KR101945292B1 - Biomarker for therapy of recurrent cancer after radiation treatment - Google Patents

Abstract

The present invention provides information for identifying a patient suffering from radiation-resistant recurrent cancer that is suitable for the administration of a target drug for metabolism, including the step of confirming the mutation of the amino acid sequence or the gene sequence of p53 protein in cancer cells surviving radiation irradiation separated from the patient The method comprising:

Description

[0001] The present invention relates to a biomarker for the treatment of recurrent cancer after radiation therapy,

The present invention relates to a method of providing information for identifying a patient suffering from radiation-resistant resistant recurrent cancer, which is suitable for the administration of a glucose metabolism target drug. More particularly, the present invention relates to a method for identifying a cancer- To a method of providing information for identifying a radiation-resistant resistant relapse cancer patient suitable for administration of a metabolic target drug, including identifying a mutation.

Cancer is the most fatal disease in the world and is the number one cause of death in the country. Despite the breakthrough of new therapeutic technologies such as surgery, drug therapy (chemotherapy, target medication), radiation therapy and immunotherapy , The cancer mortality rate has not been reduced significantly. Radiation therapy, especially for curative or adjuvant purposes, has become an important treatment for organ preservation and function in patients with head and neck cancer.

In radiation therapy for malignant tumors, survival of the tumor to obtain radiation resistance is known to be a major cause of cancer treatment failure and recurrent cancer. In addition, since the treatment method for recurrent cancer is very limited, Studies on the mechanism of radiation resistance are essential to reduce the acquisition of radiation resistance.

However, in the case of recurrent cancer after radiotherapy, salvage surgery for recurrent cancer is possible. However, in most cases, recurrent cancer is diagnosed in a state in which surgical treatment and radiation therapy are impossible Therefore, it is only possible to perform survival of patients with relapsed cancer by adjuvant chemotherapy, target drug therapy and recently immunotherapy.

Concomitant chemotherapy with docetaxel, cisplatin, and 5-fluorouracil may be used in combination with adjuvant chemotherapy for recurrent cancer after radiation therapy. However, due to toxicity, There was a problem.

As described above, the treatment method for recurrent cancer after radiation therapy is extremely limited so far.

In order to solve the above problems and to treat recurrent cancer after radiation therapy, the present inventors have developed a technique for providing a target treatment method by confirming mutation of p53 gene in relapse cancer after radiation therapy. Such a technique can provide information for identifying a patient with radiation-resistant recurrent cancer who is suitable for the administration of a drug target metabolite.

In addition, the provision of a target treatment method for the recurrence of cancer by confirming the mutation of the amino acid sequence or the gene sequence of the p53 protein of the present invention can be used as an important basic data for the development of new metabolism-specific therapeutic methods and drugs, It is expected to be possible.

An example of the present invention relates to a method for providing information on radiation therapy resistant recurrent cancer therapy, comprising the step of confirming the mutation of the amino acid sequence or gene sequence of p53 protein in cancer cells surviving radiation irradiation separated from the patient. Another aspect is to identify a patient with radiotherapy resistant relapse cancer who is suitable for the administration of the drug target metabolite, including identifying a mutation in the amino acid sequence or gene sequence of the p53 protein in the surviving cancer cells after radiation irradiation separated from the patient Diagnosis) of a disease. The method may further comprise preparing surviving cancer cells after radiation irradiation separated from the patient prior to the identifying step.

In another embodiment, there is provided a composition for the prevention or treatment of radiation therapy resistant recurrent cancer comprising a glucose metabolism target drug, wherein the radiation therapy resistant recurrent cancer comprises a mutation in the amino acid sequence or gene sequence of the p53 protein, And to a composition for preventing or treating resistance to recurrent cancer.

In another embodiment, there is provided a composition for identifying a radiation therapy resistant recurrent cancer patient suitable for administration of a glucose metabolism target drug, the composition comprising a preparation for detecting a mutation in the amino acid sequence or gene sequence of the p53 protein and a composition for identifying an amino acid sequence or gene sequence To a diagnostic kit for detecting a mutation in the amino acid sequence or gene sequence of p53 protein in a cancer cell surviving after irradiation containing an agent for detecting mutation.

Hereinafter, the present invention will be described in more detail.

The present invention provides information for identifying a patient suffering from radiation-resistant recurrent cancer that is suitable for the administration of a target drug for metabolism, including the step of confirming the mutation of the amino acid sequence or the gene sequence of p53 protein in cancer cells surviving radiation irradiation separated from the patient The method comprising:

The method may further comprise preparing surviving cancer cells after radiation irradiation separated from the patient prior to the identifying step.

The 'p53' is a cancer-suppressing protein, the human being is encoded by the TP53 gene, and the human p53 gene is present in the 17th chromosome short arm (17p13.1). p53 plays an important role in preventing cancer as a cancer suppressor in the cell cycle of multicellular organisms. P53 is also called the "protector of the genome" to prevent the mutation of the genome and preserve the stability of the genome. The name of p53 is derived from molecular weight. SDS-PAGE shows a molecular weight of about 53,000 Daltons. However, based on amino acid residues, the mass of p53 is only about 43,700 daltons. This difference is due to the large number of proline residues in the protein, which makes it more heavier than the actual mass due to the slow progression in SDS-PAGE. This phenomenon is observed in a wide variety of species, including humans, rodents, frogs, and fish. At the end of the G1 phase, the protein produced by the p53 gene checks whether the DNA in the cell is damaged. If the DNA is healthy, p53 promotes cell division, and if it finds damaged DNA, it activates DNA and induces the expression of other proteins to repair. If the damage is too lethal to repair, the p53 protein induces the cell to self-destruct. This is called apoptosis. The cell death plays a role in removing cells having damaged genetic information. Other healthy cells promote cell division to replace damaged cells.

If the p53 protein does not function normally due to a mutation in the p53 gene sequence, cells with damaged p53 DNA will be able to progress cell division. These damaged cells continue to divide and are not capable of detecting damaged DNA, resulting in more mutations. Such mutations cause cancer. Mutations in the p53 gene sequence are observed in approximately 50% or more of cancers occurring in the human body.

It is also known that p53 regulates cell metabolism by regulating energy metabolism and oxidative stress. It has been reported that p53 is a key protein that controls glycolysis, pentose phosphate pathway (PPP), mitochondrial oxidation phosphorylation, and lipid metabolism during the glucose metabolism of cancer cells.

One of the mechanisms of DNA damage repair by p53 is to increase the expression of TIGAR (TP-53-induced glycolysis and apoptosis regulator) to inhibit glycolysis or glucose metabolism and to oxidize G6P (glucose-6-phoshate) It is known to induce the production of asbestos ribosyl and NADPH in the synthesis of nucleic acids necessary for repairing damaged DNA.

In addition, p53 is expressed by phosphoglycerate mutase (PGM), glucose transporter-1/4, hexokinase, SCO2, apoptosis-inducing factor (AIF), glutaminase 2 (glucose-6-phosphate dehydrogenase), thereby increasing the oxidative phosphorylation and fatty acid metabolism of mitochondria, while inhibiting glucose uptake and related processes and promoting absorption and oxidation of intracellular glutamine.

The p53 protein may be derived from a mammal such as a primate including a human (Homo sapiens), a rodent including a mouse (Mus musculus), a rat (Rattus norvegicus), an amphibian such as a frog (Xenopus laevis) . For example, p53 is a human p53 (e.g., NP_000537.3. (Gene: NM_000546.5.)), Mouse p53 (e.g., NP_001120705.1 (Gene: NM_030989.3.) And the like), fruit flies (for example, NP_001163694.1. (Gene: NM_001170223.1.)), And the like, but the present invention is not limited thereto.

The 'mutation' occurs naturally in a gene in a long chain type deoxyribonucleic acid (DNA) molecule, or by an external factor such as electromagnetic radiation or chemicals, and is a phenomenon in which deletion, substitution, or insertion of a nucleotide existing in DNA Lt; / RTI > Mutant forms of oocysts or other animals are divided into somatic mutations and germ cell mutations. Somatic cell mutations occur in the cells that make up the body outside the germ cell, leading to local changes in the body. Cells that divide from mutated somatic cells have mutations but are not transmitted to their offspring. Germ cell mutations can be transmitted to offspring because mutations occur in the genetic material of germ cells, oocytes or sperm. When a germ cell mutation changes an individual, the effect is generally fatal. Many genetic diseases are caused by germ cell mutations.

The deletion is a phenomenon in which a nucleotide pair is deleted in a gene. The disappearance of nucleotides often causes catastrophic effects because the frame shift is altered. If the number of nucleotide pairs to be deleted is not a multiple of 3, the reading frame shifts and abnormal codons are formed, resulting in a wide variation in amino acid sequence, often terminating shorter than normal.

The substitution is that one nucleotide pair is replaced with another pair of nucleotides. Due to the flexibility of the codon, substitution does not affect the encoded protein. As a representative disease caused by substitution, there is sickle cell anemia. A pair of bases is substituted, and among the amino acids constituting hemoglobin, glutamic acid becomes valine, resulting in formation of sickle-shaped red blood cells. The absence of a change in the amino acid sequence is referred to as a neutral mutation, most of which is a missense mutation that changes to another amino acid, and a nonsense mutation that changes the codon encoding the amino acid as a termination codon as a result of the mutation.

