria 26 is caught by the lower part of the sampling pad 2 and adsorbed. Since the pore size of the sampling pad 2 is smaller than that of the target bacteria 26, the matrix and the liquid smaller than the pore size are passed upward to be positioned in the coupling part forming part 510 and the sensing part 520. Subsequently, the bonding material forming part 510 is separated, the solution remaining in the bonding material forming part 510 is discarded, and the bonding material forming part 510 is turned upside down, and then the bonding part 510 is tightened again with the sensing part 520. Therefore, both the upper and lower ends of the coupling forming portion 510 are formed in a shape that can be coupled with the sensing portion 520.

After the sample pad 2 is inverted and the target bacteria 26 is adsorbed on the sample pad 2, the enzyme-like MNP-Apt / Dz (20) solution is supplied to the vessel 540 and then the pumping operation of the pumping part 530 Inhale it. The target bacteria 26 bound to the sampling pad 2 by the movement of the inhaled enzyme-like MNP-Apt / Dz (20) solution dissolves into the liquid and the target bacteria 26 and the enzyme-like MNP- Apt / Dz (20) are combined to form a combined body (100). The binding reaction is allowed to proceed for 20 to 30 minutes as a whole in order to ensure sufficient binding between the binding unit forming unit 510 and the sensing unit 520.

Subsequently, when the solution is pumped by the pumping operation of the pumping unit 530, only the binding unit 100 larger than the pore size of the detection pad 40 of the sensing unit 520 is caught, and the unconjugated enzyme-like MNP-Apt / Dz Passes through the detection pad 40 and is discharged to the outside together with the liquid. The detection pad 40 may be the above-described radial paper chromatography.

Subsequently, the substrate (see reference numeral 50 in FIG. 1) is again placed in the container 530 and the substrate is sucked through the pumping unit 530 to filter the residual bacterial-enzyme-like MNP-Apt / Dz complex The substrate 100 reacts with the substrate and a colorimetric reaction occurs in the radial paper chromatography 40 of the sensing unit 520.

In some cases, the detection pad 40 may be detached and immersed in the substrate, or the substrate may be dropped on the detection pad 40 to perform the color reaction.

If the paper-based colorimetric sensing syringe as shown in FIG. 5 is used, the formation of the complex and the colorimetric reaction can be performed in a single syringe as one body, and the sensing can be performed more easily.

Although one MNP-Apt / Dz has been described as one target bacterium in the above embodiments, it is needless to say that a kit for simultaneous detection of multiple targets can be provided by applying an aptamer having specificity for different target bacteria.

The following examples and figures are provided to better understand the conceptual aspects and methods of embodiments of the present invention and to elucidate the operation and effects thereof. However, these experimental examples are merely given as examples of the invention, and the scope of the invention is not limited thereby.

Experimental Example

Synthetic example  One: Fe ₃ O ₄  Magnetic nanoparticles ( MNP ) -Apt / Dz  Synthesis of

Fe3O4 magnetic nanoparticles were prepared using a co-precipitation method. Specifically, 1 M at 80 with stirring for 40 minutes aqueous sodium hydroxide solution was rapidly added to a mixture of 0.25 M FeCl2 and FeCl3 (Fe ^{+ 3} / Fe ^{+ 2} = 2) in water (pH 10). After cooling to room temperature, the precipitate was collected, washed several times with water, then with 70% ethanol and dried at 70 under vacuum.

Amine-modified MNPs were then prepared. Specifically, 5 g of MNPs were suspended in 10 mL of methanol and a toluene solution (volume ratio 1: 1) containing 10 μL of 3 mM 3- (aminopropyl) triethoxysilane (APTES) was added. Stirred vigorously for 20 hours. The precipitate was collected, washed several times with methanol using magnetic separation, and dried under vacuum at 50. [

10 mg of amine-modified MNP was washed several times with 5 mL of PBS solution. The particle pellets were then resuspended in 10% glutaraldehyde solution and incubated for 2 hours at room temperature with shaking. The glutaraldehyde functionalized particles were collected and washed with PBS solution to remove unreacted glutaraldehyde completely and stored at 4 until use.

In order to conjugate streptavidin to the functionalized MNP, two separate reaction solutions containing 1 mg of glutaraldehyde-functionalized particles in 900 μl of PBS solution and 100 μl of streptavidin solution (500 μg / ml) . The two solutions were mixed and the resulting mixture was incubated at 4 overnight. Streptavidin-conjugated MNPs were washed several times with PBS solution containing 1% BSA for 1 hour.

After that, aptamer and DNAzyme with biotin at the 5 'end were prepared at 2 uM and 40 uM (concentration ratio 1:20), respectively, and mixed with 1 mg / mL streptavidin binding-MNP solution. And reacted at room temperature for about 1 hour to synthesize Fe ₃ O ₄ magnetic nanoparticle (MNP) -Apt / Dz, which is a combination of aptamer and DNAzyme due to strong binding between biotin and streptavidin.

