KR101924896B1 - Non-antibody protein scaffold based on fibronectin EDB and use thereof - Google Patents

Abstract

The present invention relates to a non-antibody protein scaffold library skeletonized with fibronectin EDB (Extra Domain B) and uses thereof. Furthermore, the present invention relates to a prophylactic, therapeutic or diagnostic agent containing a non-antibody protein scaffold library skeleton of fibronectin EDB.

Description

Non-Antibody Protein Scaffold Libraries with Fibronectin EDB Skeletons and Non-Antibody Protein Scaffold Based on Fibronectin EDB and Use thereof

The present invention relates to a non-antibody protein scaffold library skeletonized with fibronectin EDB (Extra Domain B) and uses thereof. Furthermore, the present invention relates to a prophylactic, therapeutic or diagnostic agent containing a non-antibody protein scaffold library skeleton of fibronectin EDB.

An antibody is an immune protein that binds to an antibody from the outside to interfere with the action of an antigen or to remove an antigen. The antibody can bind to a target substance with high affinity and selectivity, And has been widely recognized as a breakthrough therapeutic agent. Antibodies are composed of two immunoglobulins, heavy chain and light chain, which consist of a constant region and a variable region. Several antibody substitution proteins are recombinant proteins, such as antibodies, that can be made to have constant regions and variable regions. A small portion of a small, stable protein is replaced with a random sequence of amino acids to create a library, which is then screened for target substances, And a material with good specificity. For example, avimers and affibodies among antibody substitution proteins have been reported to have affinities as high as picomoles for the target substance. These antibody-replacing proteins are small in size and stable and can penetrate deep into cancer cells and are generally reported to produce less immune responses. Above all, it can escape from a wide range of antibody patents, and because it can be easily mass-purified from bacteria, it has a lower cost of production and is economically more advantageous than an antibody.

There are currently 40 antibody replacement proteins, but the substitute proteins that are being commercialized by venture companies or multinational pharmaceutical companies include fibronectin type III domain, lipocalin, LDLR-A domain, cristalline, protein A, Ankyrin repeat and BPTI and has a high affinity of several nanometers from the picomole for the target. Among them, Adnectin, Darpin, avimer and Kunitz domains are currently under FDA clinical trials.

Fibronectin (FN) is a glycoprotein, a major component of the extracellular matrix (ECM), and is known to be an important mediator involved in cell differentiation, adhesion, migration, domain and apoptosis . Among them, Human Fibronectin Type III (FN3) has a β-sandwich structure similar to that of immunoglobulin, and is also applied to the production of antibody replacement proteins. Fibronectin EDB (Extra Domain B) has a structure similar to that of FN3, and has been reported to be expressed in blood vessels and extracellular matrix particularly in cancer, and thus has attracted attention as a target in cancer-specific detection and treatment.

Precedent literature

Prior Art 1: Korean Patent Laid-Open No. 10-2013-0056870

It is an object of the present invention to construct a non-antibody protein scaffold library with the framework of Fibronectin EDB (Extra Domain B).

It is another object of the present invention to provide a method for screening non-antibody protein scaffolds in which the non-antibody protein scaffold library of fibronectin with EDB as a framework is reacted with a target molecule and EDB of skeleton of fibronectin having a specific high affinity to the target molecule is skeleton And a non-antibody protein scaffold skeleton of EDB of fibronectin having a specific high affinity to a target molecule selected by the above method.

Another object of the present invention is to provide an expression vector comprising a non-antibody protein scaffold skeleton of EDB of fibronectin having a specific high affinity to a target molecule.

It is still another object of the present invention to provide a method for preventing, detecting, and diagnosing diseases or disorders, particularly cancer and other immune disease-related diseases, which comprises as an active ingredient a non-antibody protein scaffold in which EDB of fibronectin having a specific high- Comprising administering to an animal, preferably a human, an effective amount of a composition for diagnosing, treating, or alleviating the disease, and a non-antibody protein scaffold skeleton of EDB of fibronectin having a specific high affinity for the target molecule, Diagnosing, treating, or alleviating a disease, disorder, particularly cancer and other immune disease-related diseases.

According to a first embodiment,

The present invention relates to a non-antibody protein scaffold library skeleton of fibronectin EDB (Extra Domain B) having the following amino acid sequence,

EVPQLTDLSFVDITDSSIGLRW (X _BC ) IIGYRITVVAAGEGIPIFEDFVD (X _DE ) YYTVTGLEPGIDYDISVITLI (X _FG ) PTTLTQQ

X _BC , X _DE, and X _FG in the above sequence represent BC loop consisting of amino acid sequence of TPLNSST respectively, DE loop consisting of amino acid sequence of SSVG and FG loop consisting of amino acid sequence of NGGESA,

Wherein at least one of the BC loop, the DE loop, and the FG loop is mutated, and discloses a non-antibody protein scaffold library in which EDB is skeleton of fibronectin.

