KR101935676B1 - Novel DEH reductase protein and uses thereof - Google Patents

Abstract

The present invention relates to a novel DEH reductase protein and a use thereof, and more particularly to a KDH (2-keto (2-keto -3-deoxy-gluconate, KDG and lactic acid.
The DEH reductase protein VsRed protein according to the present invention can convert DEH into KDG, and thus can be usefully used for biochemical or bioenergy production.

Description

Novel DEH reductase protein and uses thereof < RTI ID = 0.0 >

The present invention relates to a novel DEH (4-deoxy-L-erythro-hexoseulose uronic acid) reductase protein and its use, and more particularly to a DEH Compositions for the preparation of KDG (2-keto-3-deoxy-gluconate) containing a reducing enzyme protein, and methods for producing KDG and lactic acid.

Currently, researches for converting biomass (biomass), such as plants, microorganisms, and animals, into bio-energy or biochemicals are being actively conducted. Bio-energy is becoming a new and renewable energy source because it emits less carbon dioxide than fossil fuels. Alternative energy such as sunlight, tidal power and wind power makes it difficult to cope with growing energy demand. It has the advantage of being able to mass produce quickly. Accordingly, many studies for producing biofuel have been made. For example, a method for producing bioethanol using a recombinant microorganism capable of using pentose sugar (Korean Patent Laid-Open No. 10-2017-0025790) has been developed .

In addition, unlike compounds produced by chemical processes, biomass produced from biomass does not produce toxic substances or environmental pollutants as by-products, and biochemicals with high added value can be produced from biomass. Interest is growing.

Among biomass resources that can be developed as bio-energy or biomolecules, marine-derived biomass is seen as a useful resource for the production of environmentally friendly bio-energy and chemicals. Among marine-derived biomass, brown algae are fast growing, uncompetitive with conventional food resources, and highly productive per unit area, and thus are highly likely to be used as new biomass.

In this connection, alginic acid derived from brown algae is a complex sugar polymer having a combination of? -D-guluronate and? -L-mannuronate, and has been widely used since ancient times due to its unique physical properties. For example, alginic acid is used as a stabilizer, a viscous agent, a food or beverage, a paper or a print, and is used as a matrix carrier in a drug delivery system or tissue engineering by a gelling agent, a microparticle, a bead, a microcapsule, have.

In order to use alginic acid in brown algae as bio-energy or a biocomponent, alginate degrading enzyme which decomposes alginic acid, which is a refractory sugar, into monosaccharides is necessary. Unsaturated monosaccharides degraded by alginate degradation enzymes are spontaneously converted to 4-deoxy-L-erythro-hexoseulose uronic acid (DEH), which is reduced by DEH reductase to KDG (2-keto-3-deoxy-gluconate ) And then metabolized to glyceraldehyde-3-phosphate and pyruvate via the Entner-Doudoroff pathway. However, DEH can not be effectively used because it is very limited to discover and utilize DEH reductase as a general industrial strain.

That is, DEH reductase, which is an important enzyme for manipulating the metabolism so that it can use biodegradable alginate for the production of biochemicals or bioenergy, is derived from various bacteria such as A1-R, A1-R ', FlRed and HdRed Of DEH-specific reductases have been reported, but the number of DEH-specific reductases has been limited. In addition, the introduction of a chemical method to solve these problems has been problematic in that it is not environmentally friendly.

Under these circumstances, the inventors of the present invention have made extensive efforts to develop a method for utilizing alginic acid as a raw material for the production of a biocomponent or bioenergy. As a result, Vibrio splendidus ) converts DEH to KDG in a NADPH-dependent manner, and by using it, it is confirmed that DEH can be converted to lactic acid. Thus, the VsRed protein can be converted into a biocomponent or bioenergy And alginic acid resources can be efficiently utilized. Thus, the present invention has been completed.

One object of the present invention is to provide a composition for the preparation of KDG (2-keto-3-deoxy-gluconate) comprising a 4-deoxy-L-erythro-hexoseulose uronic acid (DEH) reductase protein consisting of the amino acid sequence of SEQ ID NO: .

It is another object of the present invention to provide a process for the preparation of KDG comprising the step of treating the composition with DEH.

It is a further object of the present invention to provide a process for preparing lactic acid comprising treating the composition with DEH to obtain KDG.

One aspect of the present invention for achieving the above object is to provide a recombinant vector comprising KDG (2-keto-3-deoxy-L-erythro- deoxy-gluconate).

