KR101948431B1 - Microalgae cell lysis composition and Method for detecting microalgae - Google Patents

Microalgae cell lysis composition and Method for detecting microalgae Download PDF

Info

Publication number
KR101948431B1
KR101948431B1 KR1020170101170A KR20170101170A KR101948431B1 KR 101948431 B1 KR101948431 B1 KR 101948431B1 KR 1020170101170 A KR1020170101170 A KR 1020170101170A KR 20170101170 A KR20170101170 A KR 20170101170A KR 101948431 B1 KR101948431 B1 KR 101948431B1
Authority
KR
South Korea
Prior art keywords
microalgae
composition
sodium
cell lysis
sds
Prior art date
Application number
KR1020170101170A
Other languages
Korean (ko)
Inventor
안지영
안근아
김양훈
Original Assignee
충북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 충북대학교 산학협력단 filed Critical 충북대학교 산학협력단
Priority to KR1020170101170A priority Critical patent/KR101948431B1/en
Application granted granted Critical
Publication of KR101948431B1 publication Critical patent/KR101948431B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/06—Lysis of microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
    • C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N1/00—Sampling; Preparing specimens for investigation
    • G01N1/28—Preparing specimens for investigation including physical details of (bio-)chemical methods covered elsewhere, e.g. G01N33/50, C12Q
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/405—Assays involving biological materials from specific organisms or of a specific nature from algae

Abstract

The present invention relates to a composition for microalgae cell lysis and a method for detecting microalgae, and more specifically, to a composition for lysis capable of extracting DNA and protein by lysing the microalgae and a method for detecting the microalgae using the same. When the composition for lysis of the present invention is used, the protein or nucleic acid can be extracted by lysing the cells, which then can be effectively used for detecting the microalgae. The composition for microalgae cell lysis comprises Tris-HCl, sodium dodecyl sulfate, ethylenediaminetetraacetic acid, sodium chloride, sodium pyrophosphate, beta-glycerophosphate, sodium orthovanadate, and leupeptin.

Description

미세조류 세포 용해용 조성물 및 미세조류 검출 방법{Microalgae cell lysis composition and Method for detecting microalgae}Technical Field [0001] The present invention relates to a microalgae cell lysis composition and a method for detecting microalgae,

본 발명은 미세조류 세포 용해용 조성물 및 미세조류 검출 방법에 관한 것으로, 미세조류를 용해시킴으로써 DNA 및 단백질을 추출할 수 있는 세포 용해용 조성물 및 이를 이용한 미세조류 검출 방법에 관한 것이다.The present invention relates to a composition for dissolving microalgae and a method for detecting microalgae, and more particularly, to a composition for cell lysis that can extract DNA and proteins by dissolving microalgae and a method for detecting microalgae using the same.

선박평형수(ballast water)는 선박 내에 저장되는 해수를 의미하며, 선박으로부터 화물을 반출할 시 부력에 의해 선박의 무게중심이 높아짐에 따라 선박 안정성이 낮아지는 것을 방지하기 위하여 화물 반출량에 비례하여 저장된다. 선박의 안전하고 효율적인 운항을 위해 저장되는 선박평형수에 의해 매년 약 50억 톤 이상의 해수가 국제적으로 이동되고 있고, 이로 인해 약 7,000 여종의 해양생물이 운반되고 있는 것으로 알려져 있다.Ballast water means seawater stored in a ship. In order to prevent ship stability from becoming low as the center of gravity of the ship becomes higher due to buoyancy when the cargo is taken out of the ship, the ballast water is stored do. More than 5 billion tons of seawater are being transported internationally each year by the ballast water stored for safe and efficient operation of the ship, and it is known that about 7,000 kinds of marine life are being transported.

이 중 미세조류는 선박평형수 내의 생물 중 가장 문제시 되고 있는데, 이들은 열악한 생존 조건에서도 휴면포자 상태로 장기간 생존하므로 좋은 환경을 만날 경우 다시 발아해서 문제를 일으킬 가능성이 크기 때문이다.Among them, microalgae are the most problematic organisms in ship equilibrium. They survive for long periods in dormant spore condition even in poor survival condition, so they are likely to cause germination again if they encounter good environment.

선박평형수에 의해 이동될 수 있는 미세조류 중 적조를 일으켜 우리나라 연안 생태계를 위협하고 독성을 함유하는 와편모조류를 대표적인 예로 들 수 있으며, 헤테로캅사 트리퀘트라(heterocapsa triquetra), 아카시오 상기니아(Akashiwo sanguinea), 프로로센트럼 미칸스(Prorocentrum micans), 페리디늄 속(Peridinium sp.) 등이 가장 대표적이다. 이들 와편모조류는 담수 및 해수에서 적조를 형성하여 어패류를 폐사시키거나 독소를 생산하며, 급격한 증식으로 인해 다양한 환경, 생태, 경제적 문제를 일으키고 있다.Among the microalgae that can be transported by ship equilibrium, there are red sea breams that threaten the coastal ecosystem of Korea and contain toxic substances. Typical examples are Heterocapsa tincture triquetra), the Casio ah California (Akashiwo sanguinea), pro Centrum mikan's (Prorocentrum micans , and peridinium sp. are the most representative. These bivalve algae form red tides in freshwater and seawater, causing the loss of fish and shellfish, production of toxins, and rapid multiplication, resulting in various environmental, ecological and economic problems.

따라서, 선박평형수를 통한 해양생물 개체의 이동으로 인해 해양 생태계를 교란시키는 원인이 되고 있는 미세조류들의 제거가 필요하며, 이후 처리수 내의 미세조류 생존 여부에 대한 확인이 필요하다. 이를 특이적으로 검출하기 위해서는 일차적으로 이들을 분해할 수 있는 세포 용해용 조성물이 필요한 상황이다.Therefore, it is necessary to remove the microalgae that cause disturbance of the marine ecosystem due to the movement of marine organisms through the ballast water, and it is necessary to confirm the survival of microalgae in the treated water. In order to specifically detect it, there is a need for a composition for cell lysis capable of primarily degrading these.

종래의 세포 용해는 기본적으로 물리적 파쇄(sonication, Tissue Lyzer)와 같은 방법이 활용되었고, 용해 여부를 확인하기 위한 방법으로 열처리 후 샘플의 유무를 확인하는 방법이 사용되었으나, 이러한 방법의 수행을 위해서는 고온처리가 가능한 고가의 장비가 필요하였다.Conventional cell dissolution basically used a method such as sonication (Tissue Lyzer), and a method of confirming whether or not a sample is present after heat treatment is used as a method for confirming dissolution. However, in order to perform such a method, Expensive equipment that can be processed was needed.