The term " protein scaffold library ", as used herein, refers to a protein library that conserves amino acid sequence regions that confer the typical structural stability of the EDB domain of fibronectin, and that contains a combination of various amino acid sequences Skeletal aggregate. Such a protein backbone library can be prepared by synthesizing various primers and using various techniques such as overlapping PCR, DNA shuffling, error prone PCR, and artificial DNA synthesis. The amplified library can be used as a bacterial phage surface expression vector, a yeast surface expression vector Or an animal cell surface expression vector, transformed, and expressed. The size of the protein skeletal library can not be limited, but the size of the library is limited during transformation, and the library usually has a diversity of 10 ⁷ -10 ¹³ . In the protein skeleton library thus expressed, a specific protein skeletal variant that specifically binds to various target molecules can be selected and isolated.

As used herein, the term " non-naturally occurring amino acid " refers to an amino acid other than the amino acid occurring at the corresponding position by arranging naturally occurring polypeptides.

As used herein, the term " protein sequence " or " amino acid sequence " means that the amino acid component in the polypeptide is linearly labeled from the amino terminus to the carboxy terminus, They exist adjacent to each other in the primary structure.

The term " nucleic acid " as used herein refers to any two or more covalently bonded nucleotides, or nucleotide analogs or derivatives. As used herein, the term includes, but is not limited to, DNA, RNA, and PNA. The terms " nucleic acid " and " polynucleotide " are used interchangeably herein.

The term " polynucleotide " as used herein is intended to encompass a single nucleic acid as well as a plurality of nucleic acids and means an isolated nucleic acid molecule or construct, for example, messenger RNA (mRNA) or plasmid DNA (pDNA). The term " isolated " nucleic acid or polynucleotide is intended to denote DNA or RNA which is a nucleic acid molecule that has been removed from its natural environment. For example, recombinant polynucleotides encoding the inventive scaffold contained within a vector are considered isolated for the purposes of the present invention. A further example of an isolated polynucleotide is a polynucleotide (partially or substantially) purified (partially or substantially) in a recombinant polynucleotide or a solution maintained in a heterologous host cell. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the polynucleotides of the invention. Isolated polynucleotides or nucleic acids according to the invention further comprise such molecules synthetically produced. In addition, the polynucleotide or nucleic acid may comprise a regulatory element, for example, a promoter, a ribosome binding site or a transcription terminator.

As used herein, the term " polypeptide " means any sequence consisting of two or more amino acids linked by amide bonds (peptide bonds), regardless of length, post-translational modification or function. The terms " polypeptide ", " peptide " and " protein " are used interchangeably herein. Thus, a peptide, dipeptide, tripeptide or oligopeptide is included within the definition of " polypeptide ", and the term " polypeptide " may be used in place of any of these terms, or interchangeably with any of these terms . In addition, the term " polypeptide " is intended to encompass the expression of polypeptides including, but not limited to, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, To represent the product of the post-transformation. Polypeptides can be derived from natural biological sources or produced by recombinant techniques, but are not necessarily translated from the designated nucleic acid sequence. The polypeptide may be generated by any method including chemical synthesis.

In a non-antibody protein scaffold library of fibronectin according to the present invention skeletonized with EDB, the mutated BC loop is characterized by comprising the following polynucleotide sequence:

(NNK) _3-10

(N in the above sequence is A, T, C or G, and K is T or G)

In a non-antibody protein scaffold library of fibronectin according to the present invention skeletonized with EDB, the mutated DE loop is characterized by comprising the following polynucleotide sequence:

(NNK) _3-10

(N in the above sequence is A, T, C or G, and K is T or G)

In a non-antibody protein scaffold library of fibronectin according to the present invention skeletonized with EDB, the mutated FG loop is characterized by comprising the following polynucleotide sequence:

(NNK) _3-20

(N in the above sequence is A, T, C or G, and K is T or G)

The non-antibody protein scaffold library of fibronectin according to the present invention, which has the EDB framework, is characterized in that the library comprises the following polynucleotide sequence:

_{GAGGTGCCCCAACTCACTGACCTAAGCTTTGTTGATATAACCGATTCAAGCATCGGCCTGAGGTGG (NNK) 3-10 ATTATTGGGTACCGCATCACAGTAGTTGCGGCAGGAGAAGGTATCCCTATTTTTGAAGATTTTGTGGAC (NNK} ) 3-10 TACTACACAGTCACAGGGCTGGAGCCGGGCATTGACTATGATATCAGCGTTATCACTCTCATT (NNK) 3-20 CCTACTACACTGACACAACAAACG

(N in the above sequence is A, T, C or G, and K is T or G)

According to a second embodiment,

The present invention relates to a method for screening non-antibody protein scaffolds in which the non-antibody protein scaffold library of fibronectin with EDB as a framework is reacted with a target molecule to make EDB of the fibronectin skeleton having a specific high affinity to the target molecule, Discloses a non-antibody protein scaffold that is skeleton of EDB of fibronectin having a specific high affinity to a target molecule selected by SEQ.

As used herein, the term " non-antibody protein scaffold variant of fibronectin with EDB backbone " refers to a non-antibody protein scaffold variant having the amino acid sequence conferring the typical structural stability of fibronectin EDB in nature, Refers to a protein having an amino acid sequence having a combination of various amino acid sequences not present in nature in the other loop structure and retaining the structure of the EDB domain of fibronectin but not in the natural world. The protein variant based on the EDB domain structure of fibronectin can specifically bind to various target molecules in addition to the protein bound to the EDB domain of fibronectin present in nature to control the biological activity of the target molecule.

As used herein, the term " target molecule " encompasses a wide range of materials and molecules, from single molecules to complex target molecules. Target molecules can be other molecules that can be recognized by a protein, nucleic acid, lipid, carbohydrate or peptide domain. Target molecules can be defined by screening assays described herein or by promoting or inhibiting specific protein interactions.

The term " affinity " as used herein refers to a measure of the binding strength between a scaffold library and a target molecule according to the present invention.

In a scaffold selected according to the method of selecting a non-antibody protein scaffold using EDB as a scaffold of fibronectin according to the present invention, the target molecule is selected from the group consisting of a cell death receptor (DR) 4, a cell death receptor (DR) 5 , Tumor necrosis factor alpha, glycoprotein IIb / IIIa receptor or glycoprotein II? / III?, Vascular endothelial growth factor (VEGF), vascular endothelial cell growth A vascular endothelial growth factor receptor (VEGFR), a tyrosine kinase inhibitor, an epidermal growth factor receptor, a platelet-derived growth factor (PDGF), a platelet-derived growth factor (FGF-2), interleukin-1 (interleukin-1), interleukin-6 (interleukin-6) But are not limited to, interleukin 32, interleukin 2 receptor, CD3, CD11a, CD14, CD15, CD16, CD20 CD32, CD64, or Raf.

According to a third embodiment,

The present invention discloses an expression vector comprising a non-antibody protein scaffold skeleton of EDB of fibronectin having a specific high affinity to a target molecule.

The term " expression " as used herein refers to the process by which a gene produces a biochemical substance, such as a scaffold or fragment thereof of the present invention. The process includes any manifestation of the presence of a functional gene in a cell, including, but not limited to, both gene expression knockdown as well as transient expression and stable expression. The process includes, but is not limited to, transcribing a gene into one or more mRNAs, and translating such mRNA into one or more polypeptides. Where the desired end product is a biochemical material, expression includes the production of the biochemical material and any precursors.

As used herein, the term " expression product " may be a nucleic acid, for example, a messenger RNA produced by the transcription of a gene, or a polypeptide. The expression products described herein can be modified by post-translational modifications, for example, nucleic acids with polyadenylation, or post-translational modifications such as methylation, glycosylation, addition of lipids, attachment to other protein subunits, Etc. < / RTI >

The term " vector " or " expression vector " as used herein is used herein to refer to a vector that is introduced into a host cell and used in accordance with the present invention as a vehicle expressing the desired expression product. As is known to those skilled in the art, such vectors may be readily selected from the group consisting of plasmids, phage, viruses and retroviruses. Generally, vectors compatible with the present invention will include selectable markers, appropriate restriction sites for promoting cloning of the desired nucleic acid, and the ability to enter and / or replicate in eukaryotic or prokaryotic cells.

The term " host cell " as used herein refers to a cell constructed by the use of recombinant DNA techniques and having a vector encoding one or more expression products. In describing the process of isolating an expression product from a recombinant host, the terms " cell " and " cell culture " are used interchangeably to denote the source of an expression product unless explicitly specified otherwise (i.e., Cell " means recovery from whole cells that have been centrifuged, or recovery from cell culture containing both the culture medium and the suspended cells).