The insertion is a phenomenon in which a nucleotide pair is added to a gene. Since the frame shift is changed, it often has a fatal effect. If the number of inserted nucleotide pairs is not a multiple of 3, the reading frame shifts and an abnormal codon is used, so that a wide range of amino acid sequence changes and is often terminated shorter than normal.

The above-mentioned 'radiation irradiation' refers to the treatment of curative, adjuvant, and palliative purposes of solid cancer through a mechanism of inhibiting cell division and inducing apoptosis through DNA damage of cancer cells, Together, this combination therapy with chemotherapy or a radiation sensitizer is an important treatment for cancer patients in the 50-60% range.

The term 'radiation therapy-resistant recurrence cancer' refers to the development of cancer cells after reprocessing of cancer cells and gene mutation during radiation therapy, and even after radiation therapy, cell division including damaged DNA is continued to acquire resistance to radiation, .

The amino acid sequence of the p53 protein is shown in SEQ ID NO: 1, and the base sequence of p53 protein is shown in SEQ ID NO: 2.

The mutation of the amino acid sequence or the gene sequence of the p53 protein includes inhibition of p53 protein activity by deletion, substitution, or insertion of all or a part of the p53 gene. Inhibition of the p53 protein activity is inhibited by Parkin Activation or induction of the expression of Bnip3, but is not limited thereto.

Inhibition of p53 protein activity by radiation does not induce activation of Parkin or expression of Bnip3. In normal cells, activation of Parkin involved in maintenance of mitochondrial homeostasis in response to cytotoxicity induced by irradiation, or activation of Bnip3 However, cells with inhibited p53 protein activity may mean that Parkin activation or Bnip3 expression is not involved in mitochondrial homeostasis in response to radiation induced cell damage.

Activation of Parkin may be confirmed by phosphorylation of Parkin Ser54, and activation of Parkin or measurement of expression of Bnip3 may be performed by a method of measuring protein phosphorylation or expression, but the present invention is not limited thereto.

The inhibition of the p53 protein activity may be a deletion (p53 null) or partial deletion of the amino acid sequence or gene sequence of the p53 protein, or a substitution (p53 mutation) of the DNA-binding domain in the p53 gene (p53 mutant).

In one embodiment, the inhibition of the p53 protein activity may be induced by mutation of the p53 amino acid sequence or gene as follows:

1) a mutation (p53 null) in which the amino acid sequence or the entire gene sequence of the p53 protein of SEQ ID NO: 1 is deleted;

2) a mutant in which amino acid is not expressed from glycine, which is the 293rd amino acid in the amino acid sequence of p53 protein of SEQ ID NO: 1;

3) a mutation in which the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is substituted with a tryptophan amino acid residue; or

4) a mutation in which the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is replaced by the tryptophan amino acid residue and the 293rd amino acid is glycan but the amino acid is not expressed, is not limited thereto.

2) In the amino acid sequence of the p53 protein of SEQ ID NO: 1, a mutation in which the amino acid is not expressed from glycine, which is the 293rd amino acid, deletes one of the nucleotides encoding glycine, which is the 293rd amino acid, It may not be expressed and may not be expressed from the 293rd amino acid glycine to the 393rd amino acid aspartic acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1 or the first amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 292 < th > amino acid, but is not limited thereto.

Mutation confirmation of the p53 gene sequence can be confirmed by p53 gene sequencing.

The cancer cells may be, but are not limited to, head and neck cancer, or squamous cell carcinoma of the upper respiratory tract or upper gastrointestinal tract.

The upper respiratory tract refers to the area from the nose to the organs and may include, but is not limited to, nose, sinus, nasopharynx, oral cavity, oropharynx, hypopharynx, or larynx.

The upper gastrointestinal tract refers to the area from the mouth to the esophagus, and may include, but is not limited to, oral, ophthalmic, hypopharyngeal, or esophageal.

The step of confirming the mutation of the amino acid sequence or the gene sequence of the p53 protein may be performed using an agent for detecting mutation of the amino acid sequence or gene sequence of the p53 protein, but is not limited thereto.

The agent for detecting the mutation of the amino acid sequence or the gene sequence of the p53 protein may be applied to a cancer cell sample surviving the irradiation, and the agent for detecting the mutation of the amino acid sequence or the gene sequence of the p53 protein may be a p53 protein (E. G., Wild type or mutated p53 protein) and / or a gene encoding the p53 protein (e. G., Wild type or mutated p53 protein).

When the agent for detecting the mutation is a substance that interacts with a wild-type p53 protein or a gene encoding the same, the protein or gene detected by the interacting substance may not have a mutation, If it is not detected by the substance, it can be confirmed that it has a mutation.

On the other hand, when the agent for detecting the mutation is a substance that interacts with a mutation of a p53 protein amino acid sequence or a gene sequence encoding the same, the protein or gene detected by the interacting substance may have a mutation, On the other hand, if it is not detected by the interacting substance, it can be confirmed that it has no mutation.

When the agent for detecting the mutation is a substance that interacts with the wild-type p53 protein or a gene encoding the mutant, it is possible to select a patient in which a mutation of the amino acid sequence or gene sequence of the p53 protein is detected, Patients may be identified with a radiotherapy-resistant recurrent cancer patient who is eligible for a glucose metabolism target drug.

On the other hand, when the agent for detecting the mutation is a substance that interacts with a mutation of the p53 protein amino acid sequence or a gene sequence encoding the same, a patient in which the mutation of the amino acid sequence or gene sequence of the p53 protein to be detected is detected And the patient can be identified as a patient with radiation therapy resistant relapsing cancer who is suitable for the administration of a glucose metabolism target drug.

In a method for providing information for identifying a patient suffering from a radiation therapy-resistant relapse cancer suitable for administration of the above-described glucose metabolism target drug, a patient in which a mutation in the amino acid sequence or gene sequence of the p53 protein has been detected, Can be identified as a cancer patient, and thus can be, but is not limited to, treating a metabolic target drug to treat it.

On the other hand, in a method for providing information for identifying a patient suffering from a radiation therapy-resistant recurrent cancer, which is suitable for the administration of the sugar metabolism target drug, a patient in which the amino acid sequence or gene sequence of the p53 protein is wild- Resistant recurrent cancer patient, and thus may not treat the glucose metabolism target drug to treat it, but it is not limited thereto.

The present invention also relates to a composition for the prevention or treatment of radiation therapy-resistant recurrent cancer comprising a sugar metabolism target drug, wherein said radiation therapy-resistant recurrent cancer comprises a mutation of p53 protein or gene. Prevention or treatment of cancer.

A composition for preventing or treating radiation-induced resistance recurrence cancer, which comprises the above-described sugar metabolism target drug, is a composition for preventing or treating radiation-induced resistance relapse cancer in a patient suffering from radiation therapy-resistant relapsed cancer including mutation of p53 protein or gene, / Or may be used for, but not limited to.

A method for identifying a patient suffering from a radiation therapy resistant relapse cancer comprising a mutation of a p53 protein or a gene in order to use a composition for preventing or treating radiation therapy resistant relapsing cancer, May be the same method as described above.

The above-mentioned genes may mean glucose metabolism of cancer cells, but the present invention is not limited thereto.

Unlike most normal tissue cells, the 'sugar metabolism of cancer cells' is a cellular metabolic pathway that is characteristic of cancer cells. Instead of turning the TCA cycle through mitochondria to rapidly grow cancer cells, biomass (protein, lipid, nucleic acids) to produce glycolysis-dependent ATP.

The sugar metabolism target drug may inhibit the process (Glycolysis), but is not limited thereto.

The 'target drug' inhibits the growth of cancer by blocking the metabolic pathway at a specific site belonging to the corresponding process during the metabolism of the cancer.

The sugar metabolizing target drug may be 2-Deoxy-D-glucose (2-DG) or (R) -1,1 ', 6,6', 7,7'-Hexahydroxy-3,3'- It has been shown that by inhibiting the metabolic pathway at a specific site belonging to the corresponding process during the metabolism of 5'-bis (1-methylethyl) - [2,2'-binaphthalene] -8,8'-dicarboxaldehyde (AT101) But it is not limited thereto.

The mutation of the amino acid sequence or the gene sequence of the p53 protein includes inhibition of p53 protein activity by deletion, substitution, or insertion of all or a part of the p53 gene. Inhibition of the p53 protein activity is inhibited by Parkin Activation or induction of the expression of Bnip3, but is not limited thereto.

The inhibition of the p53 protein activity may be a deletion (p53 null) or partial deletion of the amino acid sequence or gene sequence of the p53 protein, or a substitution (p53 mutation) of the DNA-binding domain in the p53 gene (p53 mutant).

In one embodiment, the inhibition of the p53 protein activity may be induced by mutation of the p53 amino acid sequence or gene as follows:

1) a mutation (p53 null) in which the amino acid sequence or the entire gene sequence of the p53 protein of SEQ ID NO: 1 is deleted;

2) a mutant in which amino acid is not expressed from glycine, which is the 293rd amino acid in the amino acid sequence of p53 protein of SEQ ID NO: 1;

3) a mutation in which the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is substituted with a tryptophan amino acid residue; or

4) a mutation in which the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is replaced by the tryptophan amino acid residue and the 293rd amino acid is glycan but the amino acid is not expressed, is not limited thereto.