용해 여부를 현장에서 즉시 확인하기 위해서는 장비 없이도 현장에서 바로 용해가 진행되고 수 분 내지 수 시간 내로 확인이 가능한 시스템이 필요하다. 뿐만 아니라, 시판되고 있는 화학적 방법을 이용하는 세포 용해 버퍼의 거의 대부분은 박테리아, 효모, 식물 또는 동물 세포와 같이 다양한 세포들을 분해하기 위한 라이시스 버퍼로서, 미세조류를 대상으로 하는 버퍼는 찾아보기 어렵다.In order to confirm the dissolution status immediately on site, it is necessary to have a system capable of confirming the dissolution within a few minutes to several hours without any equipments. In addition, most of the cell lysis buffers using commercially available chemical methods are lysis buffers for decomposing various cells such as bacteria, yeast, plant or animal cells, and it is difficult to find a buffer for microalgae.

본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

이에 본 발명자들은 미세조류의 검출을 위해, 미세조류를 용해시킬 수 있는 세포 용해용 조성물을 개발하고자 예의 연구 노력하였다. 그 결과, 소듐 도데실 설페이트 기반의 세포 용해용 조성물이 미세조류를 신속하게 용해시킨다는 점을 규명함으로써, 본 발명을 완성하였다. Accordingly, the present inventors have made extensive efforts to develop a cytolytic composition capable of dissolving microalgae for the detection of microalgae. As a result, the present inventors have completed the present invention by confirming that sodium dodecyl sulfate-based cell dissolving composition rapidly dissolves microalgae.

따라서 본 발명의 목적은, 미세조류에 대한 세포 용해용 조성물을 제공하는 것이다.Accordingly, an object of the present invention is to provide a composition for cell lysis against microalgae.

본 발명의 다른 목적은, 상기 세포 용해용 조성물을 이용하여 미세조류를 검출하는 방법을 제공하는 것이다.It is another object of the present invention to provide a method for detecting microalgae using the composition for cell lysis.

본 발명은 미세조류를 신속하게 용해시킴으로써 단백질 및 DNA를 효과적으로 추출할 수 있는, 소듐 도데실 설페이트(sodium dodecyl sulfate; 이하, SDS) 기반의 세포 용해용 조성물 및 이를 이용한 미세조류의 검출 방법을 포함한다.The present invention includes a composition for cell dissolution based on sodium dodecyl sulfate (hereinafter, referred to as SDS) capable of efficiently extracting proteins and DNA by rapidly dissolving microalgae, and a method for detecting microalgae using the same .

이하, 본 발명을 더욱 자세히 설명하고자 한다.Hereinafter, the present invention will be described in more detail.

본 발명의 일 양태는 Tris-HCl 10 내지 200 mM; 소듐 도데실 설페이트 0.1 내지 5.0(v/v)%; 에틸렌디아민사아세트산(ethylenediaminetetraacetic acid; 이하, EDTA) 0.1 내지 10.0 mM; 염화나트륨(sodium chloride) 100 내지 200 mM; 파이로인산나트륨(sodium pyrophosphate) 1.0 내지 5.0 mM; 베타-글리세로포스페이트(beta-glycerophosphate) 0.1 내지 10.0 mM; 바나듐산나트륨(sodium orthovanadate) 0.1 내지 10.0 mM; 및 류펩틴(leupeptin) 0.1 내지 10.0 ug/ml;을 포함하는 미세조류 세포 용해용 조성물에 관한 것이다.One aspect of the present invention is a method of treating a patient suffering from a condition selected from the group consisting of: Tris-HCl 10-200 mM; 0.1 to 5.0 (v / v)% of sodium dodecyl sulfate; 0.1 to 10.0 mM ethylenediaminetetraacetic acid (EDTA); 100 to 200 mM sodium chloride; Sodium pyrophosphate 1.0 to 5.0 mM; 0.1 to 10.0 mM beta-glycerophosphate; 0.1 to 10.0 mM sodium orthovanadate; And 0.1 to 10.0 ug / ml of leupeptin. The present invention also relates to a composition for dissolving microalgae cells.

상기 SDS는 0.1 내지 5.0(v/v)%, 0.2 내지 5.0(v/v)%, 0.5 내지 5.0(v/v)%, 1.0 내지 5.0(v/v)%, 2.0 내지 5.0(v/v)%, 3.0 내지 5.0(v/v)%일 수 있으며, 예를 들어, 3.0 내지 5.0(v/v)%일 수 있으나, 이에 한정되는 것은 아니다. 0.1(v/v)% 미만으로 포함하는 경우 세포의 용해가 일어나지 않고, 5.0(v/v)% 초과하여 포함하는 경우 더 이상의 상승 효과가 나타나지 않았다.The SDS may be used in an amount of 0.1 to 5.0 (v / v)%, 0.2 to 5.0 (v / v)%, 0.5 to 5.0 (v / v)%, 1.0 to 5.0 ), 3.0 to 5.0 (v / v)%, for example, 3.0 to 5.0 (v / v)%. When the cell is contained in an amount less than 0.1 (v / v)%, dissolution of the cells does not occur, and when it contains more than 5.0 (v / v)%, no further synergistic effect is exhibited.

상기 미세조류는 와편모조류(dinophyta)일 수 있으나, 이에 한정되는 것은 아니다.The microalgae may be, but are not limited to, dinophyta.

상기 와편모조류는 헤테로캅사 트리퀘트라(heterocapsa triquetra), 아카시오 상기니아(Akashiwo sanguinea), 프로로센트럼 미칸스(Prorocentrum micans) 또는 페리디늄 속(Peridinium sp.), 예를 들어, 헤테로캅사 트리퀘트라일 수 있으나, 이에 한정되는 것은 아니다.The parasitoidal avian influenzae species include, but are not limited to, triquetra , Akashiwo sanguinea , Prorocentrum micans , or Peridinium sp., for example, Heterocapsa tincture, but is not limited thereto.