The present inventors have developed a method for effectively producing biochemicals or bioenergy using alginic acid derived from brown algae. In carrying out various studies to utilize DEH reductase, the inventors of the present invention have found that when Vibrio spplendi The DEH reductase derived from Vibrio splendidus converts DEH to KDG in a NADPH-dependent manner, and when it is used, it is confirmed that DEH can be converted into lactic acid. By using DEH reductase derived from Vibrio splendidus , And alginic acid resources can be efficiently utilized in the production of biocompounds such as biomass.

The term "4-deoxy-L-erythro-hexoseulose uronic acid reductase" of the present invention is an enzyme involved in the conversion of DEH to KDG, which is importantly involved in the production of biochemicals or bioenergy using alginic acid do.

In the present invention, the DEH reductase may be composed of the amino acid sequence of SEQ ID NO: 1. Since it is not known that a protein consisting of the amino acid sequence of SEQ ID NO: 1 can use DEH as a substrate, and it is not yet known that DEH can be converted into KDG, the protein of SEQ ID NO: Of the present invention as a DEH reductase protein can be said to be the first to be identified by the present inventors.

The sequences used in the present invention are interpreted to include sequences showing substantial identity with the sequences listed in the sequence listing, considering mutations having biologically equivalent activity. The term " substantial identity " means aligning the sequence of the present invention to any other sequence as much as possible, and when the aligned sequence is analyzed using an algorithm commonly used in the art, Means a sequence showing 60% homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90% homology.

Accordingly, an amino acid sequence having high homology with the amino acid sequence of SEQ ID NO: 1, for example, a homology of 70% or more, specifically 80% or more, more specifically 90% or more, Should be interpreted as falling within the scope of the present invention.

Also, the DEH reductase is Vibrio Splendid D. Saunders (Vibrio splendidus ). In the present specification, the DEH reductase derived from Vibrio spplendidus consisting of the amino acid sequence of SEQ ID NO: 1 can be named as a mixture of 'VsRed protein' or 'VsRed'.

In addition, the DEH reductase may be an NADPH-dependent reductase, specifically converting NADPH-dependent DEH to KDG.

The term "NADPH" (nicotinamide adenine dinucleotide phosphate, reduced form) of the present invention refers to a compound used as a cofactor in a redox reaction, and "NADPH-dependent" Means using NADP ⁺ (nicotinamide adenine dinucleotide phosphate) and its reduced form of NADPH as cofactors. Of the known DEH reductases from various microorganisms, the A1-R reductase (Akira Inoue, Mar. Drugs 2015, 13, 493-508) and the like are known as NADPH-dependent reductases.

The term "DEH (4-deoxy-L-erythro-hexoseulose uronic acid)" of the present invention is an alginic acid monomer decomposed from alginic acid and is a compound mainly used as a starting material of a biocomponent or bioenergy production metabolic pathway using alginic acid it means.

The term " KDG (2-keto-3-deoxy-gluconate) " of the present invention means a compound used as an intermediate of a metabolic pathway for production of biochemicals or bioenergy using alginic acid, It is known that DEH is converted to KDG by the metabolic pathway.

The DEH reductase protein provided by the present invention may be prepared by a chemical peptide synthesis method known in the art, or may be prepared by amplifying the gene encoding the DEH reductase protein by PCR (polymerase chain reaction) or by a known method Cloning into an expression vector and expression.

Also, the composition for preparing KDG of the present invention is a microorganism producing the DEH reductase protein; A culture of the microorganism; A disruption of said microorganism or said culture; Or a combination thereof.

In this case, a specific example of the microorganism may be Vibrio splendidus or a transformant capable of producing the protein. Specific examples of the transformant include Escherichia coli ( E. coli), bacterial cells, such as Streptomyces (Streptomyces) spp, Salmonella (Salmonella) sp, Vibrio (Vibrio) spp; Saccharomyces cerevisiae , skiing investigation Schizosaccharomyces < RTI ID = 0.0 > yeast cells such as pombe , Pichia pastoris; Animal cells such as CHO, COS, NSO, and 293; Or plant cells, but is not limited thereto as long as it can produce the DEH reductase protein.

The term " culture " of the present invention means a substance obtained by cultivating the transformant in an artificial controlled environment condition, and " crushed product " means a product obtained by culturing the transformant, And the like. Since the transformant includes the DEH reductase protein according to the present invention, it is obvious that the DEH reductase protein is also contained in the culture of the transformant, the transformant or the disrupted product thereof.

In the present invention, the method for obtaining the culture can be carried out by a method well known in the art. Specifically, the culture is not particularly limited as long as it can be produced by expressing the DEH reductase protein of the present invention, but may be cultured continuously in a batch process or an injection batch or a repeated fed batch process can do.

In addition, the culture may contain suitable carbon sources, nitrogen sources, amino acids, vitamins, etc. necessary for the growth of microorganisms producing the DEH reductase protein, and may also include suitable precursors. The materials may be added to the culture in a manner that is appropriate for the culture in the course of the cultivation, such as, but not limited to, batch, fed or continuous.