When p53 null or partial deletion of the p53 gene sequence, or DNA-binding domain substitution (p53 mutation) in the p53 gene, the cells express the Parkin activation of p53 protein or the expression of Bnip3 by irradiation But it is not limited to this.

The cancer may be, but is not limited to, head and neck cancer, or squamous cell carcinoma of the upper respiratory tract or upper gastrointestinal tract.

The upper respiratory tract refers to a region from the nose to the trachea and may include, but is not limited to, nose, sinus, nasopharynx, oral cavity, oropharynx, hypopharynx, and larynx.

The upper gastrointestinal tract refers to the area from the mouth to the esophagus, and may include, but is not limited to, oral, ophthalmic, hypopharyngeal, or esophageal.

The sugar metabolism target drug may inhibit the process (Glycolysis), but is not limited thereto.

The sugar metabolizing target drug may be 2-Deoxy-D-glucose (2-DG) or (R) -1,1 ', 6,6', 7,7'-Hexahydroxy-3,3'- It has been shown that by inhibiting the metabolic pathway at a specific site belonging to the corresponding process during the metabolism of 5'-bis (1-methylethyl) - [2,2'-binaphthalene] -8,8'-dicarboxaldehyde (AT101) But it is not limited thereto.

The present invention also relates to a composition for the identification (or diagnosis) of a radiation therapy resistant relapsing cancer patient suitable for administration of a sugar metabolism target drug, comprising an agent for detecting a mutation in the amino acid sequence or gene sequence of the p53 protein.

The agent for detecting the mutation of the amino acid sequence or the gene sequence of the p53 protein may be applied to a cancer cell sample surviving the irradiation, and the agent for detecting the mutation of the amino acid sequence or the gene sequence of the p53 protein may be a p53 protein (E. G., Wild type or mutated p53 protein) and / or a gene encoding the p53 protein (e. G., Wild type or mutated p53 protein).

When the agent for detecting the mutation is a substance that interacts with a wild-type p53 protein or a gene encoding the same, the protein or gene detected by the interacting substance may not have a mutation, while the interaction And that the mutant has a mutation if it can not be detected by the substance that is involved in the mutation.

On the other hand, when the agent for detecting the mutation is a substance that interacts with a mutation of a p53 protein amino acid sequence or a gene sequence encoding the same, the protein or gene detected by the interacting substance may have a mutation, On the other hand, if it is not detected by the interacting substance, it can be confirmed that it does not have a mutation.

When the agent for detecting the mutation is a substance that interacts with the wild-type p53 protein or a gene encoding the mutant, it is possible to select a patient in which a mutation of the amino acid sequence or gene sequence of the p53 protein is detected, The patient may be considered to be a patient with radiotherapy-resistant relapsing cancer that is suitable for the administration of the drug, and thus may be, but is not limited to, treating the drug with a target metabolite.

On the other hand, when the agent for detecting the mutation is a substance that interacts with a mutation of the p53 protein amino acid sequence or a gene sequence encoding the same, a patient in which the mutation of the amino acid sequence or gene sequence of the p53 protein to be detected is detected And the patient may be determined to be a radiotherapy resistant relapsing cancer patient suitable for the administration of a glucose metabolism target drug, and thus the glucose metabolism target drug may be treated, but is not limited thereto.

A substance that interacts with the p53 protein (e. G., A wild-type or mutated p53 protein) is a chemical, small molecule, protein, peptide, or protein that specifically binds to a p53 protein (e. G., Wild type or mutated p53 protein) , A nucleic acid molecule (polynucleotide, oligonucleotide, etc.), and an antibody, but the present invention is not limited thereto.

A substance that interacts with a gene encoding the p53 protein (e. G., Wild-type or mutated p53 protein) specifically binds specifically to a gene encoding a p53 protein (e. G., Wild type or mutated p53 protein) But are not limited to, one or more selected from the group consisting of primers, probes, platamers, and antisense oligonucleotides.

The mutation of the gene encoding the p53 protein and / or the p53 protein can be determined by any conventional protein or gene analysis method using a substance that interacts with the protein or gene. For example, (PCR) (e.g., qPCR, real-time PCR, etc.), fluorescence in situ hybridization (FISH), microarray method, and hybridization method using conventional hybridization methods using hybridizable primers, probes, , But is not limited thereto

The primers are designed to detect 5 to 1000 bp, for example 10 to 500 bp, 20 to 200 bp, or 50 to 200 bp of the gene fragments in the nucleotide sequence of the gene encoding the p53 protein (full-length DNA, cDNA or mRNA) Which is capable of hybridizing with a consecutive 5 to 100 bp, such as 5 to 50 bp, 5 to 30 bp, or 10 to 25 bp sites of the 3'-terminal and 5'-terminal ends of the gene fragment (for example, Complementary) base sequence. The probe or the aptamer may have a total length of 5 to 100 bp, 5 to 50 bp, 5 to 30 bp, or 5 to 25 bp, and may be a base of a gene (full-length DNA, cDNA or mRNA) (For example, a complementary) base sequence with a 5 to 100 bp, 5 to 50 bp, 5 to 30 bp, or 5 to 25 bp consecutive gene fragment of the sequence, The site where the aptamer is capable of binding or hybridizing may be, but is not limited to, a site that contains the mutated position of the gene encoding the p53 protein.

The term " hybridizable " means that the gene can bind to the gene site by chemical and / or physical bonding such as covalent bond, and the 'hybridization possible' means that the base sequence of the gene region is 80 Or more, such as 90%, 95%, 98%, 99%, or 100% complementarity.

The mutation of the amino acid sequence or the gene sequence of the p53 protein includes inhibition of p53 protein activity by deletion, substitution, or insertion of all or a part of the p53 gene. Inhibition of the p53 protein activity is inhibited by Parkin Activation or induction of the expression of Bnip3, but is not limited thereto.

The inhibition of the p53 protein activity may be a deletion (p53 null) or partial deletion of the amino acid sequence or gene sequence of the p53 protein, or a substitution (p53 mutation) of the DNA-binding domain in the p53 gene (p53 mutant).

In one embodiment, the inhibition of the p53 protein activity may be induced by mutation of the p53 amino acid sequence or gene as follows:

1) a mutation (p53 null) in which the amino acid sequence or the entire gene sequence of the p53 protein of SEQ ID NO: 1 is deleted;

2) a mutant in which amino acid is not expressed from glycine, which is the 293rd amino acid in the amino acid sequence of p53 protein of SEQ ID NO: 1;

3) a mutation in which the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is substituted with a tryptophan amino acid residue; or

4) a mutation in which the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is replaced by the tryptophan amino acid residue and the 293rd amino acid is glycan but the amino acid is not expressed, is not limited thereto.

The present invention also relates to a diagnostic kit for detecting a mutation of an amino acid sequence or gene sequence of a p53 protein in a cancer cell surviving radiation after irradiation comprising an agent for detecting mutation of the amino acid sequence or gene sequence of p53 protein.

Also, the present invention provides a method for detecting a mutation of p53 amino acid sequence or gene in a cancer cell surviving irradiation with an oligonucleotide containing all or a part of the gene sequence encoding the p53 protein of SEQ ID NO: 2 or a complementary oligonucleotide thereof integrated therein And the integrated oligonucleotide may be capable of binding to or hybridizing with a mutation of the p53 gene sequence, but is not limited thereto.

The oligonucleotide or its complementary strand molecule may comprise, but is not limited to, 15 to 50, preferably 15 to 30, more preferably 18 to 25 nucleotides of the biomarker gene.

The microarray can be produced by a method known to a person skilled in the art. For example, when the microarray is fabricated as a chip, a micropipetting method using a piezo electric method is used to immobilize the DNA marker on a substrate using the detected gene marker as a probe DNA molecule Or a method using a spotter in the form of a pin is preferably used, but the present invention is not limited thereto.

The substrate of the microarray chip is preferably coated with one activator selected from the group consisting of amino-silane, poly-L-lysine and aldehyde, It is not.

The substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon film, and nitrocellulose membrane, but is not limited thereto.

The diagnostic kit may include a support, a buffer solution, a secondary antibody labeled with a coloring enzyme or a fluorescent substance, a coloring substrate solution, or L4-PHA, poly (A) RNA for measuring the change of the 1,6-N-acetylglucosamine sugar chain Separation reagents, and the like.

The support may be a nitrocellulose membrane, a 96-well plate synthesized from a polyvinyl resin, a 96-well plate synthesized from a polystyrene resin, a glass slide glass, or the like. The chromogenic enzyme may be peroxidase, Or alkaline phosphatase, and the fluorescent material may be FITC, RITC or the like, and the coloring substrate solution may be ABTS (2,2'-Azino-bis (3-ethylbenzenzothiazoline-6-sulfonic acid ), OPD (o-Phenylenediamine), TMB (Tetramethyl Benzidine), and the like.