상기 미세조류 용해용 조성물은, Tris-HCl 100 mM; 소듐 도데실 설페이트 1.0(v/v)%; EDTA 1.0 mM; 염화나트륨 150 mM; 파이로인산나트륨 2.5 mM; 베타-글리세로포스페이트 1.0 mM; 바나듐산나트륨 1.0 mM; 및 류펩틴 1.0 ug/ml을 포함하는 것인, 미세조류 세포 용해용 조성물일 수 있다.The composition for dissolving microalgae contained 100 mM Tris-HCl; 1.0 (v / v)% sodium dodecyl sulfate; EDTA 1.0 mM; 150 mM sodium chloride; Sodium pyrophosphate 2.5 mM; 1.0 mM beta-glycerophosphate; Sodium vanadate 1.0 mM; And 1.0 [mu] g / ml of leupeptin.

본 발명의 일 양태는 다음의 단계를 포함하는 미세조류 검출 방법에 관한 것이다:One aspect of the invention relates to a microalgae detection method comprising the steps of:

(a) Tris-HCl 10 내지 200 mM, 소듐 도데실 설페이트(sodium dodecyl sulfate, 이하 SDS) 0.1 내지 5.0(v/v)%, EDTA 0.1 내지 10.0 mM, 염화나트륨(sodium chloride) 100 내지 200 mM, 파이로인산나트륨(sodium pyrophosphate) 1.0 내지 5.0 mM, 베타-글리세로포스페이트(beta-glycerophosphate) 0.1 내지 10.0 mM, 바나듐산나트륨(sodium orthovanadate) 0.1 내지 10.0 mM 및 류펩틴(leupeptin) 0.1 내지 10.0 ug/ml을 포함하는 미세조류 세포 용해용 조성물을 대상 시료와 반응시키는 반응 단계; 및(a) 10 to 200 mM Tris-HCl, 0.1 to 5.0 (v / v)% of sodium dodecyl sulfate (SDS), 0.1 to 10.0 mM of EDTA, 100 to 200 mM of sodium chloride, Sodium pyrophosphate 1.0 to 5.0 mM, beta-glycerophosphate 0.1 to 10.0 mM sodium orthovanadate 0.1 to 10.0 mM and leupeptin 0.1 to 10.0 ug / ml A reaction step of reacting a composition for dissolving microalgae cells with a target sample; And

(b) 단백질 또는 핵산을 추출하는 추출 단계.(b) an extraction step for extracting the protein or nucleic acid.

상기 핵산은 DNA 또는 RNA, 예를 들어, DNA일 수 있으나, 이에 한정되는 것은 아니다.The nucleic acid may be DNA or RNA, e.g., DNA, but is not limited thereto.

상기 미세조류는 와편모조류(dinophyta)일 수 있으나, 이에 한정되는 것은 아니다.The microalgae may be, but are not limited to, dinophyta.

상기 와편모조류는 헤테로캅사 트리퀘트라(heterocapsa triquetra), 아카시오 상기니아(Akashiwo sanguinea), 프로로센트럼 미칸스(Prorocentrum micans) 또는 페리디늄 속(Peridinium sp.), 예를 들어, 헤테로캅사 트리퀘트라일 수 있으나, 이에 한정되는 것은 아니다.The parasitoidal avian influenzae species include, but are not limited to, triquetra , Akashiwo sanguinea , Prorocentrum micans , or Peridinium sp., for example, Heterocapsa tincture, but is not limited thereto.

상기 SDS는 0.1 내지 5.0(v/v)%, 0.2 내지 5.0(v/v)%, 0.5 내지 5.0(v/v)%, 1.0 내지 5.0(v/v)%, 2.0 내지 5.0(v/v)%, 3.0 내지 5.0(v/v)%일 수 있으며, 예를 들어, 3.0 내지 5.0(v/v)%일 수 있으나, 이에 한정되는 것은 아니다. 0.1(v/v)% 미만으로 포함하는 경우 세포의 용해가 일어나지 않고, 5.0(v/v)% 초과하여 포함하는 경우 더 이상의 상승 효과가 나타나지 않았다.The SDS may be used in an amount of 0.1 to 5.0 (v / v)%, 0.2 to 5.0 (v / v)%, 0.5 to 5.0 (v / v)%, 1.0 to 5.0 ), 3.0 to 5.0 (v / v)%, for example, 3.0 to 5.0 (v / v)%. When the cell is contained in an amount less than 0.1 (v / v)%, dissolution of the cells does not occur, and when it contains more than 5.0 (v / v)%, no further synergistic effect is exhibited.

상기 반응 단계는 0 내지 40, 0 내지 35, 0 내지 30, 10 내지 40, 10 내지 35, 10 내지 30, 20 내지 40, 20 내지 35, 20 내지 30, 22 내지 27의 온도 조건 하에서 수행될 수 있고, 예를 들어, 22 내지 27의 온도 조건 하에서 수행될 수 있으나, 이에 한정되는 것은 아니다. 저온 환경에서 반응을 수행할 경우 세포 용해용 조성물에서 결정이 발생하여 세포 용해의 진행을 방해할 수 있으며, 40 이상의 온도 조건으로 인한 상승 효과가 나타나지 않았다.The reaction step may be carried out under temperature conditions of 0 to 40, 0 to 35, 0 to 30, 10 to 40, 10 to 35, 10 to 30, 20 to 40, 20 to 35, 20 to 30, 22 to 27 And may be performed under a temperature condition of, for example, 22 to 27, but is not limited thereto. When the reaction is performed in a low temperature environment, crystals are formed in the composition for cell lysis, which may interfere with the progress of cell lysis, and the synergistic effect due to the temperature condition of 40 or more is not exhibited.

상기 추출 단계는 반응 단계 이후 20분 이내, 18분 이내, 15분 이내, 12분 이내, 예를 들어, 10분 이내에 수행될 수 있으나, 이에 한정되는 것은 아니다.The extraction step may be performed within 20 minutes, 18 minutes, 15 minutes, 12 minutes, such as 10 minutes after the reaction step, but is not limited thereto.

상기 추출 단계는 단백질을 추출하기 위해 단백질-은 염색(Protein-Silver Staining), 쿠마시 블루(Commasie bule) 염색 또는 BCA 단백질 정량을 수행하는 단계를 더 포함할 수 있고, 예를 들어, 단백질-은 염색을 수행하는 단계를 더 포함할 수 있으나, 이에 한정되는 것은 아니다.The extraction step may further include performing Protein-Silver Staining, Commasie bule staining, or BCA protein quantitation to extract the protein, for example, protein-silver staining, The method may further include performing dyeing, but is not limited thereto.