According to a fourth embodiment,

The present invention relates to a method for preventing, detecting, diagnosing, treating, or ameliorating a disease or disorder, particularly cancer and other immune disease-related diseases, which comprises a non-antibody protein scaffold in which EDB of fibronectin having a specific high affinity to a target molecule is skeleton Comprising administering to an animal, preferably a human, an effective amount of a non-antibody protein scaffold skeleton of EDB of fibronectin having a specific high affinity to said target molecule, Diagnosis, treatment, or alleviation of cancer and other immune disease-related diseases.

The term " treat " or " treatment ", as used herein, is used to refer to both therapeutic treatment and prophylactic or cognitive measures, wherein the purpose is to prevent undesired physiological changes or progression of the disorder It is slowing down. Whether beneficial or desired clinical outcome is detectable or undetectable, it is contemplated that alleviation of symptoms, reduction in disease severity, stabilized (i.e., not worsening) condition of the disease, delay or delay of disease progression, (Partial or total) decay, < / RTI >

As used herein, the term " treatment " means prolonging survival compared to predicted survival if treatment is not provided. The subject in need of treatment includes not only the subject already suffering from the condition or disorder, but also the subject to which the condition or disorder is susceptible or the subject to which the condition or disorder should be prevented.

The term "subject", "subject", "animal", "patient" or "mammal" as used herein means any entity, patient or animal, particularly a mammalian subject, who desires diagnosis, prognosis or treatment . Mammalian subjects may include, but are not limited to, humans, livestock, farm animals, and zoos, sports or pets such as dogs, cats, guinea pigs, rabbits, rats, mice, It is not.

Figure 1 shows a schematic representation of the protein scaffold of fibronectin EDB.
Figure 2 shows the sequence of fibronectin EDB and fibronectin 10FN3.
Figure 3 shows the amino acid and polynucleotide sequences of a non-antibody protein scaffold with the EDB backbone of fibronectin according to the present invention.
FIG. 4 shows a method for producing an insert of a non-antibody protein scaffold with EDB skeleton of fibronectin according to the present invention.
FIG. 5 shows the result of DNA gel analysis after Fabrication of EDB modified protein libraries Insert1, Insert2, Insert3, and Insert4 of fibronectin according to the present invention.
FIG. 6 shows a method for preparing a phage library of a non-antibody protein scaffold using EDB as the framework of fibronectin according to the present invention.
FIG. 7 shows the results of expression-purification of fibroblethin EDB modified protein according to the present invention using bacteria.
FIG. 8 shows the results of confirming stability of EDB-modified protein of fibronectin according to the present invention for 30 days as a scaffold.

Hereinafter, various embodiments are provided to facilitate understanding of the present invention. The following examples are provided to facilitate understanding of the invention and are not intended to limit the scope of the invention.

< Example >

Example 1 . FN  EDB skeleton Non-antibody  protein Scaffold  Building the Library

Based on the amino acid sequence and structural characteristics of the fibronectin EDB (FN EDB) protein shown in Figure 1, amino acid mutations were introduced into the BC loop, the DE loop, and the FG loop while maintaining the stable structure of the EDB domain of fibronectin, A non-antibody protein scaffold library was constructed as a skeleton. In this library, a non-antibody protein scaffold mutant that specifically binds to various target molecules and regulates the biological activity of the target molecule, is used as the framework of fibronectin EDB .

First, the PCR conditions used to make an insert of fibronectin EDB (FN EDB) protein scaffold are as follows. The PCR mixture contained 32.5 μL of distilled water (DW), 10 μL of 5X PrimeSTAR buffer, 5 μL of dNTP (2.5 mM), 1 μL of forward template (100 μM), 1 μL of reverse template (100 μM) PrimeSTAR polymerase (2.5 u / l). The PCR conditions were 10 cycles of 98 ° C and 30 cycles of 1 min at 50 ° C, and the PCR products were stored at 4 ° C. The template used was ordered by the DNA synthesizer (Bioneer) and the nucleotide sequences used are shown in Table 1 below.