Wherein the mutation of the amino acid sequence or gene sequence of the p53 protein comprises

1) a mutation (p53 null) in which the amino acid sequence or the entire gene sequence of the p53 protein of SEQ ID NO: 1 is deleted;

2) a mutant in which amino acid is not expressed from glycine, which is the 293rd amino acid in the amino acid sequence of p53 protein of SEQ ID NO: 1;

3) a mutation in which the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is substituted with a tryptophan amino acid residue; or

4) a mutation in which the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is replaced by the tryptophan amino acid residue and the 293rd amino acid is glycan but the amino acid is not expressed, is not limited thereto.

The present invention provides information for identifying a patient suffering from radiation-resistant recurrent cancer that is suitable for the administration of a target drug for metabolism, including the step of confirming the mutation of the amino acid sequence or the gene sequence of p53 protein in cancer cells surviving radiation irradiation separated from the patient The method of the present invention makes it possible to confirm a patient with radiation-resistant relapsing-remitting cancer who is suitable for the administration of a glucose metabolism target drug.

FIG. 1 is a graph showing the survival rate after irradiation in the process of selecting cells surviving after irradiation according to an embodiment of the present invention. FIG.
FIG. 2 is a graph showing changes in cell growth upon treatment of a drug-metabolizing target drug in a cancer cell surviving after irradiation according to an embodiment of the present invention. FIG.
FIG. 3 is a graph showing the change of cell growth upon treatment with a glucose-metabolizing target drug in a cancer cell surviving after irradiation with p53 by introducing p53 into p53-deficient cancer cells according to an embodiment of the present invention.
FIG. 4 is a graph showing changes in cell growth upon treatment of a drug-metabolizing target drug with radiation-resistant cancer cells in vivo according to an embodiment of the present invention. FIG.
FIG. 5 is a graph showing a difference in glucose uptake in a radiation therapy resistant relapse cancer model according to an embodiment of the present invention. FIG.
FIG. 6 is a graph showing a difference in production of lactic acid in a radiation therapy-resistant relapse-cancer model according to an embodiment of the present invention. FIG.
FIG. 7 is a graph showing differences in the extracellular matrix oxidation (ECAR) occurrence in a radiation therapy resistant relapse cancer model according to an embodiment of the present invention.
FIG. 8 is a graph showing the production of a glucose metabolism intermediate in a radiation therapy resistant relapse cancer model according to an embodiment of the present invention. FIG.
FIG. 9 is a graph showing changes in expression of enzymes involved in glucose metabolism in a radiation-resistant resistant relapse cancer model using real-time PCR according to an embodiment of the present invention.
FIG. 10 is a graphical representation of an increased glucose metabolism process in a p53 mutant or non-existing radiotherapy resistant relapse cancer model according to an embodiment of the present invention.
FIG. 11 is a graph showing the Oxygen Consumption Rate (OCR) of a radiation therapy resistant relapse cancer model according to an embodiment of the present invention.
FIG. 12 is an electron micrograph of a mitochondrial morphology observed in a p53 non-existing radiotherapy resistant relapse cancer model according to an embodiment of the present invention. M represents mitochondria, and N represents nuclei.
FIG. 13 is a graph showing the amount of mitochondria in a radiation-resistant relapse-cancer model according to an embodiment of the present invention. FIG.
FIG. 14 is a graph showing the ATP production of ROS and cells in mitochondria in a radiation therapy resistant relapse cancer model according to an embodiment of the present invention. FIG.
FIG. 15 is a graph showing the expression of mitochondrial dynamics and mitophagy-related proteins in a radiation-resistant resistant relapse cancer model according to an embodiment of the present invention.
16 is a graph showing the flux of mitophagy in a radiation-resistant relapse-cancer model according to an embodiment of the present invention.
FIG. 17 is a graph showing the expression of mitophagy-related protein after p53 knockdown in a p53 wild-type radiation therapy-resistant relapse cancer model by Western blotting according to an embodiment of the present invention.
FIG. 18 is a graph showing the expression of mitophagy-related protein after p53 knockdown in the p53 wild-type radiation therapy-resistant relapse cancer model according to an embodiment of the present invention through immunocytochemistry.
FIG. 19 is a graph showing a change in expression of mitophagy-related protein after Western blot analysis of p53 gene in a p53 non-resident type radiation therapy-resistant relapse cancer model according to an embodiment of the present invention.
FIG. 20 is a graph showing changes in cell growth upon treatment with a glucose metabolism target drug in a breast cancer cell line survived after irradiation according to an embodiment of the present invention. FIG.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example  1. Resistance to radiation therapy Recurrent cancer  Model building

1-1: Culture of cancer cells

(p53 null type, Dr. Thomas E. Carey), p53 wild type (HN30, wild type p53, provided by Dr. Jeffrey N. Myers from the University of Texas MD Anderson Cancer Center) from the University of Michigan), a p53 mutant (AMC-HN-3 (expression of a mutant p53 protein in which the 282nd amino acid arginine was replaced with tryptophan in the p53 protein amino acid sequence of SEQ ID NO: 1, R282W) -HN-8 (a mutant p53 protein expressed in a form in which amino acid is not expressed from glycine, which is the 293rd amino acid in the p53 protein amino acid sequence of SEQ ID NO: 1) is cultured in a cell line established from larynx patients in Asan Hospital) The cancer cells were cultured in Dulbecco's modified eagle medium (DMEM, Sigma) supplemented with 2 mM L-glutamine, 1% (v / v) nonessential amino acids, 100 U / ml penicillin, 100 ug / ml streptomycin and 10% fetal bovine serum Gibco Life Technologi Es, Grad Island, NY) at 5% CO 2 and 37 ° C in a cell incubator.

1-2: Irradiation of Cancer Cells

When the cultured cancer cells were grown in a 100-mm dish with 50% confluency using an X-RAD 320 radiator (Precision X-ray Inc., North Branford, CT, USA) Gy radiation was continuously irradiated at intervals of 2-3 days and irradiated for a long period of time so as to be 70 Gy in total. When cancer cells grew to 70-80% confluence, they were subcultured into new dishes.

1-3: Radiation to Cancer Cells After investigation  Alive Cancer cell line  Selection (establishment)

After surviving the irradiation, the surviving cells were collected and cultured in the same manner as in the cell culture method of 1-1.

The cancer cells were seeded at different cell numbers according to the radiation therapy of 60-mm dyshi, and irradiated with radiation of 3, 6, and 9 Gy to collect at least 50 cells to form a single colony After 10-14 days of incubation, the colonies were stained with a solution of 0.5% (w / v) cyristal violet in 50% (v / v) methanol and 10% (v / v) glacial acetic acid, , The radiation resistance curve of the parent cell (the percentage of surviving cells after irradiation) and the radiation resistance curve of the surviving cell after the irradiation of 70 Gy were plotted, respectively. Resistant cells, the surviving cells are selected as radiation-resistant cells.

For the resistance-confirmed cell lines, R was assigned to the parental cell name.

1-4: p53 Absent type  P53 was transfected into cancer cells, and surviving cancer cells sorted by irradiation

Cells injected with the pBABE vector or pBABE vector containing the p53 wild-type gene were used for the p53 non-survival type (UM-SCC-1) cells used in Example 1-1. Jeffrey N. Myers from the University of Texas MD Anderson Cancer Centerd. The cells were cultured in the same manner as in Example 1-1, irradiated with the same method as in Examples 1-2 and 1-3, and survived cell lines were selected. For cell lines with resistance confirmed, R was assigned to the parental cell name.

Example  2. in vitro and in vivo  On the right On the target drug  Resistance to radiation therapy Recurrent cancer  Check reactivity

2-1: Radiation After investigation  Alive Cancer cell  Party ambassador Target drug  Changes in cell growth during treatment

Each of the radiation resistant cell lines selected in Example 1 was treated with a glucose metabolism target drug to inhibit the growth of cancer cells.

Specifically, 2-DG (2-DG; hexokinase inhibitor, Sigma-Aldrich), which is a hsokinase inhibitor involved in Glycolysis, is treated with the radiation-resistant cell line or Lactate dehydrogenase A ) Inhibitor AT101 (AT101; LDHA inhibitor, TOCRIS) was treated in the following manner. The selected p53 wild-type, absent-type, and mutant-type radiation-resistant cancer cells were seeded on a 6-well plate at a density of 1 × 10 ⁵ cells and cultured in a medium containing 2 mM L-glutamine, 1% 10 mM 2-DG or 5 μM of AT101 was injected into each cell and the cells were treated with DMSO for 48 hours, 10 mM 2-DG for 48 hours, or 5 uM of AT101 for 48 hours.

Cells treated with the glucose metabolism target drug were trypsinized, stained with trypan blue, and counted in a Countess II automated cell counter (Life technology, Bothell, WA, USA) USA) was used to calculate the number of cells.

As a result, as shown in Fig. 2, when 2-DG or AT101, which is a glucose metabolism target drug, was treated with the p53 wild type R cell line, when 2-DG or AT101 was treated with p53 wild type cells (parent cells) Although no significant decrease in the growth of cancer cells was observed compared with the change in growth, the p53 mutant or absent R cell line showed a decrease in the expression of p53 mutant or absent cells (blastocysts) when 2-DG or AT101, ) Treated with 2-DG or AT101 inhibited cancer cell growth by 0.5 to 0.8 times as compared to the growth of cancer cells.