6A shows a TEM image of synthesized Fe ₃ O ₄ MNP. It can be confirmed that the average diameter of the produced Fe ₃ O ₄ MNP is about 10 nm or less. As a result of measuring the average diameter after binding of streptavidin, it can be confirmed that the average diameter is about 60 nm or less as illustrated in FIG. 6B. Finally, it can be seen that the average diameter of the magnetic nanoparticles (MNP-Apt / Dz) in which the aptamer and the DNA-based enzyme are combined is about 85 nm.

Comparative Example 1: Preparation of MNP-Apt

Fe ₃ O ₄ MNP was reacted with APTES (3- (aminopropyl) triethoxysilane) and glutaraldehyde to activate amine groups on the surface, followed by immobilization with streptavidin, and biotin conjugated aptamer 5 ' - Biotin-CCG GAC GCT TAT GCC TTG CCA TCT ACA GAG CAG GTG TGA CGG-3 ') and streptavidin-conjugated Fe ₃ O ₄ MNP 1 mg / mL to synthesize Fe ₃ O ₄ MNP-APts Respectively.

Comparative Example 2: Preparation of MNP-Dz

MNP-Dz was formed by combining streptavidin-conjugated Fe ₃ O ₄ MNP 1 mg / mL with DNAzyme 50 μM.

Experimental Example 1

The particles synthesized in Synthesis Example 1 and Comparative Examples 1 and 2 were subjected to SYBR green Ⅱ staining test. The result is shown in Fig. SYBR Green II dye tends to bind best with aptamer, and both aptamers and DNA-based enzymes (DNAzymes) are well bound to Fe ₃ O ₄ MNP.

Experimental Example 2

Enzyme activity of the particles synthesized in Synthesis Example 1 and Comparative Examples 1 and 2 was measured by providing TMB and hydrogen peroxide as substrates.

As shown in the absorbance measurement graph shown in FIG. 8, the peak of 650 nm was the largest in MNP-Dz having enzyme function, and the peak of 650 nm was present in MNP alone in MNP-Apt The peak was smaller than the case. This is interpreted as a decrease in enzyme activity due to the Apt surrounding the MNP surface. On the other hand, in the case of MNP-Apt / Dz, the peak was higher than that of MNP alone, which is interpreted as a synergistic effect of MNP and DNAzyme enzymatic activity. Therefore, it can be seen that the synergistic effect of enzyme activity can be obtained by appropriately adjusting the ratio of DNAzyme and Apt, and at the same time, the binding force with the target bacteria can be optimized.

Experimental Example 3

(a) E.coli O157: H7 sample containing 2X10 ⁸ cells 1000μL, (b) target cells not containing the MNP-Apt / Dz 500 μg / mL blank containing only sample 1000μL, (c) 2X10 ⁸ cell 1000 μL of a control sample containing 500 μg / mL of MNP-Apt / Dz in 1000 μL of non-target sample, (d) 1000 μL of a test sample containing 500 μg / mL of MNP-Apt / Dz in 1000 μL of target E. coli O157: H7 ² × ^{10 8} cells After reacting for 30 minutes each, each sample was filtered using a syringe on each of the corresponding radial papers. The radial paper was a PVDF membrane having a diameter of 13 mm and a size of 0.45 μm. Then 100μL 100mM TMB and 3M H ₂ O ₂ 50 μL of the mixed solution was injected into the PVDF membrane, and 20 minutes later, the color reaction was observed.

The results are illustrated in FIG. (a), (b) and (c) contrast (d) It can be seen that the colorimetric ring appears clearly only in the case of the test sample. Thus, it can be seen that the target sample can be very easily and simply visually sensed.

While the present invention has been described in connection with what is presently considered to be practical exemplary embodiments, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, Of course.

10: Swap part 20: MNP-Apt / Dz
30: Reactor 40: Radial paper chromatography

Claims (20)