template name Base sequence Loop SEQ ID NO: One F1_EDB backbone ACCGATTCAAGCATCGGCCTGAGGTGGNNKNNKNNKNNKNNKNNKNNKATTATTGGGTACCGCATCACAGTAGTTGCGGCAGGAGAAGGTATCCCTATT BC One 1-1 F2_EDB backbone ACCGATTCAAGCATCGGCCTGAGGTGGNNKNNKNNKNNKNNKATTATTGGGTACCGCATCACAGTAGTTGCGGCAGGAGAAGGTATCCCTATT BC 2 2 B1_EDB backbone AACGCTGATATCATAGTCAATGCCCGGCTCCAGCCCTGTGACTGTGTAGTAMNNMNNMNNMNNGTCCACAAAATCTTCAAAAATAGGGATACCTTCTCCTGCCGC DE 3 2-1 B2_EDB backbone &Lt; RTI ID = 0.0 &gt; DE 4 3 F1_elongate_SfiI TTCTATGCGGCCCAGCTGGCCGAGGTGCCCCAACTCACTGACCTAAGCTTTGTTGATATAACCGATTCAAGCATCGGCCTG - 5 4 B1_elongate_NotI AACAGTTTCTGCGGCCGCCGTTTGTTGTGTCAGTGTAGTAGGMNNMNNMNNMNNMNNMNNAATGAGAGTGATAACGCTGATATCATAGTCAATGCC FG 6 4-1 B2_elongate_NotI AACAGTTTCTGCGGCCGCCGTTTGTTGTGTCAGTGTAGTAGGMNNMNNMNNMNNMNNMNNMNNMNNMNNMNNMNNAATGAGAGTGATAACGCTGATATCATAGTCAATGCC FG 7

(Wherein N in the nucleotide sequence in Table 1 represents adenine (A), cytosine (C), guanine (G) or thymine (T), K is thymine (T) or guanine (G), M is adenine Or cytosine (C)

First, in the normal direction template F1_EDB backbone (5'-ACCGATTCAAGCATCGGCCTGAGGTGGNNKNNKNNKNNKNNKNNKNNKATTATTGGGTACCGCATCACAGTAGTTGCGGCAGGAGAAGGTATCCCTATT-3 ', SEQ ID NO: 1) and in a direction opposite the mold B1_EDB backbone (3'-AACGCTGATATCATAGTCAATGCCCGGCTCCAGCCCTGTGACTGTGTAGTAMNNMNNMNNMNNGTCCACAAAATCTTCAAAAATAGGGATACCTTCTCCTGCCGC-5' of the EDB fibronectin using, SEQ ID NO: 3) loop BC and DE loop Lt; / RTI &gt; were amplified by PCR. Then, in the normal direction F1_elongate_SfiI template to amplified the sequence (5'-TTCTATGCGGCCCAGCTGGCCGAGGTGCCCCAACTCACTGACCTAAGCTTTGTTGATATAACCGATTCAAGCATCGGCCTG-3 ', SEQ ID NO: 5) and in the opposite direction B1_elongate_NotI template (3'-AACAGTTTCTGCGGCCGCCGTTTGTTGTGTCAGTGTAGTAGGMNNMNNMNNMNNMNNMNNAATGAGAGTGATAACGCTGATATCATAGTCAATGCC-5': FG loop and limited by the SEQ ID NO: 6) A DNA sequence having an enzyme restriction site was amplified by PCR. The second library was constructed using the same method except that SEQ ID NO: 2 was used instead of SEQ ID NO: 1. The third library was constructed using the same method except that SEQ ID NO: 4 was used instead of SEQ ID NO: 3. The fourth library was constructed using the same method except that SEQ ID NO: 7 was used instead of SEQ ID NO: 6. Thus, a library having a nucleotide sequence as shown in Table 2 was prepared by amplifying DNA sequences randomly coding BC loop, DE loop and FG loop with fibronectin EDB as a framework.