2-2: No p53 P53 was introduced into cancer cells, After investigation  Alive Cancer cell  Party ambassador Target drug  Changes in cell growth during treatment

The cancer cell line survived after irradiation with p53 was transfected with p53 in the p53 non-cancerous cell prepared in Example 1-4, and the drug was treated with the drug in the same manner as in Example 2-1, and the growth of cancer cells was inhibited Respectively.

As a result, as shown in FIG. 3, in the results of FIG. 2, when 2-DG or AT101 was treated with R-cell line derived from p53 wild type as compared to treatment with 2-DG or AT101 to p53 wild type cells, , P53 gene was transfected into UMSCC1, a p53-absent cancer cell, and UMSCC1 tumor cells transfected with p53 wild-type were transfected with 2-DG or AT101 after survival of the surviving R cell line Treatment with 2-DG or AT101 did not show a significant decrease in cancer cell growth compared to the growth of cancer cells.

2-3: in vivo  On radiation-resistant cancer cells Target drug  Changes in cell growth during treatment

The p53 wild type cell line or the p53 non-existing type radiation resistant cell line prepared in Example 1 was transplanted into an in vivo mouse model to confirm the effect on cancer cell growth.

Specifically, cells were seeded at 1 x 10 ⁷ cells in the right flank of 6-week old male NOD / SCID gamma mice (NOD.Cg-Prkdcscid Il2rgtm1 Wjl / SzJ, The Jacson Laboratory, Bar Harbor, ME, USA) When the size was 100-200 mm ³ , 500 mg / kg 2-DG was administered intraperitoneally (IP) daily for 2 weeks, and tumor size was measured every other day. Tumor size was calculated using the following equation.

V = D x d2 x 0.52; D = long diameter, d = short diameter.

As a result, as shown in FIG. 4, when the p53 wild type cell line (HN30) and the p53 non-existing type R cell line (UMSCC1R) were planted in the mouse and treated with 500 mg / kg 2-DG, R-cell line (UMSCC1R) inhibited the growth of cancer cells by 2-DG treatment, whereas 2-DG treatment of p53 wild-type cell line (HN30) showed no significant difference in cancer cell growth.

Comparative Example  One.

MCF-7 cells, which are breast cancer cells having the p53 wild-type gene, were cultured, irradiated, and survived cancer cell lines in the same manner as in Example 1, and treated with a glucose metabolism target drug in the same manner as in Example 2, Were observed.

As a result, when the drug (2-DG, AT-101) that targets glucose metabolism is treated with a radiation-resistant cell line derived from MCF-7 having the p53 wild-type gene, cancer cells The degree of inhibition of growth was not significantly different from the degree of inhibition of cancer cell growth when the same drug was administered to the parent cells.

Comparative Example  2.

MDA-MB-231 cells, which are breast cancer cells having a p53 mutant gene (arginine 280-substituted by arginine at the 280th amino acid of the p53 protein, R280K), were cultured and irradiated in the same manner as in Example 1, And the glucose metabolism target drug was treated in the same manner as in Example 2, and the growth of cancer cells was observed.

As a result, as shown in the right side of FIG. 20, a drug (2-DG, AT-101) targeting glucose metabolism to a radiation resistant cell line derived from MDA-MB-231 cell having a p53 mutant gene The degree of inhibition of cancer cell growth when treated with the same drug was not significantly different from that of cancer cell growth inhibition.

Example  3. Confirm the change of the contemporary history

3-1: Intracellular  Measurement of sugar intake and lactate production

In order to determine whether there is a difference in glucose metabolism in the radiation therapy-resistant relapse cancer model prepared in Example 1, glucose uptake, lactate production, and extracellular matrix oxidation degree (glucose uptake, ECAR) was confirmed.

Specifically, the R cell line and the parental cell line of p53 wild type, the parent cell line, and the p53 mutant non-existent R cell line and the parent cell line were cultured in the same manner as in Example 1, and glucose uptake ) Were measured by the glucose colorimetric uptake assay kit (abcam) and the lactate production was measured by the lactate colorimetric assay kit (Biovision, Inc., Milipas, CA, USA).

On the other hand, the extracellular matrix oxidation (ECAR) was performed by the following method using XF-24 extracellular flux analyzer (Seahorse Bioscience, North Billerica, MA, USA). Before assaying, 1 ml of Seahorse Bioscience XF-24 Calibrant solution was added to the cartridge sensor per well and incubated overnight at 37 ° C in a CO2-free incubator. On the day of analysis, cells were seeded to 2 × 10 4 cells per well and then cultured in a 24-well plate at 37 ° C for 1 hour in a CO2-free incubator. The ECAR was measured according to the compound injected during the analysis. The program of 25 mM glucose, 0.5 μg / ml oligomycin, 1 M 2 -DG and Seahorse XF-24 analyzer was set according to the manufacturer's instructions. The ECAR was expressed in terms of mpH / min. Protein concentrations were measured for each well using Micro BCA protein assay kit (Thermo-Fisher Scientific) and corrected for protein concentration.

As a result, as shown in Figs. 5 to 7, there was no significant change in intracellular intracellular sugar flux, lactic acid production, and extracellular substrate oxidation rate compared to the parent cell of the p53 wild type R cell line, Mutant or absent R cell lines increased intracellular glucose and lactate production by 1.2 to 1.5 times compared to their parental cells and increased 1.2 times in the absence of p53 and 1.7 times in the p53 mutant type.

3-2: Measurement of production of sugar metabolite intermediates

In order to confirm whether there is a difference in glucose metabolism dependency on the radiation therapy resistant relapse cancer model prepared in Example 1, the following experiment was performed.

Specifically, in order to measure intracellular metabolite concentration, cells prepared and cultured by the method of Example 1 were sequentially washed with PBS and H2O, and then the cells were suspended in 80% (v / v) cold methanol Lt; / RTI > The metabolites were collected by liquid-liquid extraction with CHCl3 / H2O (35% v / v), dried in a vacuum centrifuge, and analyzed by LC-MS / MS [liquid chromatography-mass tandem mass spectrometry; (Synergi fusion RP 50 x 2 mm, Phenoenex, Torrance, Calif.), Using a 1290 HPLC (Agilent Technologies, Palo Alto, CA), Qtrap 5500 (AB Sciexm Concord, Ontrario, Production was measured.

3 μL was injected into the LC-MS / MS system and ionized with a trubo spary ionization source. 5 mM ammonium acetate in H ₂ O and 5 mM ammonium acetate in methanol were used as mobile phases A and B, respectively. The separation gradient was as follows: 0% B for 5 min, 0% to 90% B for 2 min, 90 min for 8 min, 90% to 0% B for 1 min and 0% B for 9 min. LC flow was 70 uL / min except for 140 uL / min between 7-15 min, and the column temperature was maintained at 23. Multiple reaction monitoring (MRM) was used in anion mode and extracted ion chromatography (EIC) was used for quantification consistent with specific transitions of each metabolite. The area under the curve of each EIC was standardized for the EIC of the internal standard and the peak area ratio for each internal standard of each metabolite was standardized using the protein content determined by Bradford analysis (Bio-Rad) on the sample, It was used for comparison.

In addition, the change in gene expression was confirmed by performing qRT-PCR on the radiation therapy resistant relapse cancer model prepared in Example 1. Specifically, RNA in cells prepared and cultured by the method of Example 1 was extracted using a PureLink ^™ RNA mini kit (Thermo-Fisher Scientific), and the cDNA was amplified using the First-Strand cDNA Synthesis Kit by reverse transcription-polymerase chain reaction -PCR: iNtRON Biotechnology). SYBR Green Master Mix (Applied Biosystems, Branchburg, NY) was used in qPCR. All reactions were performed in 96-well plates three times and the mean values were used to calculate mRNA expression. qPCR was performed using an Applied Biosystems Prism 7500 Sequence Detection System (Applied Biosystems).

denomination The sequence (5 '> 3') Tm (占 폚) Cycles SEQ ID NO: GLUT1_F CTTTGTGGCCTTCTTTGAAG 60 40 3 GLUT1_R CCACACAGTTGCTCCACAT 60 40 4 GLUT3_F CGGCTTCCTCATTACCTTC 60 40 5 GLUT3_R GGCACGACTTAGACATTGG 60 40 6 HKII_F CAAAGTGACAGTGGGTGTGG 60 40 7 HKII _R GCCAGGTCCTTCACTGTCTC 60 40 8 PFK_F GGATTACTGACCGCCTCTTTAGTT 60 40 9 PFK_R GCATTCCGTGAATTGTCCATC 60 40 10 LDHA_F ACAACAGGATTCTAGGTGGAGGTT 60 40 11 LDHA_R GAGTTGATGTTTTTCCCAGTCCAT 60 40 12 b-actin-F AGATGACCCAGATCATGTTTGAGA 60 40 13 b-actin_R ATAGGGACATGCGGAGACCG 60 40 14

As a result, as shown in FIG. 8 to FIG. 9, there was no change in the production of intermediates and the expression of enzymes related to the glucose metabolism during the glucose metabolism in the R cell line of p53 wild type, Mutant or absent R cells were significantly increased in the production of G6P / F6P and 3PG intermediates in the glucose metabolism than in the parental cells. The R cell line of the p53 mutant or absent type showed a higher glucose metabolism Gene expression of Glut1, Glu3, HKII, and LDHA, the enzymes involved in the process, also increased significantly.