In addition, the step of recovering the DEH reductase protein from the culture may be carried out by a method known in the art. Specifically, the recovering method is not particularly limited as long as the recovered DEH reductase protein of the present invention can be recovered, but specifically includes centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, (Eg ammonium sulfate precipitation), chromatography (for example, ion exchange, affinity, hydrophobicity and size exclusion) can be used.

For the purpose of the present invention, the composition may further comprise 4-deoxy-L-erythro-hexoseulose uronic acid (DEH) as a substrate for the protein.

In addition, the composition may further comprise NADPH.

In addition, the composition may further comprise a ^{Li +, Mg 2 +, Ca} 2 +, Na +, K + or a combination thereof. Specifically, it is possible to contain the ions in addition to the compound or combinations thereof known in the art, including, more specifically, LiCl, MgCl _2, CaCl _2, NaCl, but may include as KCl or more combinations thereof, But is not limited thereto.

In one embodiment of the present invention, DEH reductase protein (VsRed protein) derived from Vibrio splendidus was prepared, which was composed of the amino acid sequence of SEQ ID NO: 1, and was found to be coded by the nucleotide sequence of SEQ ID NO: 2 (Example 1). In addition, the VsRed protein has an enhanced enzyme activity when NADPH is used as a cofactor (Table 3, FIGS. 3A and 3B), and when the reaction is performed by adding Na ⁺ , Li ⁺ , K ⁺ (Table 4). As a result of the activity of the transformants expressing the VsRed protein and the enzyme purified only from the VsRed protein in the lysate, the total activity and specific activity of both the lysate and the enzyme were increased, (Table 3). This suggests that the VsRed protein of the present invention can be usefully used for the production of biochemicals or bioenergy using alginic acid.

Another embodiment provides a method for preparing 2-keto-3-deoxy-gluconate (KDG) comprising treating the composition with 4-deoxy-L-erythro-hexoseulose uronic acid (DEH) do.

At this time, the definitions of the terms " DEH " and " KDG " are as described above.

In the present invention, the reaction may be carried out at 25 to 40 ° C, specifically 30 to 40 ° C.

In addition, since the composition includes a transformant comprising a polynucleotide encoding the protein, the method for producing KDG according to the present invention comprises the step of culturing a transformant comprising the polynucleotide encoding the protein As shown in FIG.

At this time, the transformant can be cultured in a medium containing alginic acid, and can be cultured in a medium containing a degrading enzyme specifically degrading alginic acid and alginic acid into DEH. It may also be cultured in a medium containing Na ⁺ , Li ⁺ , K ^+, or a combination thereof, and may be cultured in a medium containing NADPH, but is not limited thereto.

In one embodiment of the present invention, it was confirmed that DEH reductase protein (VsRed protein) derived from Vibrio splendidus only specifically used DEH as a substrate, and that when NADPH was used as a coenzyme, the enzyme activity was superior (Table 3, FIGS. 3A and 3B), and when the reaction was performed by adding ions such as Na ⁺ , Li ⁺ , and K ⁺ , the activity was increased (Table 4). In addition, it was confirmed that the VsRed protein converts DEH to KDG in a NADPH-dependent manner (FIG. 4B). This suggests that the VsRed protein of the present invention can be usefully used for the production of biochemicals or bioenergy using alginic acid.

Another embodiment provides a process for preparing lactic acid comprising treating the composition of the present invention with DEH to obtain KDG.

Specifically, the process for producing lactic acid comprises the steps of: (a) treating the composition of the present invention with DEH (4-deoxy-L-erythro-hexoseulose uronic acid) to obtain KDG; (b) reacting the KDG with a KDG kinase to obtain KDPG (2-keto-3-deoxy-6-phosphogluconate); (c) reacting the KDPG with KDPG aldolase to obtain pyruvic acid; And (d) reacting the pyruvic acid with a lactate dehydrogenase to obtain lactic acid.

At this time, the definitions of the above-mentioned " DEH " or " KDG "

The term " lactic acid " of the present invention is an organic compound having the formula C ₃ H ₆ O ₃ and has been used in various industries. For example, it is used as a syrup for syrups and soft drinks for edible purposes, and also to prevent the propagation of spoilage bacteria at the beginning of fermentation of the mainstream. For industrial use, it is used as a dyestuff releasing agent, a leather demineralizer, a raw material for a synthetic resin, and the like.

The term " KDG kinase " of the present invention is an enzyme that converts KDG to KDPG (2-keto-3-deoxy-6-phosphogluconate).