A complex conjugate solution combining a DNA-based enzyme and an aptamer capable of selectively binding to a target bacterium to magnetic nanoparticles having an enzyme-like action;
A substrate causing the colorimetric reaction by the enzymatic action of the DNA-based enzyme and the magnetic nanoparticle having the enzyme-like action;
A radial paper chromatography in which the complex conjugate solution and the substrate reacted with the test sample are provided on a surface and a colorimetric ring is formed when the test sample is present in the test sample;
A sensing part for inserting the radial paper chromatography on the coupling part forming part, and a sensing part for sucking the complex conjugate solution to absorb the target bacteria adsorbed on the sampling pad, After the complex conjugate is allowed to bind, the magnetic nanoparticle-aptamer / DNA-based enzyme conjugate having the target bacterial-enzyme-like action is filtered to the sensing unit, and the substrate is filtered to filter the sensing unit And a paper-based colorimetric sensing syringe including a pumping unit for causing the substrate to react with the remaining binding substance to cause a colorimetric reaction. A paper-based colorimetric sensor kit for quick visual inspection of pathogenic bacteria. The method according to claim 1,
Based colorimetric sensor kit wherein the ratio of the DNA-based enzyme: aptamer is 20: 1 to 30: 1. The method of claim 1, wherein the magnetic nanoparticles are magnetic nanoparticles exhibiting peroxidase-
Wherein the substrate comprises a substance that is discolored while providing a hydrogen donor that is necessary for the reduction of hydrogen peroxide or organic peroxide and the hydrogen peroxide or organic peroxide. The method of claim 3,
The magnetic nanoparticles exhibiting the peroxidase-like action are Fe ₃ O ₄ ego,
The material which is discolored while providing the hydrogen donor is 3,3 ', 5,5'-tetramethylbenzidine, luminol, 2,2'-azino-bis (3-ethylbenzothiazoline- Ammonium chloride, ammonium salt, 3,3'-diaminobenzidine or o-phenylenediamine dihydrochloride. The method according to claim 1,
The aptamer is 5'-biotin-CCG GAC GCT TAT GCC TTG CCA TCT ACA GAG CAG GTG TGA CGG-3 ', the target bacteria is E. coli O157: H7,
Wherein the aptamer is 5'-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATC CCACAGCTACGTCAATACGTCAAAAGTGCACGCTCTTTGCTAA-3 ', wherein the target bacteria is Staphylococcus aureus. The method according to claim 1,
Based colorimetric sensor kit wherein the DNA-based enzyme is 5'-GGGTTGGGCGGGATGGGTTT-3 ', 5'-GGGTTAGGGTTAGGGTTAGGG-3', 5'-GGGTTGGGCGGGATGGGCC-3 'or 5'-TTTGGGTAGGGCGGGTTGGG-3'. delete delete delete delete delete delete delete delete A complex conjugate solution combining a DNA-based enzyme and an aptamer capable of selectively binding to a target bacterium to magnetic nanoparticles having an enzyme-like action;
A substrate causing the colorimetric reaction by the enzymatic action of the DNA-based enzyme and the magnetic nanoparticle having the enzyme-like action;
Wherein the composite conjugate solution reacted with the test sample and the substrate are provided on a surface and a colorimetric ring is formed when the target sample is present in the test sample,
Wherein the conjugate solution comprises a swap section for swapping and sampling the surface of the test sample, the conjugate solution is contained and the swap section can be inserted so that the test sample sampled by the swap section reacts with the conjugate solution In the reactor,
One end of the reactor is sealed with the swap portion inserted
The tip is in the form of a dropper provided with a lid,
Based colorimetric sensor kit for rapid visual visualization of structured pathogenic bacteria so that the lid is opened to provide the reacted solution in the reactor to the radial paper chromatography. 16. The method of claim 15,
Based colorimetric sensor kit wherein the ratio of the DNA-based enzyme: aptamer is 20: 1 to 30: 1. 16. The method of claim 15,
The magnetic nanoparticles are magnetic nanoparticles exhibiting peroxidase-like action,
Wherein the substrate comprises a substance that is discolored while providing a hydrogen donor that is necessary for the reduction of hydrogen peroxide or organic peroxide and the hydrogen peroxide or organic peroxide. 18. The method of claim 17,
The magnetic nanoparticles exhibiting the peroxidase-like action are Fe ₃ O ₄ ,
The material which is discolored while providing the hydrogen donor is 3,3 ', 5,5'-tetramethylbenzidine, luminol, 2,2'-azino-bis (3-ethylbenzothiazoline- Ammonium chloride, ammonium salt, 3,3'-diaminobenzidine or o-phenylenediamine dihydrochloride. 16. The method of claim 15,
The aptamer is 5'-biotin-CCG GAC GCT TAT GCC TTG CCA TCT ACA GAG CAG GTG TGA CGG-3 ', the target bacteria is E. coli O157: H7,
Wherein the aptamer is 5'-GCAATGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTGGTCATC CCACAGCTACGTCAATACGTCAAAAGTGCACGCTCTTTGCTAA-3 ', wherein the target bacteria is Staphylococcus aureus. 16. The method of claim 15,
Based colorimetric sensor kit wherein the DNA-based enzyme is 5'-GGGTTGGGCGGGATGGGTTT-3 ', 5'-GGGTTAGGGTTAGGGTTAGGG-3', 5'-GGGTTGGGCGGGATGGGCC-3 'or 5'-TTTGGGTAGGGCGGGTTGGG-3'.

Images