Based on the results of Example 3 above, it can be seen that the metabolic remodeling of the p53 mutant or non-p53 cell line was increased by acquiring radiation resistance as compared with the p53 wild type cell line.

Example  4. Identification of changes in function and morphology of mitochondria

4-1: Oxygen consumption rate (OCR: O ₂  consumption rate

Compared with the p53 wild-type cell line, the p53 mutant or absent cell line was increased by increasing the resistance to radiation, and thus the oxygen consumption rate was increased according to the increase in the number of days.

이며, CO2가 없는 배양기에서 하루밤 배양시켰다. 분석 당일 웰당 2 X 10⁴ 세포가 되게 심은 다음 24 웰 플레이트를 37

이며, CO2가 없는 배양기에서 1시간 배양하였다. Seahorse XF-24 분석기의 프로그램은 제조업체에서 제공된 지침에 따라 설정하였다. 또한 OCR은 pmol/min로 표현하였다. Micro BCA protein assay kit (Thermo-Fisher Scientific)을 이용하여 각 웰에 대한 단백질 농도를 측정하여 단백질 농도로 보정하였다.Specifically, the oxygen consumption rate (OCR) was measured using an XF-24 extracellular flux analyzer (Seahorse Bioscience, North Billerica, MA, USA). Before assaying, add 1 ml of Seahorse Bioscience XF-24 Calibrant solution per well to the cartridge sensor.

, And incubated overnight in a CO2 free incubator. The cells were seeded to 2 X 10 ⁴ cells per well on the day of analysis,

, And cultured in a CO2-free incubator for 1 hour. The program of the Seahorse XF-24 analyzer was set according to the instructions provided by the manufacturer. The OCR was expressed in pmol / min. Protein concentrations were measured for each well using Micro BCA protein assay kit (Thermo-Fisher Scientific) and corrected for protein concentration.

Oligomycin inhibits ATP synthesis by blocking the proton channel of the F0 partial ATP synthase of mitochondria and Carbonyl cyanide p-trifluoromethoxyphenenylhydrazone (FCCP) transports hydrogen ions across the proton channels of ATP synthase to interfere with ATP synthesis It acts as an uncoupling and plays a role in increasing OCR or ECAR by rapidly consuming energy and oxygen without producing mitochondrial ATP. Rotenone prevents the transfer of electrons from FMN to CoQ, which is the first to accept electrons and protons from NADH It inhibits both oxygen and ATP production, and Antimycin A inhibits both oxygen and ATP production by blocking the movement of electrons from cyt b to cyt c1.

As a result, as shown in Fig. 11, the p53 wild-type R cell line exhibited the maximum oxygen consumption (the maximum oxygen consumption was the difference in the OCR value when the rotenone / antimycin A was treated at the OCR value when FCCP was treated) , But it was confirmed that the maximum amount of oxygen consumption was significantly lower in the p53 mutant or absent R cell line than that of the parent cell.

4-2: Observation of mitochondrial morphology

It is known that the morphological changes of the mitochondria are closely related to the function of the mitochondria and maintenance of their homeostasis, and the morphological changes of the mitochondria are induced by the radiation stress. Therefore, whether or not the p53 mutant or non-p53 mutant cell line was increased compared to the parent cell through mitochondrial damage by radiation was confirmed by the following method.

Specifically, cells were fixed with 2.5% (v / v) glutaraldehyde in 150 mM cacodylate buffer, exposed to 2% (w / v) osmium tetroxide for 1 hour at 4 ° C, acetate was used for block staining. Then, dehydrated in an ethanol series (70, 80, 90, 96, 100% ethanol) and impregnated with spurr's resin series (Spurr / ethanol 1: 1, 2: 1, 100%, Sigma-aldrich EM0300) For 8 hours. Embedded cells were cut with a diamond knife in an ultramicrotome (MTX-L, RMC). The sections were directly mounted on 150 mesh copper grids (Gilder, G200), stained with 50% (v / v) methanol, 2% (w / v) uranyl acetate for 20 min and stained with Reynold's lead citrate for 10 min. Grids were observed at a magnification of 2 μm using a JEOL JEM1400 electron microscope (FRED HUTCH Research Institute, Seattle, Wash.) At 120 kV.

As a result, as shown in Fig. 12, the ratio of abnormal mitochondria among the whole mitochondria was about two times higher than that of the parental cells of the R cell line without p53.

4-3: Mass of mitochondria and ROS  (Reactive oxygen species)

The quantitative changes of mitochondrial mass and ROS produced only in mitochondria were confirmed in order to confirm the change of function of cancer cell mitochondria by irradiation. Although the function of mitochondrion was inhibited in cells expressing p53 null form However, in order to confirm whether or not ATP is maintained through the glycolysis shift, an experiment for confirming total ATP expression level was performed as follows.

Specifically, MitoTracker Green FM (Invitrogen) was injected into a cancer cell culture medium cultivated in the same manner as in Example 1 at a concentration of 200 nM, and cultured at 37 for 20 minutes. Then, a fluorescence activated flow cytometer FACScan; Becton Dickinson, Franklin Lakes, NJ). The amount of ROS produced in the mitochondria was measured by FACScan using the method provided by the manufacturer and the MitoSOX ™ Red Mitochondrial Superoxide Indicator (Thermo-Fisher) was injected into the mitochondrial ROS at a concentration of 5 μM.

In addition, ATP assay kit (Biovision, K354-100) was used to confirm ATP production by the manufacturer.

As a result, as shown in Figs. 13 to 14, the amount of mitochondria per cell and ROS produced in intracellularly produced mitochondria in the R cell line of the p53 mutant type increased 1.3-fold compared to that of the parental cells, whereas the p53 wild type R The cell line did not show a significant increase compared to the parental cells.

In addition, total ATP production was not significantly different between the p53 wild type and the non - surviving R cell line and each parental cell line.

Example  5. p53 mutation and mitophagy  Occurrence of

5-1: Mitophagy  Measurement of occurrence of

The following experiment was carried out to confirm that the occurrence of mitophagy increases due to the morphological and functional abnormality of mitochondria in the process of acquiring radiation resistance of p53 mutant cancer cells.

Specifically, cancer cells were cultured in the same manner as in Example 1-1, and cancer cells were irradiated with 4 Gy of radiation using an X-RAD 320 irradiator (Precision X-ray Inc., North Branford, CT). To perform Western blotting, intracellular proteins were extracted with RIPA buffer containing protease and phosphatase inhibitor (Thermo Scientific, Rockford, IL) and quantified using a Bradford protein assay kit (Bio-Rad, Hercules, CA) Respectively. 20 ug of protein was separated using 10-13% SDS-polyacrylamide gel. (TBST) containing 5% (w / v) bovine serum albumin (BSA, Bio-world, Dublin, OH) in 1X TBS after transfection on nitrocellulose membrane (Amersham International Plc., Little Chalfont, UK) (Ser65) (ab154995), and the primary antibody was cultured for 50 minutes (Cell signaling Larboratories, Danvers, MA: phospho-p53 Sigma-Aldrich, St. Louis, Mo.), parkin (ab15954) and Bnip3 (ab10433); Santa Cruz Biotechnologies, La Jolla, CA; p53 (sc- MO: beta-actin (A5441)). Membrane was washed with TBST and then added with a secondary antibody (anti-rabbit anti-rabbit IgG HRP conjugate; Bethyl Laboratories, Inc., Montgomery, TX). After washing with TBST, the cells were developed using SuperSignal®West Pico Trial kit (Thermo-Fisher Scientific, Rockford, IL).

On the other hand, when cells are damaged due to radiation stress, depolarized mitochondria are generated and mitophagy is induced.

The first is a Parkin-dependent mitophagy that activates PINK1 (PTEN-induced putative kinase 1) and induces mitophagy by phosphorylating Ser65 of the N-terminal ubiquitin ligase domain of Parkin and Ser65 of Ubiquitin. Therefore, the phosphorylation of Parkin Ser54 and the increase of the amount of phosphorylation of Ubiquitin Ser65 can be confirmed to confirm the induction of mitophagy.

Secondly, it is possible to confirm the induction of mitophagy by confirming the increase of Bnip3 expression by Parkin's independent mitophagy.

Third, mitochondria are reduced by mitophagy induction. Mitochondria reduction is confirmed by reduction of Tom20 expression, and mitophagy is induced.

As a result, as shown in FIG. 15, the expression of mitophagy (phosphor-Parkin, or Bnip3) was observed in p53 wild type (HN30) and p53 non-existing (UMSCC1) The expression of Bnip3 and p-Parkin increased 4.2-fold and 4.7-fold, respectively, and the expression of Tom20 was decreased 0.5-fold by irradiation. However, the expression of p53-noninfected (UMSCC1) The expression of Bnip3, p-Parkin and Tom20 could not be detected.