The term " KDPG (2-keto-3-deoxy-6-phosphogluconate) " of the present invention is a compound used as an intermediate of a biocomponent such as lactic acid using alginic acid or a metabolic pathway for bioenergy production.

The term " KDPG aldolase " of the present invention is an enzyme that converts KDPG to pyruvic acid.

The term " pyruvic acid " of the present invention is an organic compound having the formula CH ₃ COCOOH, which is used as an intermediate for various metabolism.

The term " lactate dehydrogenase " of the present invention is an enzyme that converts pyruvic acid to lactic acid.

In the present invention, the steps (a) to (d) may be performed simultaneously or sequentially.

In one embodiment of the present invention, an enzyme such as DEH reductase protein (VsRed protein) derived from Vibrio spplendida and KDG kinase, KDPG aldolase, and lactate dehydrogenase can be used to convert DEH to lactic acid (Fig. 7). This suggests that the VsRed protein of the present invention can be usefully used for the production of biochemicals such as lactic acid or bioenergy using alginic acid.

The DEH reductase protein VsRed protein according to the present invention can convert DEH into KDG, and thus can be usefully used for biochemical or bioenergy production.

1 is an image showing SDS-PAGE analysis results of VsRed protein, which is a DEH reductase, prepared according to an embodiment of the present invention. Wherein M is a protein marker; Lane 1 is a whole cell; Lane 2 is a cell lysate; And lane 3 means a purified enzyme.
2A is a graph showing the pH-dependent activity of the VsRed protein prepared according to an embodiment of the present invention. The pH was adjusted using a buffer and 20 mM potassium phosphate buffer, 20 mM MOPS buffer, 20 mM HEPES buffer, 20 mM glycine-NaOH buffer was used.
FIG. 2B is a graph showing the temperature-dependent activity of VsRed protein prepared according to one embodiment of the present invention.
FIG. 2C is a graph showing the thermal stability of the VsRed protein prepared according to an embodiment of the present invention. FIG. The thermal stability of VsRed was analyzed by heating at 4 to 50 [deg.] C for 20 minutes.
3A is a graph showing co-factor specificity of VsRed protein prepared according to an embodiment of the present invention. The DEH reduction activity of VsRed protein was confirmed in the presence of NADPH or NADH. Conditions in which only NADH (control of the red circle) and NADPH (control of the blue circle) were present were set as the control group, and NADH or NAPDH; VsRed enzyme; And 1% DEH at 30 ° C were set as a comparative group (NAPH of red circle or NADPH of blue circle).
FIG. 3B is a TLC (thin layer chromatography) result obtained by analyzing co-factor specificity of VsRed protein prepared according to an embodiment of the present invention. + NADH means the case where the enzyme is reacted in the presence of NADH, and + NADPH means the case where the enzyme is reacted in the presence of NADPH. The reaction proceeded at 30 ° C. Each reactant present on the TLC thin film was carbonized by spraying with 10% sulfuric acid dissolved in ethanol.
4A is a mass spectrogram of DEH (m / z 175).
FIG. 4B is a mass spectrogram of the reaction product obtained by reacting the VsRed protein with DEH for 5 minutes, which is prepared according to an embodiment of the present invention. The peaks at m / z 175 and m / z 177 indicate DEH and KDG, respectively.
FIG. 4C is a mass spectrogram of the reaction product obtained by reacting VsRed protein and DEH for 120 minutes, which is prepared according to an embodiment of the present invention. FIG. The peaks at m / z 175 and m / z 177 indicate DEH and KDG, respectively.
5 is an image showing the result of BLAST analysis comparing amino acid sequences between VsRed protein and other NADPH-dependent reductase prepared according to an embodiment of the present invention. At this time, VsRed is Vibrio Splendid di Ranges according to the invention (Vibrio splendidus- derived DEH reductase; VPSDR is a Vibrio parahaemolyticus ( Vibrio parahaemolyticus ) Derived reductase (PDB code 3GUY); AHSDR is a reductase (PDB code 3L6E) derived from Aeromonas hydrophila ; AR-1 refers to a carbonyl reductase (PDB_3AFN) derived from Sphingomonas sp. A1. The Thr-Gly-XXX-Gly-X-Gly motif and the four catalytic amino acids (Asn, Ser, Tyr, and Lys), which are residues between the enzymes, are shown as white circles and black circles, respectively. The positions of ? -strand and ? -helix are indicated by blue arrows and red lines, respectively.
FIG. 6 is a graph showing the in vitro reductase activity of VsRed protein prepared according to an embodiment of the present invention, showing the concentration of NADPH not reacted with the VsRed protein. A is a known SDR enzyme (NCBI accession: EAP95875.1), B is a VsRed protein of the present invention, a black circle means a BSA control curve, and a white circle means a reductase reaction.
FIG. 7 is a graph showing the concentration of lactic acid (L-lactate) produced by the reaction with VsRed protein prepared according to one embodiment of the present invention.

Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited by the following examples.

Example  1. Vibrio Splendidus ( Vibrio splendidus Originating DEH  Use of Reductase Protein

To develop a DEH reductase that can be used in the production of bio-compound or bioenergy, Vibrio Splendid D. Saunders (Vibrio splendidus ) was used.

First, Vibrio splendidus ) was isolated and gDNA was isolated and cloned into the pET21b (+) vector system using the primer shown in Table 1 below.

VsRed primer for cloning primer order SEQ ID NO: VsRed_EcoRI
(Forward) 5'-GGGTCGGGATCCGAATTCAATGATTTTAATCACCG-3 ' SEQ ID NO: 3 VsRed_XhoI
(Reverse) Gt; SEQ ID NO: 4

The cloned recombinant vector was introduced into Escherichia coli to obtain a transformant. VsRed protein was overexpressed in the transformant by treating the transformant with 0.1 mM IPTG for 24 hours. As a result of confirming the presence or absence of protein expression through SDS-PAGE, as shown in FIG. 1, DEH reductase protein (hereinafter referred to as "VsRed protein") derived from Vibrio spplendridus at 24 kDa was in a water-soluble form Respectively.

In addition, the amino acid sequence (SEQ ID NO: 1) and the base sequence (SEQ ID NO: 2) encoding the VsRed protein that confirmed the expression are shown in Table 2 below.

division order SEQ ID NO: Amino acid sequence MILITGSSSGLGAALAKQYANTSNSRQRLMITGRSSQRLAELAKSLPANTVSQACDLCDPQSVSELLDALPETPKLVVHSAGSGYFGKIEQQDPAAISYMLKNNIESSIFLIRELVQRYKDQPVTIAVVMSTAAQGAKAEESTYCAAKWAVKGFIESVRLELKGHPMKIVAVYPGGMATEFWGTSGKAMDTSSFMTAQEAAQMLQQALTSTEHGYVSDITINRG SEQ ID NO: 1 Base sequence atgattttaatcaccggatcaagcagcggtttaggcgcagctttagccaagcaatatgcgaacacatcgaacagccgtcagcgcttaatgatcactggccgcagctcccaacgtttagctgaattagcaaaaagcctgccagcgaatactgttagccaagcctgtgacttgtgtgatccacaatcagtgagcgagttattggatgcgttgcctgaaacaccaaagctggtggttcatagcgcaggcagtgggtacttcggtaaaattgaacaacaagatcccgccgccatcagctacatgctgaaaaacaacatcgagtcttccatctttttgattcgcgagcttgtgcagcgctacaaagatcaacccgtcaccattgctgttgtgatgtcgaccgcggctcaaggcgctaaagcagaagagtctacttactgcgcagccaaatgggcagtaaaaggctttatcgaatcggtcaggttggagctcaaaggtcacccgatgaaaatcgttgcggtttatcccggaggaatggcaaccgagttttggggaaccagcggcaaagcaatggatacttcaagctttatgaccgctcaagaagccgctcaaatgctgcagcaggcgttaaccagcaccgagcatggatatgtgtcagatatcacgataaaccgcggt SEQ ID NO: 2

Example  2. VsRed  Protein Cofactor (co-factor) specificity

First, in order to examine the co-factor specificity of the recombinant VsRed protein prepared in Example 1, DEH reduction activity was measured in the presence of NADH or NADPH. The activity of the lysate (crude enzyme) and purified enzyme (purified enzyme) of the VsRed protein were confirmed. The results are summarized in Table 3.

DEH reduction activity of recombinant VsRed protein Total protein
(mg) Total activity
(Unit)
[NADH / NADPH] Specific activity
(U / mg)
[NADH / NADPH] Purification
(fold)
[NADH / NADPH] Yield
(%)
[NADH / NADPH] VsRed Melt
(Lysate) 155 134.85 / 6355 0.87 / 41 1.0 / 1.0 100/100 Purified enzyme
(Purified enzyme) 26 41.6 / 4576 1.6 / 176 1.8 / 4.29 30.8 / 72

From the results shown in Table 3, it was confirmed that VsRed protein is NADPH-dependent reductase by confirming that the VsRed protein has a better DEH reduction activity when NADPH is present than NADH.

Meanwhile, it was confirmed that the specific activity of the VsRed protein was 176 U / mg. This is three times higher than the inactivity (56.9 U / mg) of the recombinant A1R protein of the Sphingomonas sp. A1 strain, which is known to have the highest enzyme activity among existing NADPH-dependent reductases, It was found that the VsRed protein to be provided had better reducing activity than the conventional reducing enzyme.