The nucleotide sequence (N = random / K = T or G) SEQ ID NO: Fibronectin EDB random library1 GAGGTGCCCCAACTCACTGACCTAAGCTTTGTTGATATAACCGATTCAAGCATCGGCCTGAGGTGGNNKNNKNNKNNKNNKNNKNNKATTATTGGGTACCGCATCACAGTAGTTGCGGCAGGAGAAGGTATCCCTATTTTTGAAGATTTTGTGGACNNKNNKNNKNNKTACTACACAGTCACAGGGCTGGAGCCGGGCATTGACTATGATATCAGCGTTATCACTCTCATTNNKNNKNNKNNKNNKNNKCCTACTACACTGACACAACAAACG 8 Fibronectin EDB random library2 GAGGTGCCCCAACTCACTGACCTAAGCTTTGTTGATATAACCGATTCAAGCATCGGCCTGAGGTGGNNKNNKNNKNNKNNKATTATTGGGTACCGCATCACAGTAGTTGCGGCAGGAGAAGGTATCCCTATTTTTGAAGATTTTGTGGACNNKNNKNNKNNKTACTACACAGTCACAGGGCTGGAGCCGGGCATTGACTATGATATCAGCGTTATCACTCTCATTNNKNNKNNKNNKNNKNNKCCTACTACACTGACACAACAAACG 9 Fibronectin EDB random library 3 GAGGTGCCCCAACTCACTGACCTAAGCTTTGTTGATATAACCGATTCAAGCATCGGCCTGAGGTGGNNKNNKNNKNNKNNKNNKNNKATTATTGGGTACCGCATCACAGTAGTTGCGGCAGGAGAAGGTATCCCTATTTTTGAAGATTTTGTGGACNNKNNKNNKNNKNNKNNKTACTACACAGTCACAGGGCTGGAGCCGGGCATTGACTATGATATCAGCGTTATCACTCTCATTNNKNNKNNKNNKNNKNNKCCTACTACACTGACACAACAAACG 10 Fibronectin EDB random library 4 GAGGTGCCCCAACTCACTGACCTAAGCTTTGTTGATATAACCGATTCAAGCATCGGCCTGAGGTGGNNKNNKNNKNNKNNKNNKNNKATTATTGGGTACCGCATCACAGTAGTTGCGGCAGGAGAAGGTATCCCTATTTTTGAAGATTTTGTGGACNNKNNKNNKNNKTACTACACAGTCACAGGGCTGGAGCCGGGCATTGACTATGATATCAGCGTTATCACTCTCATTNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKNNKCCTACTACACTGACACAACAAACG 11

Example  2. FN  Fabrication and propagation of EDB library

The DNA inserts from library 1 to library 4 according to Example 1 were digested with SfiI and NotI and ligated to a phage plasmid complex vector (Phagemid ventor, Novagen) digested with SfiI and NotI as shown in FIG. 6 Was introduced into E. coli using electroporation. Since the phagemid vector has an ampicillin (Amp) resistance gene as a selection marker, the E. coli was cultured in ampicillin (Amp) medium for library screening, and the transformed E. coli having ampicillin resistance was selected. A helper phage was superinfected to produce a library phage having various recombinant EDBs in order to produce a phage for library amplification from the phagemid vector of the transformed E. coli. In this example, M13 phages were used as helper phage and cultured in Super Broth (SB) medium known to be suitable for large-scale plasmid DNA culture. The culture was inoculated on a 400 mL culture medium (supplemented with ampicillin / 2% glucose) and cultured at 37 ° C with shaking at 250 rpm until the OD ₆₀₀ reached 0.5. The supernatant was removed by centrifugation, and glucose- ml of Amp-supplemented SB medium, followed by addition of M13 helper phage of 10 ¹² pfu (plaque forming unit) and re-cultivation for 1 hour at 37 ° C and 200 rpm for library digestion with various recombinant EDB variants .

Example  3. EDB Modified protein  Expression - Purification

In order to confirm that the EDB-modified protein can be expressed and purified, the EDB modified protein (EVPQLTDLSFVDITDSSIGLRW RHPHFPT IIGYRITVVAAGEGIPIFEDFVD LQPP YYTVTGLEPGIDYDISVITLI VAQNDHELITP PTTLTQQT) was grafted onto the VEGFR2-specific 10Fn3, which was reported in the previous paper. The gene for the EDB variant protein was synthesized from bioneer and cloned into expression vector pBT7-N-His. This was transformed into BL21 cells and then plated on agar medium containing ampicillin. The colonies grown in agar plate medium were inoculated into 5 ml of LB medium containing ampicillin (50 μg / ml), cultured at 37 ° C. at 220 rpm for one day, mixed with glycerol at a ratio of 1: 1, And stored in a -80 ° C deepfreezer. 100 μl of stock was inoculated in 20 ml of LB medium containing ampicillin (50 μg / ml), cultured at 37 ° C. at 220 rpm for one day, transferred to 400 ml of LB medium containing ampicillin (50 μg / ml) = 0.7. Then, 1 mM isopropyl -? - D-chiogalactopyranoside (IPTG) was added thereto and cultured at 20 ° C. at 220 rpm for one day. The supernatant was removed by centrifugation at 4000 xg for 10 min at 4 &lt; 0 &gt; C and suspended in lysis buffer (50 mM sodium phosphate (pH 8.0), 300 mM NaCl and 10 mM imidazole). After being stored at -80 ° C for one day, it was completely dissolved and dissolved in 1 ml of Isopropanol (PMSF) (PMSF), and 1 ml was added to the dissolved E. coli . The E. coli was dissolved using a sonicator and centrifuged at 4 ° C at 13,000 rpm for 1 hour. The Ni-NTA affinity resin (Elposbio, Daejeon, Korea) was washed with distilled water and lysis buffer and the supernatant was bound to the resin. After washing with 600 ml of washing buffer (50 mM sodium phosphate (pH 8.0), 300 mM NaCl and 20 mM imidazole), the N-terminal His-tag EDB modification was carried out using a solution buffer (50 mM sodium phosphate (pH 8.0), 300 mM NaCl and 250 mM imidazole) Proteins were obtained by elution. The obtained protein was centrifuged at 4,000 rpm at 4,000 rpm at 4 ° C for 10 min, concentrated, and then subjected to 5 buffer changes in the same manner to obtain high-purity EDB-modified protein. Fig. 7 shows the results of the expression and purification of the EDB-modified protein.