5-2: Mitophagy  Changes in flux

In Example 5-1, it was confirmed that mitochondrial division and mitophagy were increased due to morphological and functional abnormalities of mitochondria in the process of acquiring radiation resistance of p53 mutant cancer cells. The mitophag y In order to quantitatively analyze the evolution of mitophagy, mitophagy was inhibited by treatment with lysosome inhibitor and mitophagy inhibitor, and mitophagy flow was increased by increasing the amount of mitochondria by CCCP. .

Specifically, the cancer cells prepared and cultured in the same manner as in Example 1 were treated with 10 nM MitoTracker Deep Red (Invitrogen, M22426), cultured at 37 ° C for 15 minutes, washed with PBS, and washed with 30 μM CQ ) Or 5 uM CsA (cyclosporine A, mitophagy inhibitor) was treated for 3 hours and the amount of MitoTracker Deep Red changed after 6, 20 hours of treatment with CCCP (carbonyl cyanide m-chlorophenyl hydrazine) , And the measurement was performed using FACScan.

The mitochondrial membrane potential, which is decreased during mitophagy induction, was measured by FACScan using MitoTracker Deep Red. In this case, MitoTracker Deep Red when the lysosome inhibitor and mitophagy inhibitor were present compared with the absence of the lysosome inhibitor and mitophagy inhibitor The ratio of the measured value of red was normalized by control to confirm the increase or decrease of mitophagy flux.

As a result, as shown in Fig. 16, the mitophagy flux was increased only in the p53 wild-type (HN30) cell line after irradiation, and in the p53 non-existing (UMSCC1) cell line, a significant change in the mitophagy flux Not observed.

5-3: After p53 knockdown Mitophagy  Of expression

After reduction of p53 expression in p53 wild-type cancer cells, mitophagy Of wild-type cancer cells was compared with that of p53 wild-type cancer cells.

Specifically, On-target plus smart pool p53 and non-targeting siRNA were purchased from Darmacon (Lafayette, CO). HN30 or UMSCC1 cells cultured in the same manner as in Example 1 were seeded in a medium without antibiotics 24 hours before transiently transfection of siRNAs using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, Calif.). On-target plus smart pools containing the siRNAs listed in Table 2 below or non-targeting siRNAs were treated 48 hours later with 4 Gy of radiation and then sampled every 6, 12, and 24 hours for Western blotting and immunofluorescence staining immunofluocrescence.

In the case of immunofluorescence, the sampled cells were fixed in 3.7% formaldehyde (Sigma-Aldrich) for 15 minutes, and then 0.1% (v / v) triton-X 100 (Sigma-Aldrich) for 10 minutes. Cells were washed 3 times with PBS, blocked with 1% (w / v) BSA for 1 hour, and incubated with Tom20 (Santa Cruze, sc-17764) and LAMP2 (Abcam, ab25631) Or mouse Alexa-Fluor-488- and Alexa-Fluor-633-conjugate secondary antibodies (Life Technologies) for 1 hour. After washing with PBS, 10 μg / ml DAPI (Sigma) was stained for 5 minutes, and the slides were mounted with a fluorescent solution (Dako Cytomation, Carpinteria, CA). For imaging, we used confocal laser microscopy (Leica, St-Gallen, Switzerland) according to the manufacturer's method.

denomination The sequence (5 '> 3') SEQ ID NO: p53 siRNA # 1 GAAAUUUGCGUGUGGAGUA 15 p53 siRNA # 2 GUGCAGCUGUGGGUUGAUU 16 p53 siRNA # 3 GCAGUCAGAUCCUAGCGUC 17 p53 siRNA # 4 GGAGAAUAUUUCACCCUUC 18 Non-targeting siRNA UGGUUUACAUGUCGACUAA 19

As a result, as shown in Figs. 17 to 18, reduction of p53 expression in p53 wild-type cancer cell line (HN30) using siRNA, and then irradiation, inversely reduces the occurrence of mitophagy after irradiation in p53 wild-type cancer cells .

As shown in Fig. 19, when the p53 gene was transfected into the p53 non-cancerous cancer cell (UMSCC1) in the same manner as in Example 1-4 and irradiated with radiation, the mitochondrial And the expression of p53 gene was increased.

<110> THE ASAN FOUNDATION          University of Ulsan Foundation for Industry Cooperation <120> Biomarker for therapy of recurrent cancer after radiation          treatment <130> DPP20165083KR <160> 19 <170> KoPatentin 3.0 <210> 1 <211> 393 <212> PRT <213> Homo sapiens <400> 1 Met Glu Glu Pro Gln Ser Asp Pro Ser Val Glu Pro Pro Leu Ser Gln   1 5 10 15 Glu Thr Phe Ser Asp Leu Trp Lys Leu Leu Pro Glu Asn Asn Val Leu              20 25 30 Ser Pro Leu Pro Ser Gln Ala Met Asp Asp Leu Met Leu Ser Pro Asp          35 40 45 Asp Ile Glu Gln Trp Phe Thr Glu Asp Pro Gly Pro Asp Glu Ala Pro      50 55 60 Arg Met Pro Glu Ala Ala Pro Arg Val Ala Pro Ala Pro Ala Ala Pro  65 70 75 80 Thr Pro Ala Ala Pro Ala Pro Ala Pro Ser Trp Pro Leu Ser Ser Ser                  85 90 95 Val Ser Ser Gln Lys Thr Tyr Gln Gly Ser Tyr Gly Phe Arg Leu Gly             100 105 110 Phe Leu His Ser Gly Thr Ala Lys Ser Val Thr Cys Thr Tyr Ser Pro         115 120 125 Ala Leu Asn Lys Met Phe Cys Gln Leu Ala Lys Thr Cys Pro Val Gln     130 135 140 Leu Trp Val Asp Ser Thr Pro Pro Gly Thr Arg Val Arg Ala Met 145 150 155 160 Ala Ile Tyr Lys Gln Ser Gln His Met Thr Glu Val Val Arg Arg Cys                 165 170 175 Pro His His Glu Arg Cys Ser Asp Ser Asp Gly Leu Ala Pro Pro Gln             180 185 190 His Leu Ile Arg Val Glu Gly Asn Leu Arg Val Glu Tyr Leu Asp Asp         195 200 205 Arg Asn Thr Phe Arg His Ser Val Val Val Pro Tyr Glu Pro Pro Glu     210 215 220 Val Gly Ser Asp Cys Thr Thr Ile His Tyr Asn Tyr Met Cys Asn Ser 225 230 235 240 Ser Cys Met Gly Gly Met Asn Arg Arg Pro Ile Leu Thr Ile Ile Thr                 245 250 255 Leu Glu Asp Ser Ser Gly Asn Leu Leu Gly Arg Asn Ser Phe Glu Val             260 265 270 His Val Cys Ala Cys Pro Gly Arg Asp Arg Arg Thr Glu Glu Glu Asn         275 280 285 Leu Arg Lys Lys Gly Glu Pro His His Glu Leu Pro Pro Gly Ser Thr     290 295 300 Lys Arg Ala Leu Ser Asn Asn Thr Ser Ser Ser Pro Gln Pro Lys Lys 305 310 315 320 Lys Pro Leu Asp Gly Glu Tyr Phe Thr Leu Gln Ile Arg Gly Arg Glu                 325 330 335 Arg Phe Glu Met Phe Arg Glu Leu Asn Glu Ala Leu Glu Leu Lys Asp             340 345 350 Ala Gln Ala Gly Lys Glu Pro Gly Gly Ser Ser Ala His Ser Ser His         355 360 365 Leu Lys Ser Lys Lys Gly Gln Ser Thr Ser Arg His Lys Lys Leu Met     370 375 380 Phe Lys Thr Glu Gly Pro Asp Ser Asp 385 390 <210> 2 <211> 2451 <212> DNA <213> Homo sapiens <400> 2 cgtgctttcc acgacggtga cacgcttccc tggattggcc agactgcctt ccgggtcact 60 gccatggagg agccgcagtc agatcctagc gtcgagcccc ctctgagtca ggaaacattt 120 tcagacctat ggaaactact tcctgaaaac aacgttctgt cccccttgcc gtcccaagca 180 atggatgatt tgatgctgtc cccggacgat attgaacaat ggttcactga agacccaggt 240 ccagatgaag ctcccagaat gccagaggct gctccccgcg tggcccctgc accagcagct 300 cctacaccgg cggcccctgc accagccccc tcctggcccc tgtcatcttc tgtcccttcc 360 cagaaaacct accagggcag ctacggtttc cgtctgggct tcttgcattc tgggacagcc 420 aagtctgtga cttgcacgta ctcccctgcc ctcaacaaga tgttttgcca actggccaag 480 acctgccctg tgcagctgtg ggttgattcc acacccccgc ccggcacccg cgtccgcgcc 540 atggccatct acaagcagtc acagcacatg acggaggttg tgaggcgctg cccccaccat 600 gagcgctgct cagatagcga tggtctggcc cctcctcagc atcttatccg agtggaagga 660 aatttgcgtg tggagtattt ggatgacaga aacacttttc gacatagtgt ggtggtgccc 720 tatgagccgc ctgaggttgg ctctgactgt accaccatcc actacaacta catgtgtaac 780 agttcctgca tgggcggcat gaaccggagg cccatcctca ccatcatcac actggaagac 840 tccagtggta atctactggg acggaacagc tttgaggtgc atgtttgtgc ctgtcctggg 900 agagaccggc gcacagagga agagaatctc cgcaagaaag gggagcctca ccacgagctg 960 cccccaggga gcactaagcg agcactgtcc aacaacacca gctcctctcc ccagccaaag 1020 aagaaaccac tggatggaga atatttcacc cttcagatcc gtgggcgtga gcgcttcgag 1080 atgttccgag agctgaatga ggccttggaa ctcaaggatg cccaggctgg gaaggagcca 1140 ggggggagca gggctcactc cagccacctg aagtccaaaa agggtcagtc tacctcccgc 1200 cataaaaaac tcatgttcaa gacagaaggg cctgactcag actgacattc tccacttctt 1260 gttccccact gacagcctcc cacccccatc tctccctccc ctgccatttt gggttttggg 1320 tctttgaacc cttgcttgca ataggtgtgc gtcagaagca cccaggactt ccatttgctt 1380 tgtcccgggg ctccactgaa caagttggcc tgcactggtg ttttgttgtg gggaggagga 1440 tggggagtag gacataccag cttagatttt aaggttttta ctgtgaggga tgtttgggag 1500 atgtaagaaa tgttcttgca gttaagggtt agtttacaat cagccacatt ctaggtaggg 1560 gcccacttca ccgtactaac cagggaagct gtccctcact gttgaatttt ctctaacttc 1620 aaggcccata tctgtgaaat gctggcattt gcacctacct cacagagtgc attgtgaggg 1680 ttaatgaaat aatgtacatc tggccttgaa accacctttt attacatggg gtctagaact 1740 tgaccccctt gagggtgctt gttccctctc cctgttggtc ggtgggttgg tagtttctac 1800 agttgggcag ctggttaggt agagggagtt gtcaagtctc tgctggccca gccaaaccct 1860 gtctgacaac ctcttggtga accttagtac ctaaaaggaa atctcacccc atcccacacc 1920 ctggaggatt tcatctcttg tatatgatga tctggatcca ccaagacttg ttttatgctc 1980 agggtcaatt tcttttttct tttttttttt ttttttcttt ttctttgaga ctgggtctcg 2040 ctttgttgcc caggctggag tggagtggcg tgatcttggc ttactgcagc ctttgcctcc 2100 ccggctcgag cagtcctgcc tcagcctccg gagtagctgg gaccacaggt tcatgccacc 2160 atggccagcc aacttttgca tgttttgtag agatggggtc tcacagtgtt gcccaggctg 2220 gtctcaaact cctgggctca ggcgatccac ctgtctcagc ctcccagagt gctgggatta 2280 caattgtgag ccaccacgtc cagctggaag ggtcaacatc ttttacattc tgcaagcaca 2340 tctgcatttt caccccaccc ttcccctcct tctccctttt tatatcccat ttttatatcg 2400 atctcttatt ttacaataaa actttgctgc caaaaaaaaa aaaaaaaaaa a 2451 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GLUT1_F <400> 3 ctttgtggcc ttctttgaag 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GLUT1_R <400> 4 ccacacagtt gctccacat 19 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GLUT3_F <400> 5 cggcttcctc attaccttc 19 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GLUT3_R <400> 6 ggcacgactt agacattgg 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HKII_F <400> 7 caaagtgaca gtgggtgtgg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HKII_R <400> 8 gccaggtcct tcactgtctc 20 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PFK_F <400> 9 ggattactga ccgcctcttt agtt 24 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PFK_R <400> 10 gcattccgtg aattgtccat c 21 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> LDHA_F <400> 11 acaacaggat tctaggtgga ggtt 24 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> LDHA_R <400> 12 gagttgatgt ttttcccagt ccat 24 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > b-actin-F <400> 13 agatgaccca gatcatgttt gaga 24 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> B-actin-R <400> 14 atagggacat gcggagaccg 20 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> p53 siRNA # 1 <400> 15 gaaauuugcg uguggagua 19 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> p53 siRNA # 2 <400> 16 gugcagcugu ggguugauu 19 <210> 17 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> p53 siRNA # 3 <400> 17 gcagucagau ccuagcguc 19 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> p53 siRNA # 4 <400> 18 ggagaauauu ucacccuuc 19 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Non-targeting siRNA <400> 19 ugguuuacau gucgacuaa 19