Example  3. VsRed  Identification of substrate and ion specificity of protein

First, in order to examine the substrate specificity and ion specificity of the recombinant VsRed protein prepared in Example 1, DEH reduction activity was measured in the presence of each substrate and ion, and the results are summarized in Table 4 below.

Material name Concentration (mM) activation (%) temperament DEH 5 100 α-keto-acid (pyruvate) 5 N.D. Aldose
(glucose, galactose, ribose, arabinose, xylose, 2-deoxy-D-glucose) 5 N.D. Ketose (fructose) 5 N.D. Sugar alcohol
(mannitol, sorbitol) 5 N.D. Carboxylic acid (citrate) 5 N.D. compound
(ion) NaCl One 110 LiCl One 108 KCl One 108 MgCl ₂ One 87 CaCl ₂ One 98 CoCl ₂ One 83 MnCl ₂ One 94 ZnCl ₂ One 18 Ethylenediaminetetraacetic acid One 96 Dithiothreitol One 82

The results of Table 4 indicate that the VsRed protein specifically acts only on DEH and is a substrate for α-keto acid, aldose, sugar alcohol, carboxylic acid and the like , It was confirmed that there was no activity.

Further, while if by the addition of various ions added to the result of the reduction reaction, Na ^+, Li ^+, K ^+, etc. In order to evaluate the effect ion on the recombinant VsRed enzyme activity is increased, the addition of Zn ⁺ , The enzyme activity was significantly lowered.

Example  4. VsRed  Evaluation of protein stability by pH and temperature of protein

Proteins are affected by tertiary structure and enzyme activity depending on pH and temperature. Thus, the optimal pH and optimal temperature of the recombinant VsRed protein prepared in Example 1 were evaluated.

As a result, as shown in FIG. 2, the optimal pH was 7.0 and the optimum temperature was 35 ° C., and it was confirmed that the activity of the enzyme was remarkably reduced when it was allowed to stand at 30 ° C. or more for 20 minutes or more.

This is because, compared with the existing known NAPDH-dependent reductase, 'FlRed protein', exhibiting only 40% of the original activity when incubated at 30 ° C. for 30 minutes or more (Akira Inoue, Mar. Drugs 2015, 13, 493 -508), it was found that the VsRed according to the present invention is excellent in thermal stability.

Example  5. VsRed  Identification of protein enzyme activity

The enzyme activity of the recombinant VsRed prepared in Example 1 was analyzed by UV spectrophotometer and thin layer chromatography (TLC).

As a result, as shown in FIG. 3A, VsRed according to the present invention uses NADPH as a cofactor for reduction of DEH, and the use of NADH is remarkably low. The results are shown in FIG. 3B showing the result of TLC. When NADH is provided as an auxiliary agent, the amount of KDG converted from DEH is extremely small, whereas when NADH is provided as an auxiliary agent, conversion into KDG is relatively small I can confirm that there are many.

In addition, changes in DEH and KDG levels over time were analyzed by MALDI-TOF when the VsRed protein was added to the DEH substrate and NAPDH was added as a cofactor. For reference, the mass spectrogram of the substrate DEH on the MALDI-TOF data is m / z 175 and the mass spectrogram of the reaction product KDG is m / z 177 (Fig. 4A).

As a result, as shown in FIG. 4B, it was confirmed that KDG was generated after 5 minutes of addition of VsRed protein. Also, as shown in FIG. 4C, after 120 minutes, the amount of DEH was decreased while the amount of KDG was relatively increased.

From the above results, it was confirmed that VsRed protein is a DEH reductase that converts DEH to KDG and shows NADPH-dependent activity.

Example  6. VsRed  Of the amino acid sequence of the protein Homology  Confirm

As a result of confirming that the recombinant VsRed protein according to the present invention is a DEH reductase, the sequence homology with other known DEH reductases was confirmed.

Specifically, enzymes belonging to the family of short-chain dehydrogenase / reductase (SDR) were used as a comparison among enzymes having a well-defined structure among various NADPH-dependent DEH reductases. Using the BLAST search of NCBI, Vibrio parahaemolyticus , (VPSDR) derived from Sphingomonas sp. A1., A reducing enzyme (AHSDR) derived from Aeromonas hydrophila , an amino acid of a reducing enzyme (AR-1) derived from Sphingomonas sp. The sequences and homology were compared.

As a result, as shown in FIG. 5, it was confirmed that the amino acid sequence of the VsRed protein has a homology of 20-30%, which is almost the same as that of the above-mentioned other NADPH-dependent DEH reductase. Gly-XXX-Gly-X-Gly 'residues and co-catalytic amino acid residues (Asn, Tyr, Lys And Ser) were conserved in the VsRed protein as well as in other reducing enzymes.