Example  4. EDB Modified protein  Stability experiment

The purified EDB modified protein was stored at 4 ℃ for one month to confirm that it was stable. 1 mg / ml of EDB-modified protein was stored in the refrigerator for one month and centrifuged at 13,000 rpm for 10 minutes to measure the amount of soluble protein in the BCA assay. As a result, it was confirmed that more than 90% of the modified proteins were stable (FIG. 8).

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Korea Institute of Ceramic Engineering and Technology <120> Non-antibody protein scaffold based on fibronectin EDB and use          the <130> DPP-2016-0819 <160> 11 <170> KoPatentin 3.0 <210> 1 <211> 99 <212> DNA <213> Artificial Sequence <220> <223> F1_EDB backbone <400> 1 accgattcaa gcatcggcct gaggtggnnk nnknnknnkn nknnknnkat tattgggtac 60 cgcatcacag tagttgcggc aggagaaggt atccctatt 99 <210> 2 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> F2_EDB backbone <400> 2 accgattcaa gcatcggcct gaggtggnnk nnknnknnkn nkattattgg gtaccgcatc 60 acagtagttg cggcaggaga aggtatccct att 93 <210> 3 <211> 105 <212> DNA <213> Artificial Sequence <220> <223> B1_EDB backbone <400> 3 aacgctgata tcatagtcaa tgcccggctc cagccctgtg actgtgtagt amnnmnnmnn 60 mnngtccaca aaatcttcaa aaatagggat accttctcct gccgc 105 <210> 4 <211> 111 <212> DNA <213> Artificial Sequence <220> <223> B2_EDB backbone <400> 4 aacgctgata tcatagtcaa tgcccggctc cagccctgtg actgtgtagt amnnmnnmnn 60 mnnmnnmnng tccacaaaat cttcaaaaat agggatacct tctcctgccg c 111 <210> 5 <211> 81 <212> DNA <213> Artificial Sequence <220> <223> F1_elongate_SfiI <400> 5 ttctatgcgg cccagctggc cgaggtgccc caactcactg acctaagctt tgttgatata 60 accgattcaa gcatcggcct g 81 <210> 6 <211> 96 <212> DNA <213> Artificial Sequence <220> <223> B1_elongate_NotI <400> 6 aacagtttct gcggccgccg tttgttgtgt cagtgtagta ggmnnmnnmn nmnnmnnmnn 60 aatgagagtg ataacgctga tatcatagtc aatgcc 96 <210> 7 <211> 109 <212> DNA <213> Artificial Sequence <220> <223> B2_elongate_NotI <400> 7 cagtttctgc ggccgccgtt tgttgtgtca gtgtagtagg mnnmnnmnnmnnmnnmn 60 nmnnmnnmnn mnnaatgaga gtgataacgc tgatatcata gtcaatgcc 109 <210> 8 <211> 273 <212> DNA <213> Artificial Sequence <220> <223> Fibronectin EDB random library 1 <400> 8 gaggtgcccc aactcactga cctaagcttt gttgatataa ccgattcaag catcggcctg 60 aggtggnnkn nknnknnknn knnknnkatt attgggtacc gcatcacagt agttgcggca 120 ggagaaggta tccctatttt tgaagatttt gtggacnnkn nknnknnkta ctacacagtc 180 acagggctgg agccgggcat tgactatgat atcagcgtta tcactctcat tnnknnknnk 240 nnknnknnkc ctactacact gacacaacaa acg 273 <210> 9 <211> 267 <212> DNA <213> Artificial Sequence <220> <223> Fibronectin EDB random library 2 <400> 9 gaggtgcccc aactcactga cctaagcttt gttgatataa ccgattcaag catcggcctg 60 aggtggnnkn nknnknnknn kattattggg taccgcatca cagtagttgc ggcaggagaa 120 ggtatcccta tttttgaaga ttttgtggac nnknnknnkn nktactacac agtcacaggg 180 ctggagccgg gcattgacta tgatatcagc gttatcactc tcattnnknn knnknnknnk 240 nnkcctacta cactgacaca acaaacg 267 <210> 10 <211> 279 <212> DNA <213> Artificial Sequence <220> <223> Fibronectin EDB random library 3 <400> 10 gaggtgcccc aactcactga cctaagcttt gttgatataa ccgattcaag catcggcctg 60 aggtggnnkn nknnknnknn knnknnkatt attgggtacc gcatcacagt agttgcggca 120 ggagaaggta tccctatttt tgaagatttt gtggacnnkn nknnknnknn knnktactac 180 acagtcacag ggctggagcc gggcattgac tatgatatca gcgttatcac tctcattnnk 240 nnknnknnkn nknnkcctac tacactgaca caacaaacg 279 <210> 11 <211> 288 <212> DNA <213> Artificial Sequence <220> <223> Fibronectin EDB random library 4 <400> 11 gaggtgcccc aactcactga cctaagcttt gttgatataa ccgattcaag catcggcctg 60 aggtggnnkn nknnknnknn knnknnkatt attgggtacc gcatcacagt agttgcggca 120 ggagaaggta tccctatttt tgaagatttt gtggacnnkn nknnknnkta ctacacagtc 180 acagggctgg agccgggcat tgactatgat atcagcgtta tcactctcat tnnknnknnk 240 nnknnknnkn nknnknnknn knnkcctact acactgacac aacaaacg 288