상기 추출 단계는 핵산을 추출하기 위해 PCI(phenol:chloroform:isoamylalcohol = 25:24:1) 에탄올 침전법을 수행하여 시료로부터 DNA를 분리하는 단계를 더 포함할 수 있으나 이에 한정되는 것은 아니다.The extracting step may further include a step of separating DNA from the sample by performing PCI (phenol: chloroform: isoamylalcohol = 25: 24: 1) ethanol precipitation to extract the nucleic acid, but the present invention is not limited thereto.

상기 핵산을 추출하는 추출 단계는 시료로부터 분리한 DNA를 증폭시켜 확인하기 위해 PCR을 수행하는 단계를 포함할 수 있으나 이에 한정되는 것은 아니다.The extraction step of extracting the nucleic acid may include a step of performing PCR to amplify the DNA isolated from the sample and to confirm it, but the present invention is not limited thereto.

본 발명은 미세조류를 용해시키는 세포 용해용 조성물 및 이를 이용한 미세조류 검출 방법에 관한 것으로서,The present invention relates to a composition for dissolving microalgae and a method for detecting microalgae using the composition,

상기 세포 용해용 조성물을 이용함으로써 세포를 용해시켜 단백질 또는 핵산을 추출할 수 있으므로 이를 효과적으로 미세조류의 검출에 이용할 수 있고, 상기 세포 용해용 조성물은 특히 와편모조류에 대하여 효과적으로 사용할 수 있으므로, 담수 및 해수에서 적조를 형성하여 어패류를 폐사시키거나 독소를 생산하며, 증식 속도가 빠른 와편모조류의 검출에 이용할 수 있다.Since the composition for cell lysis can dissolve cells to extract proteins or nucleic acids, it can be effectively used for the detection of microalgae, and the composition for cell lysis can be effectively used especially for phytophagous birds. Therefore, It can be used to detect fish and shellfish that produce red tides in seawater, to produce toxins, and to detect phytoplankton which has a rapid growth rate.

도 1은 본 발명의 일 실시예에 따른 세포 용해용 조성물의 계면활성제 종류 및 함량 변화에 따른 세포 용해 효과를 단백질 추출 정도로 비교한 단백질-은 염색(silver staining) 결과이다.
도 2는 본 발명의 일 실시예에 따른 세포 용해용 조성물의 화학적 파쇄능을 물리적 파쇄능을 기준으로 하여 상대적으로 비교한 세포 용해 결과 그래프이다.
도 3은 본 발명의 일 실시예에 따른 세포 용해용 조성물을 이용하여 추출한 단백질의 ATPase 활성 분석 결과 그래프이다.
도 4는 헤테로캅사 트리퀘트라(heterocapsa triquetra)의 ITS(Gen Bank No. AB084101.1) 영역 부위를 나타내는 모식도이다.
도 5는 본 발명의 일 실시예에 따른 세포 용해용 조성물의 계면활성제 종류 및 함량 변화에 따른 세포 용해 효과를 DNA 추출 정도로 비교한 아가로즈 겔 전기영동 결과이다(1열: 계면활성제 불포함; 2 내지 6열: CHAPS 각 0.1, 0.5, 1.0, 3.0 및 5.0% 포함; 7 내지 11열: SDS 각 0.1, 0.5, 1.0, 3.0 및 5.0% 포함; 12 내지 16열: Triton X-100 각 0.1, 0.5, 1.0, 3.0 및 5.0% 포함; 17열: CTAB DNA 추출방법; 18열: TE 보일링 방법).
도 6은 본 발명의 일 실시예에 따라 헤테로캅사 트리퀘트라의 세포 용해 이후 ITS 영역 부위의 검출을 확인한 결과이다.FIG. 1 is a result of protein-silver staining comparing the cell lysis effect according to the kind and content of surfactant in the cell lysis composition according to an embodiment of the present invention.
FIG. 2 is a graph showing the cell lysis results obtained by comparing the chemical crushing ability of the composition for cell lysis according to an embodiment of the present invention with reference to the physical crushability.
FIG. 3 is a graph showing the results of ATPase activity analysis of proteins extracted using the composition for cell lysis according to an embodiment of the present invention.
Figure 4 is a graph of (Genbank No. AB084101.1) region of the triquetra .
5 is a graph showing the results of agarose gel electrophoresis comparing the cell lysis effect with the degree of DNA extraction according to the kind and content of the surfactant in the composition for cell lysis according to an embodiment of the present invention (column 1: surfactant-free; 6 columns: CHAPS angles 0.1, 0.5, 1.0, 3.0 and 5.0% inclusive 7 to 11 columns SDS angles 0.1, 0.5, 1.0, 3.0 and 5.0% inclusive 12 to 16 columns Triton X- 1.0, 3.0, and 5.0%; column 17: CTAB DNA extraction method; column 18: TE boiling method).
FIG. 6 is a result of confirming the detection of the ITS region after cell lysis of Hercapacetriquute according to an embodiment of the present invention.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

실시예: 세포 용해용 조성물의 제조 및 이를 이용한 세포 용해Example: Preparation of a composition for cell lysis and cell lysis using the same

계면활성제의 종류 및 농도를 달리하여 세포 용해용 조성물을 제조한 뒤, 이를 이용하여 헤테로캅사 트리퀘트라와 반응시켰다.A composition for cell lysis was prepared by varying the kind and concentration of the surfactant, and then reacted with the Hercapacastriquute using the same.