These results indicate that the VsRed protein is a NADPH-dependent DEH reductase that conserves motifs specific for NADPH-dependent reductase.

Example  7. VsRed  Comparison of Reduced Enzyme Activities of Proteins

As the recombinant VsRed protein of the present invention was found to be a DEH reductase, the activity of another known SDR enzyme (NCBI accession: EAP95875.1; hereinafter referred to as 'EAP95875.1 protein') and the reducing enzyme activity were compared.

Specifically, the reaction solution was constituted as shown in Table 5 below and reacted at 230 rpm and 30 ° C for 10 to 50 minutes.

Furtherance Final concentration 1% DEH 0.08% 2. 82 mM NADH or 3 mM NADPH 0.4 mM 20 mM potassium phosphate buffer
(pH 7.0) - Enzyme (protein) 300 [mu] g / ml Final volume 200 μl

EAP95875.1 protein BSA control group Absorbance NADPH
(mM) The reacted NADPH
(mM) Absorbance NADPH (mM) 10 minutes 1.001 0.314 1.037 0.325 -0.012 20 minutes 0.979 0.306 0.024 30 minutes 0.945 0.295 0.018 40 minutes 0.915 0.285 0.028 50 minutes 0.916 0.286 0.028

VsRed protein BSA control group Absorbance NADPH
(mM) The reacted NADPH
(mM) Absorbance NADPH (mM) 10 minutes 1.001 0.313 0.802 0.249 0.065 20 minutes 0.737 0.227 0.103 30 minutes 0.607 0.185 0.129 40 minutes 0.472 0.141 0.173 50 minutes 0.392 0.114 0.199

As a result, as shown in Tables 6 and 7 and FIG. 6, in the case of EAP95875.1 protein, it was confirmed that the amount of NADPH that reacts with the EAP95875.1 protein did not change even when the reaction proceeded.

However, in the case of the VsRed protein, the amount of NADPH that reacts with the VsRed protein significantly increased as the reaction proceeded, and the concentration of NADPH present in the reaction solution at the end of the reaction was significantly decreased.

From the above results, it was confirmed that among the enzymes belonging to the SDR family, enzymes which do not exhibit DEH reductase activity were also present. In contrast, the recombinant VsRed protein of the present invention showed excellent DEH reductase activity.

Example  8. VsReds  Method for producing lactic acid (L-lactate) using protein

In order to confirm whether the recombinant VsRed protein prepared in Example 1 can be used for the production of a biocompound, lactic acid (L-lactate) was prepared using the VsRed protein.

Specifically, the VsReds protein and lactate dehydrogenase (LDH) were isolated from Escherichia coli containing the same. The VsReds protein and LDH were then incubated with a reaction solution containing 2 mM DEH, 2-4 mM NAD (P) H, 2 mM ATP and the appropriate amount of enzyme at 230 rpm and 30 ° C for 40 minutes, And analyzed by high performance liquid chromatography (HPLC).

The enzymes used in this reaction are as follows: KDG kinase, 2-keto-3-deoxy-6-phosphogluconate aldolase, LDH and VsReds (DEH reductase).

As a result, as shown in FIG. 7, it was confirmed that when the DEH and the VsReds protein reacted, the concentration of lactic acid gradually increased as the reaction proceeded. In particular, the conversion of DEH to lactate of the VsReds protein was 81.9%, and other known SDR enzymes, namely, the EAP95875.1 protein (NCAP accession: EAP95875.1, 76.7%) did not produce DEH reductase activity and did not produce lactic acid I can not.