Claims (20)

Confirming the mutation of the amino acid sequence or gene sequence of the p53 protein in the surviving cancer cells after radiation irradiation separated from the patient,
The mutation of the amino acid sequence of the p53 protein does not induce Parkin activation or Bnip3 expression,
2) the amino acid is not expressed from the 293rd amino acid glycine in the amino acid sequence of the p53 protein of SEQ ID NO: 1;
3) the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is substituted with a tryptophan amino acid residue; or
4) A method for producing a glycoprotein which is suitable for administration of a sugar metabolism target drug, characterized in that the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is substituted with a tryptophan amino acid residue and the amino acid is not expressed from glycine, A method of providing information for identifying a patient with a recurrence-resistant cancer. delete delete The method of claim 1, wherein the cancer cells are squamous cell carcinoma or squamous cell carcinoma arising in an upper respiratory or upper gastrointestinal tract. 2. The method of claim 1, wherein the sugar metabolite target drug inhibits the process (Glycolysis). 6. The method of claim 5, wherein the sugar metabolizing target drug is 2-Deoxy-D-glucose (2-DG) or (R) -1,1 ', 6,6', 7,7'-Hexahydroxy- -dimethyl-5,5'-bis (1-methylethyl) - [2,2'-binaphthalene] -8,8'-dicarboxaldehyde (AT101). A composition for the prophylaxis or treatment of radiation therapy-resistant recurrent cancer comprising a glucose metabolism target drug, said radiation therapy-resistant recurrent cancer comprising a mutation in the amino acid sequence of the p53 protein,
The mutation of the amino acid sequence of the p53 protein does not induce Parkin activation or Bnip3 expression,
2) the amino acid is not expressed from the 293rd amino acid glycine in the amino acid sequence of the p53 protein of SEQ ID NO: 1;
3) the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is substituted with a tryptophan amino acid residue; or
4) A method for treating cancer, comprising administering to a subject a radiation therapy comprising a sugar metabolizing target drug, wherein the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is substituted with a tryptophan amino acid residue and the amino acid is not expressed from glycine, A composition for preventing or treating resistance to recurrent cancer. delete delete 8. The composition of claim 7, wherein the cancer is squamous cell carcinoma or squamous cell carcinoma arising in an upper respiratory or upper gastrointestinal tract. 8. The composition of claim 7, wherein the sugar metabolite target drug inhibits the process (Glycolysis). 12. The method of claim 11, wherein the sugar metabolism target drug is 2-Deoxy-D-glucose (2-DG) or (R) -1,1 ', 6,6', 7,7'-Hexahydroxy- -dimethyl-5,5'-bis (1-methylethyl) - [2,2'-binaphthalene] -8,8'-dicarboxaldehyde (AT101). an agent for detecting an amino acid sequence mutation of a p53 protein,
The mutation of the amino acid sequence of the p53 protein does not induce Parkin activation or Bnip3 expression,
2) the amino acid is not expressed from the 293rd amino acid glycine in the amino acid sequence of the p53 protein of SEQ ID NO: 1;
3) the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is substituted with a tryptophan amino acid residue; or
4) A method for producing a glycoprotein which is suitable for the administration of a sugar metabolizing target drug, characterized in that the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is substituted with a tryptophan amino acid residue and the amino acid is not expressed from the 293rd amino acid glycine A composition for identifying a patient suffering from resistance to recurrent cancer. 14. The composition of claim 13, wherein the agent for detecting a mutation in the amino acid sequence or gene sequence of the p53 protein is a substance that interacts with a p53 protein or a protein encoding the p53 protein. 15. The method of claim 14, wherein the agent for detecting the mutation of the amino acid sequence of the p53 protein comprises a chemical, small molecule, protein, peptide, nucleic acid molecule (polynucleotide, oligonucleotide, , And the like), and antibodies. 15. The method according to claim 14, wherein the substance interacting with the gene encoding the p53 protein is selected from the group consisting of a specifically binding primer, a probe, an extramer, and an antisense oligonucleotide that specifically binds to a gene encoding the p53 protein &Lt; RTI ID = 0.0 &gt; 1, &lt; / RTI &gt; delete delete An agent for detecting a mutation in the amino acid sequence of a p53 protein,
The mutation of the amino acid sequence of the p53 protein does not induce Parkin activation or Bnip3 expression,
2) the amino acid is not expressed from the 293rd amino acid glycine in the amino acid sequence of the p53 protein of SEQ ID NO: 1;
3) the arginine residue, which is the 282nd amino acid in the amino acid sequence of the p53 protein of SEQ ID NO: 1, is substituted with a tryptophan amino acid residue; or
4) In the amino acid sequence of p53 protein of SEQ ID NO: 1, the arginine residue, which is the 282nd amino acid, is replaced with a tryptophan amino acid residue and the amino acid is not expressed from the 293rd amino acid glycine. Of the amino acid sequence of SEQ ID NO. delete

Images