구체적으로, 100 mM 농도의 Tris-HCl(pH 7.5), 계면활성제(detergent)로는 0.0, 0.1, 0.5, 1.0, 3.0 및 5.0(v/v)% 농도의 소듐 도데실 설페이트(sodium dodecyl sulfate; 이하, SDS), 단백질분해효소 억제제(protease inhibitor)는 1.0 mM 농도의 에틸렌디아민사아세트산(ethylenediaminetetraacetic acid; 이하, EDTA), 150 mM 농도의 염화나트륨(sodium chloride, 이하 NaCl), 2.5 mM 농도의 파이로인산나트륨(sodium pyrophosphate), 1.0 mM 농도의 베타-글리세로포스페이트(beta-glycerophosphate), 1.0 mM 농도의 바나듐산나트륨(sodium orthovanadate) 및 1.0 ug/ml 농도의 류펩틴(leupeptin)을 포함하는 세포 용해용 조성물을 제조하였다.Specifically, sodium dodecyl sulfate (hereinafter referred to as " sodium dodecyl sulfate ") at a concentration of 100 mM Tris-HCl (pH 7.5) and a surfactant of 0.0, 0.1, 0.5, 1.0, 3.0 and 5.0 , SDS) and a protease inhibitor were prepared by adding ethylenediaminetetraacetic acid (EDTA) at a concentration of 1.0 mM, sodium chloride (NaCl) at a concentration of 150 mM, pyrophosphoric acid Sodium pyrophosphate, beta-glycerophosphate at a concentration of 1.0 mM, sodium orthovanadate at a concentration of 1.0 mM, and leupeptin at a concentration of 1.0 ug / ml. A composition was prepared.

또한, 상기와 동일한 조성에서, SDS 대신 Triton X-100 및 CHAPS를 동일 농도로 포함하는 세포 용해용 조성물을 추가적으로 준비하였다.In addition, a composition for cell lysis containing the same concentration of Triton X-100 and CHAPS in place of SDS was further prepared.

상기 세포 용해용 조성물의 효과를 확인하기 위해, 미세조류를 1.0 X 105 cells/ml 기준으로 확보한 후 이와 동일 부피의 세포 용해용 조성물을 넣어 10분 동안 상온(25℃)에서 반응시켰다.In order to confirm the effect of the composition for cell lysis, microalgae were maintained at a concentration of 1.0 × 10 5 cells / ml, and the same volume of the composition for cell lysis was added thereto, followed by reaction at room temperature (25 ° C.) for 10 minutes.

이후 단백질 및 DNA 추출을 통해 결과를 확인하기 위하여, 13,000 rpm, 4 조건에서 5분 동안 원심분리를 진행하였고, 상등액만을 이용하여 세포 용해 효과를 확인하고자 하였다.After centrifugation at 13,000 rpm for 4 min, the supernatant was used to confirm the cell lysis effect.

시험예 1: 세포 용해를 통한 단백질의 검출능 확인Test Example 1: Confirmation of protein detection ability through cell lysis

1-1. 단백질 검출이 가능한 계면활성제의 종류 및 함량의 확인1-1. Identification of the type and content of surfactant capable of protein detection

상기 실시예에서 이용한 세포 용해용 조성물의 세포 용해 효과를 비교하기 위한 대조군으로서 조직파쇄기(Tissue Lyzer, Qiagen)로 5분 동안 30 kHz의 조건으로 파쇄한 시료인 C1, RIPA 버퍼(Thermo Scientific)를 첨가하고 히팅블럭(Heating block)을 이용하여 100에서 5분 동안 가열한 후 5분 동안 아이스 위에서 안정화시킨 시료인 C2를 준비하였다.As a control for comparing the cytolytic effect of the composition for cell lysis used in the above examples, C1, RIPA buffer (Thermo Scientific), which is a sample crushed at 30 kHz for 5 minutes with a tissue crusher (Tissue Lyzer, Qiagen) And heated at 100 for 5 minutes using a heating block, and a sample C2 stabilized on ice for 5 minutes was prepared.

세포 용해 결과는 10(v/v)% SDS-PAGE 겔을 이용하여 나타냈으며, 단백질-은 염색 키트(EzWay Protein-Silver Staining Kit, K14040D, gomabiotech)를 사용하여 은 염색(silver staining)으로서 결과를 확인하였다. 염색 과정은 상기 키트의 프로토콜을 기반으로 상온 조건 하에서 수행하였다.Cell lysis results were expressed using 10 (v / v)% SDS-PAGE gel and silver staining was performed using protein-silver staining kit (EzWay Protein-Silver Staining Kit, K14040D, gomabiotech) Respectively. The staining procedure was performed under room temperature conditions based on the protocol of the kit.

도 1에서 확인할 수 있듯이, Triton X-100을 이용한 세포 용해용 조성물에 의해서는 헤테로캅사 트리퀘트라로부터 단백질이 검출되지 않았으며, 세포 용해용 조성물 중 단백질을 검출할 수 있는 SDS의 최저 함량은 0.1%, CHAPS의 최저 함량은 1.0%인 것으로, 둘 중 SDS가 더 우수한 것으로 확인되었다.As can be seen from FIG. 1, no protein was detected from Hectaxacetaquitra by the composition for cell lysis using Triton X-100, and the minimum content of SDS capable of detecting the protein in the cytolytic composition was 0.1 %, The lowest content of CHAPS was 1.0%.

1-2. 물리적 파쇄 방법과의 파쇄능 비교1-2. Comparison of fracture ability with physical fracturing method

상기 시험예 1-1의 결과에 근거하여, C1의 물리적 파쇄 방법(Tissue Lyzer)에 의한 물리적 파쇄능을 100%로 설정하였을 때, 본 발명의 세포 용해용 조성물을 이용한 화학적 파쇄능을 1.0(v/v)% 농도의 SDS 또는 CHAPS를 포함하는 기준으로 상대적으로 비교하여 수치화하였다. C2는 "Chemical Boiling"으로 표시하였다. "Non detergent"는 상기 실시예 중 계면활성제를 포함하지 않은 경우에 해당한다.Based on the results of Test Example 1-1, when the physical fracturing ability of C1 by the physical disintegration method (Tissue Lyzer) was set to 100%, the chemical disruption ability using the cell dissolution composition of the present invention was 1.0 (v / v)% concentration of SDS or CHAPS. C2 is labeled "Chemical Boiling ". The term "non detergent " corresponds to the case where the surfactant is not included in the above embodiments.

도 2에서 확인할 수 있듯이, 1.0(v/v)% 농도의 SDS를 포함하는 시료의 경우 92.67%로 물리적 파쇄 방법과 약 7% 정도의 파쇄능 차이를 보여 화학적 파쇄능으로서 가장 높은 값을 기록한 것을 확인할 수 있으며, 같은 농도의 CHAPS의 경우 파쇄능이 63.96%임을 확인할 수 있다. RIPA 버퍼와 같이 시판되는 세포 용해용 버퍼의 경우 파쇄능이 28.60%로 상대적으로 낮은 효율을 보였고, 계면활성제를 포함하지 않은 경우에 있어서는 유의미한 파쇄능 수치가 확인되지 않았다.As can be seen from FIG. 2, the sample containing SDS at a concentration of 1.0 (v / v)% showed 92.67%, which is the highest value as the chemical cracking ability It can be confirmed that the CHAPS of the same concentration has a fracture capability of 63.96%. The commercially available buffer for cell lysis, such as RIPA buffer, showed a relatively low efficiency of 28.60% in the crushing capacity and no significant crushing capacity in the case of not containing the surfactant.