From the above results, it was found that the VsRed protein of the present invention can convert DEH derived from alginic acid into lactic acid, and thus can be usefully used for producing biocompounds having high added value from algae and other biomass.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> University-Industry Cooperation Group of Kyung Hee University <120> Novel DEH reductase protein and uses thereof <130> KPA160778-KR-P1 <150> KR 10-2016-0079004 <151> 2016-06-24 <160> 4 <170> KoPatentin 3.0 <210> 1 <211> 224 <212> PRT <213> Vibrio splendidus <400> 1 Met Ile Leu Ile Thr Gly Ser Ser Ser Gly Leu Gly   1 5 10 15 Lys Gln Tyr Ala Asn Thr Ser Asn Ser Arg Gln Arg Leu Met Ile Thr              20 25 30 Gly Arg Ser Ser Gln Arg Leu Ala Glu Leu Ala Lys Ser Leu Pro Ala          35 40 45 Asn Thr Val Ser Gln Ala Cys Asp Leu Cys Asp Pro Gln Ser Ser Ser      50 55 60 Glu Leu Leu Asp Ala Leu Pro Glu Thr Pro Lys Leu Val Val His Ser  65 70 75 80 Ala Gly Ser Gly Tyr Phe Gly Lys Ile Glu Gln Gln Asp Pro Ala Ala                  85 90 95 Ile Ser Tyr Met Leu Lys Asn Asn Ile Glu Ser Ser Ile Phe Leu Ile             100 105 110 Arg Glu Leu Val Gln Arg Tyr Lys Asp Gln Pro Val Thr Ile Ala Val         115 120 125 Val Met Ser Thr Ala Ala Gln Gly Ala Lys Ala Glu Glu Ser Thr Tyr     130 135 140 Cys Ala Ala Lys Trp Ala Val Lys Gly Phe Ile Glu Ser Val Arg Leu 145 150 155 160 Glu Leu Lys Gly His Pro Met Lys Ile Val Ala Val Tyr Pro Gly Gly                 165 170 175 Met Ala Thr Glu Phe Trp Gly Thr Ser Gly Lys Ala Met Asp Thr Ser             180 185 190 Ser Phe Met Thr Ala Gln Glu Ala Ala Gln Met Leu Gln Gln Ala Leu         195 200 205 Thr Ser Thr Glu His Gly Tyr Val Ser Asp Ile Thr Ile Asn Arg Gly     210 215 220 <210> 2 <211> 672 <212> DNA <213> Artificial Sequence <220> <223> Vibrio splendidus <400> 2 atgattttaa tcaccggatc aagcagcggt ttaggcgcag ctttagccaa gcaatatgcg 60 aacacatcga acagccgtca gcgcttaatg atcactggcc gcagctccca acgtttagct 120 gaattagcaa aaagcctgcc agcgaatact gttagccaag cctgtgactt gtgtgatcca 180 caatcagtga gcgagttatt ggatgcgttg cctgaaacac caaagctggt ggttcatagc 240 gcaggcagtg ggtacttcgg taaaattgaa caacaagatc ccgccgccat cagctacatg 300 ctgaaaaaca acatcgagtc ttccatcttt ttgattcgcg agcttgtgca gcgctacaaa 360 gatcaacccg tcaccattgc tgttgtgatg tcgaccgcgg ctcaaggcgc taaagcagaa 420 gagtctactt actgcgcagc caaatgggca gtaaaaggct ttatcgaatc ggtcaggttg 480 gagctcaaag gtcacccgat gaaaatcgtt gcggtttatc ccggaggaat ggcaaccgag 540 ttttggggaa ccagcggcaa agcaatggat acttcaagct ttatgaccgc tcaagaagcc 600 gctcaaatgc tgcagcaggc gttaaccagc accgagcatg gatatgtgtc agatatcacg 660 ataaaccgcg gt 672 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > VsRed_EcoRI Forward primer <400> 3 gggtcgggat ccgaattcaa tgattttaat caccg 35 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> VsRed_XhoI Reverse primer <400> 4 gtggtggtgg tgctcgagac cgcgg 25

Claims (10)

4-deoxy-L-erythro-hexoseulose uronic acid (DEH) consisting of the amino acid sequence of SEQ ID NO: A composition for the production of 2-keto-3-deoxy-gluconate (KDG) comprising a reducing enzyme protein. 2. The composition of claim 1, wherein the DEH reductase is a NADPH-dependent reductase. The composition of claim 1, wherein the composition comprises a microorganism that produces the DEH reductase protein; His culture; A disruption of said microorganism or said culture; Or a combination thereof. 2. The composition of claim 1, wherein the composition further comprises DEH as a substrate for the protein. 2. The composition of claim 1, wherein the composition further comprises NADPH. The composition of claim 1, wherein the composition further comprises Na ⁺ , Li ⁺ , K ^+, or a combination thereof. A process for the preparation of KDG (2-keto-3-deoxy-gluconate), comprising the step of treating a composition according to any one of claims 1 to 6 with 4-deoxy-L-erythro-hexoseulose uronic acid Gt; The process according to claim 7, wherein the reaction is carried out at 25 to 40 占 폚. (a) treating the composition of any one of claims 1 to 6 with DEH (4-deoxy-L-erythro-hexoseulose uronic acid) to obtain KDG;
(b) reacting the KDG with a KDG kinase to obtain KDPG (2-keto-3-deoxy-6-phosphogluconate);
(c) reacting the KDPG with KDPG aldolase to obtain pyruvic acid; And
(d) reacting the pyruvic acid with a lactate dehydrogenase to obtain lactic acid. 10. The method of claim 9, wherein the steps (a) - (d) are performed simultaneously or sequentially.

Images