Claims (11)

A non-antibody protein scaffold library skeletonized with EDB (Extra Domain B) of fibronectin comprising the following polynucleotide sequence.
_{GAGGTGCCCCAACTCACTGACCTAAGCTTTGTTGATATAACCGATTCAAGCATCGGCCTGAGGTGG (NNK) 3-10 ATTATTGGGTACCGCATCACAGTAGTTGCGGCAGGAGAAGGTATCCCTATTTTTGAAGATTTTGTGGAC (NNK} ) 3-10 TACTACACAGTCACAGGGCTGGAGCCGGGCATTGACTATGATATCAGCGTTATCACTCTCATT (NNK) 3-20 CCTACTACACTGACACAACAAACG
(N in the above sequence is A, T, C or G, and K is T or G)
delete delete delete delete The method according to claim 1,
Wherein the library comprises any one of SEQ ID NOS: 8 to 11. 11. The non-antibody protein scaffold library of fibronectin according to claim 9,
A non-antibody protein scaffold made by reacting a non-antibody protein scaffold library of fibronectin according to any one of claims 1 to 6 with a target molecule to form EDB of fibronectin having a specific high affinity to the target molecule How to select.
8. The method of claim 7,
The target molecule may be selected from the group consisting of a cell death receptor (DR) 4, a cell death receptor (DR) 5, a tumor necrosis factor alpha, a glycoprotein IIb / IIIa receptor or a glycoprotein II? / III? , Vascular endothelial growth factor (VEGF), vascular endothelial growth factor receptor (VEGFR), tyrosine kinase inhibitor, epidermal growth factor receptor, , Platelet-derived growth factor (PDGF), platelet-derived growth factor receptor (PDGFR), stem cell factor receptor (c-kit), Fms-positive tyrosine kinase-3 3), interleukin 1, interleukin 6, interleukin 32, interleukin 2 receptor, CD3, CD11a, CD14, CD15, CD16, CD20 CD32, CD64 or RTI ID = 0.0 &gt; Raf &lt; / RTI &gt; Method for selecting a non-antibody protein scaffold tin EDB to the skeleton.
An expression vector comprising a non-antibody protein scaffold skeleton of EDB of fibronectin according to claim 1 or 6 having a specific high affinity for the target molecule.
Diagnosis, diagnosis, treatment, or treatment of a cancer or immune disease-related disease comprising, as an active ingredient, a non-antibody protein scaffold with the EDB skeleton of fibronectin according to item 1 or 6 having a specific high affinity to the target molecule Compositions for alleviating.
An effective amount of a non-antibody protein scaffold skeleton of fibronectin according to any one of claims 1 to 6 having a specific high affinity to a target molecule, comprising administering to an animal other than human a cancer or immune disease- Prevention, detection, diagnosis, treatment, or alleviation.

Images