1-3. ATPase 활성 분석을 통한 추출 단백질의 검증1-3. Verification of extracted protein by ATPase activity analysis

상기 실시예에 따른 세포 용해용 조성물을 이용하여 미세조류로부터 추출한 단백질을 검증하기 위한 ATPase 활성(activity)을 분석하였다. 결과를 검증하기 위하여 ATPase 분석 키트(High Throughput Colorimetric ATPase Assays, inc. PiColorLock, innova bioscience)를 사용하였으며, 제품의 설명서를 기준으로 관련 프로토콜에 따라 수행하였다.The activity of ATPase for the analysis of proteins extracted from microalgae was analyzed using the composition for cell lysis according to the above examples. To verify the results, ATPase assay kit (High Throughput Colorimetric ATPase Assays, inc. PiColorLock, innova bioscience) was used and performed according to the relevant protocol based on the product description.

도 3에서 확인할 수 있듯이, ATPase 활성 분석 결과, SDS를 1.0(v/v)% 이상으로 포함하는 세포 용해용 조성물을 이용하여 추출한 단백질에서 ATPase 활성이 나타남을 확인할 수 있다.As shown in FIG. 3, ATPase activity analysis showed that ATPase activity was observed in proteins extracted using a composition for cell lysis containing SDS at 1.0 (v / v)% or more.

시험예 2: 세포 용해를 통한 DNA의 검출능 확인Test Example 2: Detection ability of DNA by cell lysis

2-1. DNA 검출이 가능한 계면활성제의 종류 및 함량의 확인2-1. Identification of the types and content of surfactants capable of DNA detection

상기 실시예에서 이용한 세포 용해용 조성물의 세포 용해 효과를 비교하기 위한 대조군으로서 통상적으로 이용되는 CTAB DNA 추출 방법(도 5의 17열) 및 TE 보일링(Boiling) 방법(도 5의 18열)을 수행하여 시료를 준비하였다.The CTAB DNA extraction method (column 17 in FIG. 5) and the TE boiling method (column 18 in FIG. 5), which are commonly used as a control group for comparing the cytolytic effect of the composition for cell lysis used in the above examples, To prepare a sample.

상기 실시예에서의 원심분리 이후 상등액을 이용하여 PCI 에탄올 침전법을 적용하였다. PCI 에탄올 침전법의 수행을 위해 100 ul의 상등액에 동량의 PCI(Biosesang)를 투입한 후 13,000 rpm, 10분, 4℃ 조건으로 원심분리를 진행하였다. 이 중 상등액만 회수하여 3배 부피에 해당하는 100(v/v)% 에탄올을 첨가한 후, 저온 조건에서의 효과적인 DNA의 농축을 위해 1시간 동안 -20℃ 냉동고에서 반응시켰다. 이후 13,000 rpm, 10분, 4℃ 조건으로 원심분리를 수행하여 DNA 펠릿(pellet)을 확보한 후 이를 완전히 건조시켜 여분의 에탄올을 제거하기 위해서 50℃ 히팅블록에서 15분 동안 건조시켰고, 50 ul 증류수(D.W)로 DNA 펠릿을 녹였다.After centrifugation in the above example, the PCI ethanol precipitation method was applied using the supernatant. For the PCI ethanol precipitation method, the same amount of PCI (Biosesang) was added to 100 μl of the supernatant, followed by centrifugation at 13,000 rpm, 10 minutes, and 4 ° C. 100% (v / v) ethanol was added, which corresponds to a volume of 3 times the volume of the supernatant, and then reacted in a -20 ° C freezer for 1 hour for efficient DNA concentration at low temperature. Thereafter, centrifugation was carried out at 13,000 rpm, 10 minutes and 4 ° C to obtain a DNA pellet. The DNA pellet was completely dried and dried in a heating block at 50 ° C for 15 minutes in order to remove excess ethanol. (DW) to dissolve the DNA pellet.

증폭된 산물을 확인하기 위하여 PCR을 수행하였으며, 도 4와 같이 헤테로캅사 트리퀘트라의 ITS(Gen Bank No. AB084101.1) 영역 부위를 이용해 프라이머 쌍을 제작한 후 PCR을 수행하였다. 상기 ITS 영역 부위는 짧은 바코딩 영역을 가지고 있고, 진핵생물을 확인할 수 있는 특이적인 서열을 포함하고 있기 때문에, 증폭 및 판독이 용이하다는 점에서 선택되었다.PCR was carried out to confirm the amplified products. PCR was carried out after primer pairs were constructed using the region of ITS (Genbank No. AB084101.1) of Heterocapsa tincture as shown in Fig. The region of the ITS region has a short bar coding region and is selected in that it is easy to amplify and read because it contains a specific sequence that can identify eukaryotes.

프라이머 쌍은 F: GCACGCATCCAAACTGC(서열목록 제1서열), R: GAAGTCACAAGTGACTATGGAAG(서열목록 제2서열)에 해당하며, PCR 조건은 변성 전(pre-denaturation): 95℃, 10분; 변성(denaturation): 95℃, 30초; 어닐링(annealing): 55℃, 30초; 신장(extension): 72℃, 2분; 신장 후(post-extension): 72℃, 10분으로 진행하였다. PCR 믹스(mix)는 PCR 프리믹스(premix, solgent)를 이용하여 수행하였다.The primer pair corresponds to F: GCACGCATCCAAACTGC (SEQ ID No. 1), R: GAAGTCACAAGTGACTATGGAAG (SEQ ID No. 2), PCR conditions include pre-denaturation at 95 ° C for 10 min; Denaturation: 95 캜, 30 sec; Annealing: 55 캜, 30 seconds; Extension: 72 캜, 2 min; Post-extension: 72 ° C for 10 minutes. The PCR mix was performed using a PCR premix (premix, solgent).

DNA 전기영동 결과는 2(w/v)% 아가로즈 겔(agarose gel)을 이용하여 100V 조건에서 25분 동안 전기영동을 수행하여 도출되었다.DNA electrophoresis results were obtained by performing electrophoresis for 25 minutes at 100 V using 2 (w / v)% agarose gel.

도 5에서 확인할 수 있듯이, 1.0(v/v)% 이상의 SDS를 포함하는 세포 용해용 조성물과 반응시킨 시료에서만 DNA가 검출되었고, CHAPS 및 Triton X-100을 포함하는 세포 용해용 조성물과 반응시킨 시료에서는 계면활성제의 농도에 관계없이 DNA가 검출되지 않았다.5, DNA was detected only in a sample reacted with a composition for cell lysis containing 1.0 (v / v)% or more of SDS, and a sample reacted with a cytolytic composition containing CHAPS and Triton X-100 No DNA was detected regardless of the concentration of the surfactant.

2-2. 세포 용해를 통한 타겟 유전자의 검출 확인2-2. Confirmation of detection of target gene through cell lysis

헤테로캅사 트리퀘트라의 ITS 영역 내의 염기서열에 EcoRI 제한효소 서열이 있으므로, 본 발명의 세포 용해용 조성물(SDS 1.0(v/v)% 포함)로 추출된 DNA를 PCR하여 얻은 산물을 이용하여 절단(digestion)을 진행하였다. 37℃에서 2시간 동안 반응시킴으로써 절단하였으며, 2(w/v)% 아가로즈 겔을 이용하여 100 V에서 25분 동안 전기영동을 수행하였다.Since the nucleotide sequence in the ITS region of Heterocapsa tincture contains an EcoRI restriction enzyme sequence, the product obtained by PCR of the DNA extracted with the cytolytic composition of the present invention (containing SDS 1.0 (v / v)%) (digestion). Followed by digestion at 37 ° C for 2 hours, and electrophoresis was carried out at 100 V for 25 minutes using 2 (w / v)% agarose gel.

도 6에서 확인할 수 있듯이, 헤테로캅사 트리퀘트라의 ITS 영역 내의 염기서열이 세포 용해 이후 추출한 DNA로부터 검출되었다.As can be seen in FIG. 6, the nucleotide sequence in the ITS region of Heterocarpa triqu each was detected from DNA extracted after cell lysis.

상기 실시예 및 시험예 1 및 2에서의 세포 용해용 조성물의 조성에 대한 분석 결과, 100 mM Tris-HCl(pH 7.5), 1.0(v/v)% SDS, 1.0 mM EDTA, 150 mM NaCl, 2.5 mM 파이로인산나트륨, 1.0 mM 베타-글리세로포스페이트, 1.0 mM 바나듐산나트륨, 1.0 ug/ml 류펩틴을 포함하는 세포 용해용 조성물이 가장 최적의 조성비를 나타낸다고 볼 수 있다.As a result of analyzing the composition of the composition for cell lysis in Examples and Test Examples 1 and 2, 100 mM Tris-HCl (pH 7.5), 1.0 (v / v)% SDS, 1.0 mM EDTA, mM sodium pyrophosphate, 1.0 mM beta-glycerophosphate, 1.0 mM sodium vanadate, and 1.0 ug / ml leupeptin are the most suitable composition ratios.

이상, 본 발명내용의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적인 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의해 정의된다고 할 것이다.Having described specific portions of the present invention in detail, those skilled in the art will appreciate that these specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Industry-University Cooperation Foundation Chungbuk University <120> Microalgae cell lysis composition and Method for detecting microalgae <130> PN170063 <160> 2 <170> KopatentIn 2.0 <210> 1 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 1 gcacgcatcc aaactgc 17 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 2 gaagtcacaa gtgactatgg aag 23 <110> Industry-University Cooperation Foundation Chungbuk University <120> Microalgae cell lysis composition and Method for detecting          microalgae <130> PN170063 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 1 gcacgcatcc aaactgc 17 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequence <400> 2 gaagtcacaa gtgactatgg aag 23

Claims (9)

Tris-HCl 10 내지 200 mM;
소듐 도데실 설페이트(sodium dodecyl sulfate; 이하, SDS) 0.1 내지 5.0 (v/v)%;
에틸렌디아민사아세트산(ethylenediaminetetraacetic acid; 이하, EDTA) 0.1 내지 10.0 mM;
염화나트륨(sodium chloride) 100 내지 200 mM;
파이로인산나트륨(sodium pyrophosphate) 1.0 내지 5.0 mM;
베타-글리세로포스페이트(beta-glycerophosphate) 0.1 내지 10.0 mM;
바나듐산나트륨(sodium orthovanadate) 0.1 내지 10.0 mM; 및
류펩틴(leupeptin) 0.1 내지 10.0 ug/ml;
을 포함하는 미세조류 세포 용해용 조성물.10-200 mM Tris-HCl;
0.1 to 5.0 (v / v)% of sodium dodecyl sulfate (SDS);
0.1 to 10.0 mM ethylenediaminetetraacetic acid (EDTA);
100 to 200 mM sodium chloride;
Sodium pyrophosphate 1.0 to 5.0 mM;
0.1 to 10.0 mM beta-glycerophosphate;
0.1 to 10.0 mM sodium orthovanadate; And
Leupeptin 0.1 to 10.0 ug / ml;
Wherein the microbial cell is cultured. 제 1 항에 있어서, 상기 SDS는 1.0 내지 5.0(v/v)% 인 것인, 미세조류 세포 용해용 조성물.The composition for dissolving microalgae according to claim 1, wherein the SDS is 1.0 to 5.0 (v / v)%. 제 1 항에 있어서, 상기 미세조류는 와편모조류(dinophyta)인 것인, 미세조류 세포 용해용 조성물.The composition according to claim 1, wherein the microalgae are dinophyta. 제 1 항에 있어서, 상기 미세조류 세포 용해용 조성물은,
Tris-HCl 100 mM;
소듐 도데실 설페이트 1.0(v/v)%;
EDTA 1.0 mM;
염화나트륨 150 mM;
파이로인산나트륨 2.5 mM;
베타-글리세로포스페이트 1.0 mM;
바나듐산나트륨 1.0 mM; 및
류펩틴 1.0 ug/ml
을 포함하는 것인, 미세조류 세포 용해용 조성물.2. The microalgae cell dissolving composition according to claim 1,
Tris-HCl 100 mM;
1.0 (v / v)% sodium dodecyl sulfate;
EDTA 1.0 mM;
150 mM sodium chloride;
Sodium pyrophosphate 2.5 mM;
1.0 mM beta-glycerophosphate;
Sodium vanadate 1.0 mM; And
1.0 ug / ml of leupeptin
Wherein the microbial cell is selected from the group consisting of: 다음의 단계를 포함하는 미세조류 검출 방법:
(a) Tris-HCl 10 내지 200 mM, 소듐 도데실 설페이트(sodium dodecyl sulfate, 이하 SDS) 0.1 내지 5.0(v/v)%, EDTA 0.1 내지 10.0 mM, 염화나트륨(sodium chloride) 100 내지 200 mM, 파이로인산나트륨(sodium pyrophosphate) 1.0 내지 5.0 mM, 베타-글리세로포스페이트(beta-glycerophosphate) 0.1 내지 10.0 mM, 바나듐산나트륨(sodium orthovanadate) 0.1 내지 10.0 mM 및 류펩틴(leupeptin) 0.1 내지 10.0 ug/ml을 포함하는 미세조류 세포 용해용 조성물을 대상 시료와 반응시키는 반응 단계; 및
(b) 단백질 또는 핵산을 추출하는 추출 단계.A microalgae detection method comprising the steps of:
(a) 10 to 200 mM Tris-HCl, 0.1 to 5.0 (v / v)% of sodium dodecyl sulfate (SDS), 0.1 to 10.0 mM of EDTA, 100 to 200 mM of sodium chloride, Sodium pyrophosphate 1.0 to 5.0 mM, beta-glycerophosphate 0.1 to 10.0 mM sodium orthovanadate 0.1 to 10.0 mM and leupeptin 0.1 to 10.0 ug / ml A reaction step of reacting a composition for dissolving microalgae cells with a target sample; And
(b) an extraction step for extracting the protein or nucleic acid. 제 5 항에 있어서, 상기 미세조류는 와편모조류(dinophyta)인 것인, 미세조류 검출 방법.6. The method of claim 5, wherein the microalgae are dinophyta. 제 5 항에 있어서, 상기 SDS는 1.0 내지 5.0(v/v)%인 것인, 미세조류 검출 방법.6. The microalgae detection method according to claim 5, wherein the SDS is 1.0 to 5.0 (v / v)%. 제 5 항에 있어서, 상기 반응 단계는 0 내지 40℃의 온도 조건 하에서 수행되는 것인, 미세조류 검출 방법.6. The microalgae detection method according to claim 5, wherein the reaction step is carried out under a temperature condition of 0 to 40 占 폚. 제 5 항에 있어서, 상기 추출 단계는 반응 단계 이후 20분 이내에 수행되는 것인, 미세조류 검출 방법.6. The method of claim 5, wherein the extracting step is performed within 20 minutes after the reaction step.
KR1020170101170A 2017-08-09 2017-08-09 Microalgae cell lysis composition and Method for detecting microalgae KR101948431B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020170101170A KR101948431B1 (en) 2017-08-09 2017-08-09 Microalgae cell lysis composition and Method for detecting microalgae

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020170101170A KR101948431B1 (en) 2017-08-09 2017-08-09 Microalgae cell lysis composition and Method for detecting microalgae

Publications (1)

Publication Number Publication Date
KR101948431B1 true KR101948431B1 (en) 2019-02-15

Family

ID=65367386

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020170101170A KR101948431B1 (en) 2017-08-09 2017-08-09 Microalgae cell lysis composition and Method for detecting microalgae

Country Status (1)

Country Link
KR (1) KR101948431B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102247419B1 (en) * 2020-03-24 2021-05-03 정지원 Buffer composition and analysis method using the same

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Int.J.Curr.Microbiol.App.Sci., vol.4, no.10, p.273-281(2015)*
Int.J.Mol.Sci., vol.17, 955 (2016.06.16.)*

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102247419B1 (en) * 2020-03-24 2021-05-03 정지원 Buffer composition and analysis method using the same

Similar Documents

Publication Publication Date Title
Mirete et al. Functional metagenomics of extreme environments
US7893251B2 (en) Methods for selective isolation of nucleic acids from microbial cells present in samples containing higher eukaryotic cells and/or tissues
Vester et al. Discovery of novel enzymes with industrial potential from a cold and alkaline environment by a combination of functional metagenomics and culturing
Morin et al. An efficient DNA isolation protocol for filamentous cyanobacteria of the genus Arthrospira
Leis et al. Screening and expression of genes from metagenomes
EP2652175B1 (en) Method for electroeluting genetic material from dried samples
Bakken et al. Nucleic acid extraction from soil
Chen et al. A simple and efficient method for extraction of Taq DNA polymerase
Zhang Exploiting formalin‐preserved fish specimens for resources of DNA barcoding
KR101948431B1 (en) Microalgae cell lysis composition and Method for detecting microalgae
Tripathy et al. Exploring rapid and efficient protocol for isolation of fungal DNA
Ogello et al. Genetic differentiation of Artemia franciscana (Kellogg, 1906) in Kenyan coastal saltworks
Goncalves et al. High yield of functional metagenomic library from mangroves constructed in fosmid vector
Alvarado et al. Fast and reliable DNA extraction protocol for identification of species in raw and processed meat products sold on the commercial market
Thongekkaew et al. Yeasts in mixed deciduous forest areas of Phujong Nayoy National Park and their ability to produce xylanase and carboxymethyl cellulase.
JP2007124926A (en) Dna extractant and method for extracting dna using the same
KR20090058221A (en) Method of selectively lysing a dead cell in a cell populations in a sample
JP6128371B2 (en) Method for producing nucleic acid extract
JP2011160755A (en) Method for extracting nucleic acid of brown algae, method for determining species of brown algae and kit for extracting nucleic acid of brown algae
WO2020089756A1 (en) Detection method for halal food and halal food additives
Hamedo et al. Screening of hydrolytic extremozymes in haloalkaliphilic Archaea by culture and molecular-based methods.
JPWO2007116450A1 (en) Nucleic acid extraction method and nucleic acid extraction kit
Shi et al. Development of a dual promoter-mediated gene silencing system in Flammulina velutipes
Nagee et al. Molecular characterization of an expressed sequence tag representing the cuticle-degrading serine protease gene (PII) from the nematophagous fungus Arthrobotrys oviformis by differential display technology
JP2009136221A (en) Method for extracting nucleic acid

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant