KR101919485B1 - Use of Cholinergic genes for treating depressive disorder - Google Patents

Abstract

The present invention relates to the use of a cholinergic gene for the prevention or treatment of depression, and it relates to a method for screening for a preventive or therapeutic agent for depression by analyzing the expression of a cholinergic gene, a pharmaceutical composition for preventing or treating depression, An antidepressant therapy-refractory diagnostic method for analyzing the expression of a cholinergic gene, an antidepressant treatment regulating the expression of a cholinergic gene, a method for producing a refractory or aneurismatic animal model, and an antidepressant therapy-refractory or anhidrotic animal model therefor.
According to the present invention, by analyzing the change of expression rate of cholinergic genes, drugs for preventing or treating depression can be screened, and further, depression can be diagnosed early or the prognosis can be analyzed.
The pharmaceutical composition for the prevention or treatment of depression according to the present invention can prevent or treat depression by controlling the expression of the cholinergic gene.
In addition, the development of an animal model with a pleuritic symptom, a key symptom of depression, and the development of a refractory animal model for antidepression can be applied to various studies to overcome the difficulties in the treatment of depression.

Description

Use of cholinergic genes for the prevention or treatment of depression < RTI ID = 0.0 >

The present invention relates to the use of a cholinergic gene for the prevention or treatment of depression, and it relates to a method for screening for a preventive or therapeutic agent for depression by analyzing the expression of a cholinergic gene, a pharmaceutical composition for preventing or treating depression, An antidepressant therapy-refractory diagnostic method for analyzing the expression of a cholinergic gene, an antidepressant treatment regulating the expression of a cholinergic gene, a method for producing a refractory or aneurismatic animal model, and an antidepressant therapy-refractory or anhidrotic animal model therefor.

Major depressive disorder (MDD) or depression is a serious psychiatric disorder closely related to suicide attempts (Non-Patent Document 1). Cholinergic transmission in the brain has been thought to be the basis of the endophenotype for depression (Non-Patent Document 2-4). The increase in acetylcholine (ACh) through the regulation of acetylcholinesterase inhibitors can cause depressive symptoms in both humans and rodents (Non-Patent Documents 5-6). Furthermore, inhibition of nicotinic acetylcholine receptors (nAChRs) or muscarinic acetylcholine receptors (mAChRs) improves the symptoms of depression (Non-Patent Documents 7-8). These findings suggest that acetylcholine signaling contributes to depression, but it is not yet clear whether any particular group of cholinergic neurons is associated with specific depressive symptoms.

Habenula of the thalamus (Epithalamus) is anatomically or functionally divided into the forebrain and dopamine (ie, the substantia nigra pars compacta and ventral tegmental area (VTA) and serotonin The median habenula (MHb) and the lateral habenula (LHb) are the nuclei of the reins, which are connected to the midbrain, Various evidence from studies in animal models and humans suggests that the medial rein nucleus plays an important role in nicotine addiction (Non-Patent Documents 11-13), while the regulatory disorder of the lateral relex nucleus The results of this study suggest that the deep brain nucleus of the medial reinforcement nucleus may be involved in a variety of mental disorders including depression. Therapeutic-refractory depression and deeply acquired innate abilities in rats (Non-Patent Document 14-15). However, in the pathophysiological aspects of depression, the role of the inner bridle nuclei is not clear yet.

The present inventors confirmed that the cholinergic gene cluster in the inner nuclear nucleus was reduced in depressed patients and that the choline signaling of the inner nuclear nucleus from the depression model of humans and rats controlled the depressive state, And thus can be used for the screening of a composition for the prevention or treatment of depression. The present invention has been completed based on this finding.

 Ferrari AJ., Et al. Burden of depressive disorders by country, sex, age, and year: 2010. PLoS Med. 2013; 10 (11): e1001547.  Dilsaver SC. Cholinergic mechanisms in depression. Brain Res. 1986; 396 (3): 285-316.  Janowsky DS., Et al. A cholinergic-adrenergic hypothesis of mania and depression. Lancet. 1972; 2 (7778): 632-5.  Janowsky DS., Et al. Adrenergic-cholinergic balance and the treatment of affective disorders. Prog Neuropsychopharmacol Biol Psychiatry. 1983; 7 (2-3): 297-307.  Risch SC., Et al. Mood and behavioral effects of physostigmine on humans are accompanied by elevations in plasma beta-endorphin and cortisol. Science. 1980; 209 (4464): 1545-6.  Mineur YS., Et al. Cholinergic signaling in the hippocampus regulates social stress resilience and anxiety- and depression-like behavior. Proc Natl Acad Sci U S A. 2013: 110 (9): 3573-8.  Shytle RD., Et al. Nicotinic acetylcholine receptors as targets for antidepressants. Mol Psychiatry. 2002; 7 (6): 525-35.  Drevets WC., Et al. Antidepressant effects of the muscarinic cholinergic receptor antagonist scopolamine: a review. Biol Psychiatry. 2013; 73 (12): 1156-63.  Klemm WR. Habenular and interpeduncularis nuclei: shared components in multiple-function networks. Med Sci Monit. 2004; 10 (11): RA 261-73.  Lecourtier L., et al. A conductor hidden in the orchestra? Role of the habenular complex in monoamine transmission and cognition. Neurosci Biobehav Rev. 2007; 31: 658-72.  Hsu YW., Et al. Medial habenula output circuit mediated by alpha5 nicotinic receptor-expressing GABAergic neurons in the interpeduncular nucleus. J Neurosci. 2013; 33 (46): 18022-35.  Zhao-Shea R., et al., Tapper AR. Activation of GABAergic neurons in the interpeduncular nucleus triggers physical nicotine withdrawal symptoms. Curr Biol. 2013; 23 (23): 2327-35.  Dao DQ., Et al. Nicotine enhances excitability of medial habenular neurons via facilitation of neurokinin signaling. J Neurosci. 2014; 34 (12): 4273-84.  Sartorius A., et al. Deep brain stimulation of the lateral habenula in treatment resistant major depression. Med Hypotheses. 2007; 69: 1305-8.  Li B., et al. Synaptic potentiation onto habenula neurons in the learned helplessness model of depression. Nature. 2011; 470 (7335): 535-9.

It is an object of the present invention to provide a method for screening a preventive or therapeutic agent for depression.

It is an object of the present invention to provide a method for diagnosing depression in vitro.

It is an object of the present invention to provide a pharmaceutical composition for the prevention or treatment of depression.

It is an object of the present invention to provide an in vitro antidepressant therapy refractory diagnostic method.

It is an object of the present invention to provide a method for producing an animal model of antidepressant treatment-refractory or anesthesia.

Another object of the present invention is to provide an antidepressant treatment-refractory or anesthetics animal model according to the method of the present invention.

(A) a CHAT (choline acetyltransferase) gene represented by SEQ ID NO: 1 or SEQ ID NO: 2, a VACHT (vesicular acetylcholine transporter) gene represented by SEQ ID NO: 3 or SEQ ID NO: 4, CHT (choline transporter) the gene, SEQ ID NO: 7 or SEQ ID NO: 8 is represented by A nicotinic acetylcholine receptor? 3 ( CHRNA3 ) gene, SEQ ID NO: 9 or SEQ ID NO: 10 A nicotinic acetylcholine receptor < RTI ID = 0.0 > beta3) < / RTI & CHRNB4 (nicotinic acetylcholine receptor < RTI ID = 0.0 > beta4) < / RTI >gene;

(b) before and after contacting the drug candidate material, each CHAT , VACHT , CHT , CHRNA3 , CHRNB3 or CHRNB4 gene; And

(c) determining that the drug candidate substance is a preventive or therapeutic agent for depression when a change in the expression level of each gene is confirmed,

Wherein the cell of step (a) is a cell derived from Habenula. The present invention also provides a method for screening a preventive or therapeutic agent for depression.

The term " drug candidate substance " is an unknown substance that is considered to have an influence on the expression amount of a gene or affect the amount or activity of a protein. In the present invention, CHAT , VACHT , CHT , CHRNA3 , CHRNB3 CHRNB4 " refers to an unknown substance that is likely to affect the expression level or activity of a gene or protein. The drug candidates may include, but are not limited to, small interference RNA (siRNA), antisense RNA, nucleotides, chemically synthesized substances, and natural extracts.

The term "Habenula" refers to a part that functions to relay nerve signaling in the neural circuit of the cerebral limbic system and is subdivided into medial habenula (MHb) and lateral habenula (LHb). .

The cell of step (a) may be a cell comprising the CHAT (choline acetyltransferase) gene of SEQ ID NO: 1 or SEQ ID NO: 2.

The change of the gene expression rate in the step (b) may be detected by a conventional biochemical analysis method for confirming not only a hybridization reaction using a DNA microarray or a cDNA microarray but also an expression rate, amount or pattern of mRNA produced by transcription of the gene . RT-PCR, qRT-PCR, competitive RT-PCR, real-time RT-PCR, real-time RT-PCR, -time RT-PCR), RNase protection assay (RNase protection assay), in-situ (in situ hybridization reaction, or Northern blotting, and any other methods conventionally performed in the art can be used. For example, in the case of carrying out according to the RT-PCR protocol, total RNA is isolated from the sample-treated cells, and single-stranded cDNA is prepared using primers and reverse transcriptase. Then, a change in gene expression amount is measured by real-time quantitative PCR using a single-strand cDNA as a template and a gene-specific primer set. The results for real-time PCR are analyzed according to the Absolute Quantification standard curve method.

In one embodiment of the present invention, the change in mRNA expression rate was measured using qRT-PCR or in situ hybridization, but the present invention is not limited thereto.

The agent for measuring the mRNA expression level of the gene is composed of a molecule which can be used for the confirmation of the expression level of the CHAT , VACHT , CHT , CHRNA3 , CHRNB3 or CHRNB4 gene, preferably a primer or a probe specifically binding to the gene But it is not limited thereto.

The term " primer " refers to a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming base pairs with a complementary template and serving as a starting point for template strand copying Quot; means a short nucleic acid sequence. The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i.e., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. The PCR conditions, the lengths of the sense and antisense primers can be modified based on what is known in the art.

The term " probe " means a nucleic acid fragment such as RNA or DNA corresponding to a short period of a few nucleotides or several hundreds of nucleotides capable of specifically binding to mRNA, and the presence or absence of a specific mRNA can be confirmed by labeling Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.

The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more natural nucleotides with one or more homologues, and modification between nucleotides such as uncharged linkers (e.g., methylphosphonate, phosphotriester, phosphoramidate, Mate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.).

The amino acid sequence translated from the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 12 as well as the mutant of the nucleotide sequence as well as the gene consisting of the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: . ≪ / RTI > The mutant is a gene consisting of a base sequence having a functional characteristic similar to the base sequence of SEQ ID NO: 1 to SEQ ID NO: 12 though the base sequence is changed. Specifically, the gene according to the present invention may include a nucleotide sequence having 80% or more, and preferably 84% or more, of the nucleotide sequence of the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 12. Also, the amino acid sequence according to the present invention may include an amino acid sequence translated from the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 12, and the protein according to the present invention may include the amino acid sequence translated from the nucleotide sequence of SEQ ID NO: RTI ID = 0.0 > amino acid < / RTI >

The invention (a) CHAT (choline acetyltransferase) gene, VACHT (vesicular acetylcholine transporter) genes, CHT (choline transporter) genes, CHRNA3 (nicotinic acetylcholine receptor α3) gene, (nicotinic acetylcholine receptor β3) CHRNB3 gene or CHRNB4 (nicotinic acetylcholine receptor < RTI ID = 0.0 > beta4) < / RTI >gene;

(b) measuring changes in the expression rates of the CHAT , VACHT , CHT , CHRNA3 , CHRNB3 or CHRNB4 genes before and after the drug candidate substance contact; And

(c) determining that the drug candidate substance is a preventive or therapeutic agent for depression when a change in the expression level of each gene is confirmed,

Wherein the cell of step (a) is a cell derived from Habenula. The present invention also provides a method for screening a preventive or therapeutic agent for depression.

The cell of step (a) may be a cell containing CHAT (choline acetyltransferase) gene.

(A) a choline acetyltransferase (CHAT) protein, a vesicular acetylcholine transporter protein, a choline transporter (CHT) protein, a nicotinic acetylcholine receptor 3 protein, a nicotinic acetylcholine receptor 3 protein or a nicotinic acetylcholine receptor receptor < RTI ID = 0.0 > (4) < / RTI > protein) to a cell comprising at least one selected from the group consisting of:

(b) measuring a change in the expression level or activity of each of the CHAT, VACHT, CHT, CHRNA3, CHRNB3 or CHRNB4 protein before and after the drug candidate substance contact; And

(c) determining that the drug candidate substance is a preventive or therapeutic agent for depression when a change in the expression level or activity of each protein is confirmed;

A method for screening a preventive or therapeutic agent for depression,

Wherein the cell of step (a) is a cell derived from Habenula. The present invention also provides a method for screening a preventive or therapeutic agent for depression.

The cell of step (a) may be a cell containing CHAT (choline acetyltransferase) protein.

In step (b), the protein expression rate or activity may be determined by measuring the amount of the protein present or the amount of the protein showing the active or inactive form using an antibody. Specifically, Western blotting, ELISA enzyme immunoassay, enzyme linked immunosorbent assay, radioimmunoassay, radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assay, A complement fixation assay (FACS), a protein chip, and the like, and any method conventionally performed in the art may be used. In the practice of the radiation immunoassay, radioimmunoassay diffusion method, etc., a radioactive isotope: can be used as a labeled (e.g., ¹⁴ C, ¹²⁵ I, ³² P and ³⁵ S) antibody.

In one embodiment of the present invention, the change in the protein expression rate was measured using Western blotting, but the present invention is not limited thereto.

The term " antibody " means a specific protein molecule indicated for an antigenic site, and the monoclonal antibody to the protein may be produced and used through a monoclonal antibody production method as is conventional in the art, Can be used. In addition, a polyclonal antibody recognizing the protein may be used instead of the monoclonal antibody, or it may be produced and used through an antiserum preparation method customary in the art.

The invention (a) for a cell derived from the reins nucleus (Habenula), each CHAT (choline acetyltransferase) gene, VACHT (vesicular acetylcholine transporter) genes, CHT (choline transporter) genes, CHRNA3 (nicotinic acetylcholine receptor α3) gene, CHRNB3 (nicotinic acetylcholine receptor β3) gene or CHRNB4 (nicotinic acetylcholine receptor β4) measuring the expression of the gene; And

(b) the expression level of each of the CHAT , VACHT , CHT , CHRNA3, CHRNB3 or CHRNB4 gene measured in the cell derived from Habenula without mental disease symptoms, And comparing the measured gene expression level with the measured gene expression level, the method comprising the steps of: (a)

(A) a choline acetyltransferase (CHAT) protein, a vesicular acetylcholine transporter (VACHT) protein, a choline transporter (CHT) protein, a nicotinic acetylcholine receptor α3 Measuring the expression level or activity of CHRNB3 (nicotinic acetylcholine receptor beta 3) protein or CHRNB4 (nicotinic acetylcholine receptor beta 4) protein; And

(b) determining the expression level or activity of the protein measured in the step (a) as a function of each CHAT, VACHT, CHT, CHRNA3, CHRNB3 or CHRNB4 protein measured on cells derived from Habenula without mental disease symptoms And comparing the expression level or the activity of the protein with the expression level or activity of the protein when the expression level or the activity of each protein measured in the step (a) is decreased.

The method for diagnosing depression may be performed in vitro.

The term " without mental illness symptoms " refers to the absence of symptoms associated with mental illnesses including mental illnesses, neuropathies and other personality disorders, more specifically symptoms of pathological mental conditions affecting accidents, feelings, it means.

The term " diagnosis " is intended to include determining the susceptibility of a subject diagnosed with depression after administering a prophylactic or therapeutic agent for depression such as a drug (or candidate drug) to the subject, determining whether the subject has depression presently (Eg, to confirm the relief of depressive symptoms), to determine the prognosis of the subject, or to monitor the status of the object to provide information about therametrics .

The present invention provides a choline acetyltransferase ( CHAT ) gene represented by SEQ ID NO: 1 or 2, a VACHT (vesicular acetylcholine transporter) gene represented by SEQ ID NO: 3 or SEQ ID NO: 4, CHT choline transporter) gene, SEQ ID NO: 7 or SEQ ID NO: nicotinic (CHRNA3 acetylcholine represented by the 8 receptor α3) gene, SEQ ID NO: 9 or SEQ ID NO: 10 as CHRNB3 (nicotinic acetylcholine receptor β3) gene or SEQ ID NO: 11 or SEQ ID NO: 12 represented And a gene for CHRNB4 (nicotinic acetylcholine receptor? 4) gene represented by SEQ ID NO: 1, which is represented by SEQ ID NO: 2, as an active ingredient.

The pharmaceutical composition for preventing or treating depression may comprise an RNAi sequence for CHAT (choline acetyltransferase) gene represented by SEQ ID NO: 1 or SEQ ID NO: 2 as an active ingredient.

The term " RNAi " is an abbreviation for RNA interference. When an agent that induces RNAi, such as double helical RNA (also referred to as dsRNA), is introduced into a cell, mRNA homologous thereto is specifically degraded, Is suppressed. The RNAi used here has the same meaning as the agonist inducing RNAi. 　

The RNAi is a process in which a short double-stranded RNA selectively degrades a target mRNA corresponding to its own base sequence to stop transcription and protein synthesis of a target gene, and siRNA (small interfering RNA) can be prepared by directly synthesizing siRNA in vitro and then introducing it into cells through transfection, and a method of expressing short hairpin RNA (siRNA) There is a way to utilize vectors. When an expression vector is used to express an shRNA expression vector in a cell through transformation, the sense and antisense sequence of the target sequence from the promoter is located at a position between the linker And thus, a small hairpin shRNA with a loop is synthesized. The shRNA thus synthesized is degraded by the RNase Ⅲ enzyme called Dicer, which is present in the cell, and converted into an siRNA of about 21 to 23 nucleotides having a correct structure, and a protein complex called RISC (RNA-induced silencing complex) It will be apparent to those of ordinary skill in the art to combine and disassemble the target mRNA. As such, siRNA can suppress the expression of a target gene, and thus it is provided by an efficient gene knockdown method, a gene silencing method, or a gene therapy method.

More specifically, shRNA (small hairpin RNA) is obtained by synthesizing an oligo DNA connecting 3 to 10 base linkers between the sense of a target gene siRNA sequence and complementary nonsense, and then cloning into a plasmid vector , Retroviruses such as lentivirus or adenovirus, and the RNA interference effect is relatively longer than that of siRNA.

The term " vector " means a DNA construct that retains a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in the appropriate host. The vector may be a plasmid, phage particle, or simply a potential genome insert. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. The vector of the present invention can typically be constructed as a vector for cloning or expression.

The pharmaceutical composition of the present invention may be prepared using pharmaceutically acceptable and physiologically acceptable adjuvants in addition to the active ingredients, and examples of the adjuvants include excipients, disintegrants, sweeteners, binders, coating agents, swelling agents, lubricants, Or a solubilizing agent such as a flavoring agent can be used.

The pharmaceutical composition of the present invention may be formulated into a pharmaceutical composition containing at least one pharmaceutically acceptable carrier in addition to the active ingredient for administration. Acceptable pharmaceutical carriers for compositions that are formulated into a liquid solution include sterile water and sterile water suitable for the living body such as saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, One or more of these components may be mixed and used. If necessary, other conventional additives such as an antioxidant, a buffer, and a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants can be additionally added and formulated into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Further, it can be suitably formulated according to each disease or ingredient, using the method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA, as appropriate in the field.

The pharmaceutical preparation form of the pharmaceutical composition of the present invention may be in the form of granules, powders, coated tablets, tablets, capsules, suppositories, syrups, juices, suspensions, emulsions, drips or injectable solutions, . The pharmaceutical composition of the present invention may be administered orally or parenterally through intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, intrasternal, percutaneous, intranasal, inhalation, topical, rectal, ≪ / RTI >

An effective amount of the active ingredient of the pharmaceutical composition of the present invention means an amount required for prevention or treatment of the disease. Accordingly, the present invention is not limited to the particular type of the disease, the severity of the disease, the kind and amount of the active ingredient and other ingredients contained in the composition, the type of formulation and the patient's age, body weight, general health status, sex and diet, Rate of administration, duration of treatment, concurrent medication, and the like. For example, in the case of an adult, it may be administered at a dose of 0.01 ng / kg to 10 g / kg for RNAi according to the present invention once to several times a day.

In one embodiment of the present invention, the RANi capable of knocking down the CHAT gene according to the present invention is designated as AAV- CHAT shRNA, and adenovirus vector AAV2 / 9 (adeno-associated virus 2/9) Based on A PGK promoter expressing EGFP and a U6 promoter expressing shRNA.

An animal model has also been established in one embodiment of the present invention. In an embodiment of the present invention, depression-related animal behavior tests were performed on rats in which the CHAT gene was knocked down by injecting AAV- CHAT shRNA, which is the RANi produced in the present invention. In particular, in the rat knocked down with the CHAT gene, VACHT protein expression other than CHAT is normally performed , and it is possible to individually monitor changes in inhibition / knockdown of expression of CHAT , VACHT , CHT , CHRNA3 , CHRNB3 or CHRNB4 gene or protein.

(A) measuring the expression level of CHAT (choline acetyltransferase) gene for cells derived from Habenula; And

(b) comparing the expression level of the gene measured in step (a) with the expression level of the CHAT gene measured on cells derived from Habenula without mental disease symptoms,

The present invention provides a method for diagnosing antiretroviral therapy refractory disorder, wherein the antidepressant agent is judged to be refractory to the antidepressant drug when the expression rate of the gene measured in step (a) is decreased.

(A) measuring the expression rate or activity of CHAT (choline acetyltransferase) protein for cells derived from Habenula; And

(b) comparing the expression level or activity of the protein measured in step (a) with the expression level or activity of the CHAT protein measured on cells derived from Habenula without mental disease symptoms So,

The present invention provides a method for diagnosing antiretroviral therapy refractory disorder, which is judged to be refractory to antidepressant drugs when the expression level or activity of the protein measured in step (a) is decreased.

The term " refractory to treatment " means a property that the symptom of the disease does not improve upon administration of a drug functioning as a therapeutic agent. In the present invention, the symptom of depression including an unpleasant sensation is not improved with respect to the antidepressant It means nature.

The antidepressant may be a serotonin uptake inhibitor and is preferably selected from the group consisting of fluoxetine, citalopram, Dapoxetin, escitalopram, fluvoxamine, paroxetine, But may be any one selected from the group consisting of paroxetine, sertraline, and zimelidine, and more preferably, it may be fluoxetine, but is not limited thereto.

The present invention relates to a method for producing a recombinant viral vector which expresses an RNAi sequence for CHAT (choline acetyltransferase) gene represented by SEQ ID NO: 1 or SEQ ID NO: 2; And

The method comprising knocking down the CHAT gene by injecting the recombinant viral vector into the brain Habenula of normal mammals other than humans, thereby providing an anti-depressant therapeutic animal model preparation method.

The present invention relates to a method for producing a recombinant viral vector which expresses an RNAi sequence for CHAT (choline acetyltransferase) gene represented by SEQ ID NO: 1 or SEQ ID NO: 2; And

And a step of knocking down the CHAT gene by injecting the recombinant viral vector into the brain Habenula of normal mammals other than humans.

The recombinant vector may be AAV-CHAT shRNA, which is a vector having cleavage map as shown in Fig. 3A.

The normal mammal other than human may be a mouse or a rat.

The present invention provides antidepressant treatment-refractory animal models prepared according to the methods of the present invention.

In addition, the present invention provides an anesthesia animal model prepared according to the method of the present invention.

According to the present invention, by analyzing the change of expression rate of cholinergic genes, drugs for preventing or treating depression can be screened, and further, depression can be diagnosed early or the prognosis can be analyzed.

The pharmaceutical composition for the prevention or treatment of depression according to the present invention can prevent or treat depression by controlling the expression of the cholinergic gene.

In addition, the development of an animal model with a pleuritic symptom, a key symptom of depression, and the development of a refractory animal model for antidepression can be applied to various studies to overcome the difficulties in the treatment of depression.

FIG. 1 shows the expression of six cholinergic genes in the bone tissue obtained from suicide depression patients. FIG. A is a diagram showing the separation of a human nuclear specimen. The nucleus is located on the 11th slab adjacent to the pineal gland of the brain (slab 1, frontal lobe; slab 18, occipital lobe); B is a schematic diagram of a common cholinergic synapse, showing that ACh (acetylcholine) neurotransmission via Ca ^{2 +} -dicturative docking, fusion, and cleavage at the cholinergic presynaptic nerve terminal membrane ; C shows mRNA expression of CHAT , VACHT , CHT , CHRNA3 , CHRNB3 and CHRNB4 , which are six cholinergic genes. CAMK2B is a control. The data in the graph were mean ± SEM (CON, control, n = 11; MDD, n = 12 subjects; * P <0.05, Mann-Whitney U- test).
Figure 2 shows the effect of chronic constriction stress (CRS) on the expression of cholinergic genes in the nucleus of the rats of rats. A is a schematic diagram illustrating the steps of a stress experiment and tissue sample extraction; B is a graph showing weight change during the stress test period. CRS was added from Day 8. NS, non-stressed, n = 4; CRS, n = 4 .; C and D show increased levels of plasma corticosterone due to CRS and adrenal hypertrophy. The data in the graph are mean ± SEM. * P < 0.05, ** P < 0.01, Student's t- test .; E and F show depressive behavior in rats exposed to CRS (anesthesia in the sucrose preference test (SPT), static attitude in the forced swimming experiment (FST)). The data in the graph are mean ± SEM. NS, n = 20; CRS, n = 20 rats, ** P < 0.01, Mann-Whitney U- test; G shows mRNA expression of the six cholinergic genes CHAT , VACHT , CHT , CHRNA3 , CHRNB3 and CHRNB4 in the nucleus of the rat exposed to CRS. CAMK2B is a control. The data in the graph are mean ± SEM. NS, n = 4; CRS, n = 4; * P <0.05, ** P <0.01, *** P <0.001, Mann-Whitney U- test; H is a diagram showing hybridization of brain tissue of rats exposed to CRS with a probe for six cholinergic genes and CAMK2B . Probe was reddish, and brain tissue was contrasted with blue (Hoechst). The inserted box is an enlarged image of the original image. The scale bar is 50 μm; inset, 5 μm.
FIG. 3 is a graph showing the effect of CHAT FIG. 5 is a graph showing an effect of knock-down. FIG. A above is CHAT AAV vector designed to induce knockdown (AAV- CHAT shRNA or AAV-sh-CHAT), and A below is a schematic diagram illustrating an experimental paradigm for behavioral testing of virus-infected rats. B is a photomicrograph of the nuclear structure of the rat-derived brass injected with AAV-sh-SCR (control) or AAV-sh-CHAT ( CHAT knockdown). CHAT Protein expression was red immunofluorescence, cell nucleus was blue (Hoechst), and virus infection was green (GFP). The inserted box is an enlarged image of the nucleus of the infected inner reinforcement. The scale bar is 50 μm; C is VACHT Lt; RTI ID = 0.0 &gt; AAV-sh-CHAT. &Lt; / RTI &gt; The nuclear nerves with AAV-sh-CHAT injected were immunostained with VACHT (red) and EGFP (green). The scale bar is 50 μm; D and E were obtained from Western blots of CHAT and VACHT from the nucleus of the rat injected with AAV-sh-SCR (control) or AAV-sh-CHAT Fig. The data in the graph were mean ± SEM (sh-SCR, n = 4 rats; sh-CHAT, n = 4; * P <0.05, Student's t- test).
FIG. 4 is a graph showing antidepressant treatment refractoryness in an animal model of CHAT knockdown in medial rein nucleus (MHb). A is a schematic diagram showing a paradigm for testing antidepressant therapy refractoryness in a CHAT knockdown animal model. B is the sucrose preference in the sucrose preference test of the CHAT knockdown animal model, C is the total solution intake in the sucrose preference experiment, and D is the dwell time in the forced swimming experiment (FST). The data in the graphs were mean ± SEM (sh-SCR + Sal, AAFV-sh-SCR + saline, n = 9 mice, sh-CHAT + Flx, AAV-sh-CHAT + fluoxetine, n = 15, , Student's t-test).
FIG. 5 is a graph showing the effect of the inhibitory nuclear nerve cell activation on the dopaminergic neurons in the blind meridians. A is a schematic diagram showing the injection of Cre-dependent hM3Dq virus (AAV-hM3Dq-mCherry) into CHAT-cre mice. B is a figure showing that the mCherry fusion hM3Dq protein is expressed in the CHAT positive reinforcement nucleolus neurons. CD shows the induction of c-Fos expression (green) in hippocampal nuclear cholinergic neurons expressing hM3Dq-mCherry (red). EH shows c-Fos immunoreactivity (green) in TH-positive cells (ie, dopamine neurons; white) or TH-negative cells upon administration of CNO. Yellow arrowheads represent TH-positive and c-Fos positive cells. I shows that in CNO injected DREADD mice 64.5% of dopamine neurons (cells n = 49 from 2 mice) and 35.5% of non-dopamine cells are c-Fos positive. In contrast, saline-infused DREADD mice, dopamine neurons (n = 10 cells 2) and 88.9% of non-dopamine cells were c-Fos positive. The scale bar is BF, 100 μm; G and H, 10 탆.
6 is a graph showing the effect of the nuclear nuclear nerve cell activation on the seam nuclear serotonin neuron. AB is a visualization of the nucleus (blue) and 5-HT (red) in DREADD mice expressing Cre-dependent hM3Dq, respectively. CD visualizes the nucleus (blue) and 5-HT (red) in the CHAT knockdown animal model, respectively. Mean ± SEM (sh-SCR, n = 5 mice, sh-CHAT, n = 5, ** P <0.01, Student's t-test). The scale bar is 100 μm.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

< Example  1> Preparation of Human Brain Sample and Reinuclear ( Habenula ) Incision

Human brain tissue was obtained from DBCBB (Douglas Bell Canada Brain Bank, Douglas Mental Health University Institute, Canada) and 12 suicides (age, 41.5 ± 4.02 years; Postmortem intervals, 37.36 ± 4.23 hours, pH, 6.48 ± 0.09) and 11 healthy controls (mean age, 44 ± 3.04 years, sex, male, postmortem intervals, 25.78 ± 4.52 hours, ; pH, 6.67 + 0.04). There were no significant differences in age, gender, post spacing, and pH in the test and control groups. Specifically, the center of the brain stem was dissected and divided into the left hemisphere and the right hemisphere, and the cerebellum and meninges of each hemisphere were removed. The nerve trunks from the hemispheres between the mammillary body and superior colliculus were separated using a scalpel. The pH of the sample was measured using cerebellum. To make the slabs, the hemispheres were placed on a cutting plate with the median face facing downward, and then cut into 18-20 pieces to form coronally, And frozen, respectively (Fig. 1A). The halftone nucleus was present in the 11th or 12th slab (thick slices of the brain) and was gently removed from the frozen plate using a round burin with a tip.

< Example  2> qRT - PCR  Reinforcement through nuclear ( Habenula ) Origin Choline ( Cholinergic ) Gene mRNA expression rate analysis

QRT-PCR (quantitative real-time polymerase chain reaction) analysis based on TaqMan probe was performed to analyze the mRNA expression rate of choline nucleus-derived choline genes in the human brain samples obtained from Example 1. Total RNA samples (500 ng) were reverse transcribed using reverse transcriptase (Invitrogen, USA) and random primers. RNA integrity was analyzed using an analyzer (Agilent 2100 Bioanalyzer, Agilent Technologies, USA). The stability of 28s ribosomal DNA was determined by PCR, and there was no change in the test (suicide) and control (normal) (28S rDNA expression stability: control, 6.123 ± 0.1487; test group, 6.154 ± 0.0728; Mann-Whitney U- test, P = 0.4235).

The housekeeping reference genes such as GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), TBP (TATA-binding protein) and CYC1 (cytochrome c-1) .

Gene symbol Slope R ² Efficiency  ( % ) GAPDH -3.309475 0.9978 100 TBP -3.3670 0.99617 99.3 CYC1 -3.33036 0.99617 98.6

The reaction efficiency value was calculated from the equation E = 10 ^{(-I / slope)} . E is the efficiency, and the slope is the slope of the optimal line.

qRT-PCR was performed using TaqMan master mix (TaqMan Expression Assay, TaqMan Expression Assay, LightCycler 1.5 Instrument, Roche, Switzerland) according to the manufacturer's method, 2 μl of cDNA, 1 μl of TaqMan Expression Assay specific for each quantitative gene, Mastermix, Applied Biosystems, USA). The standard curve is expressed as a pool of cDNAs from all individuals. Expression levels were measured using the Absolute Quantification standard curve method using GAPDH . PCR was performed for 5 minutes at 95 ° C, 50 times at 95 ° C for 10 seconds, and 30 minutes at 60 ° C. In Table 2, the context sequence (the nucleotide sequence around the site to which the probe binds) is a probe sequence prepared and sold for the TaqMan assay, which was ordered from Thermo Fisher SCIENTIFIC. CHT prepared the primer and made a probe for it by commissioning it to Thermo Fisher SCIENTIFIC. Primers and probes are available at http://www.appliedbiosystems.com. F is a forward primer, and R is a reverse primer.

Gene
symbol TaqMan
assay ID Primer sequence  5 '- &gt; 3' Context sequence SLC18A3
( VACHT ) Hs00268179_s1 - GTCATCGTGCCCATAGTGCCCGACT
(SEQ ID NO: 13) SLC5A7
( CHT ) Custom F: GAACATCTACCAGCTTTCCTTCAGA
(SEQ ID NO: 14)
R: TGATTCGCATAACCCAAACGATTTC
(SEQ ID NO: 15) - CHAT Hs00252848_m1 - AGTGAGGAGTCTGGGCTGCCCAAAC
(SEQ ID NO: 16) CHRNA3 Hs01088199_m1 - ACCTGTGGCTCAAGCAAATCTGGAA
(SEQ ID NO: 17) CHRNB3 Hs00181269_m1 - TTGAAAATGCTGACGGCCGCTTCGA
(SEQ ID NO: 18) CHRNB4 Hs00609520_m1 - CCTTTGCGGGCGCGGGAACTGCCGC
(SEQ ID NO: 19) CAMK2B Hs00365799_m1 - AGCATTCCAACATCGTGCGTCTCCA
(SEQ ID NO: 20) GAPDH Hs99999905_m1 - GGGCGCCTGGTCACCAGGGCTGCTT
(SEQ ID NO: 21) TBP Hs99999910_m1 - GCAGCTGCAAAATATTGTATCCACA
(SEQ ID NO: 22) CYC1 Hs00357717_m1 - TCTTAGAGTTTGACGATGGCACCCC
(SEQ ID NO: 23)

As a result, choline transporter CHT (fold change, control vs. test group: 1.000 ± 0.237 vs. 0.460 ± 0.117, P = 0.025) and CHRNB3 (fold change, control vs. test group: 1.000 ± 0.308 vs (0.394 ± 0.126, P = 0.046) was significantly decreased in the test group compared to the control group, and CHAT (choline acetyltransferase) (fold change, control vs. test group: 1.000 ± 0.509 vs. 0.436 ± 0.188, P = 0.559 ), VACHT (fold change, control vs. experimental group: 1.000 ± 0.227 vs. 0.833 ± 0.216, P = 0.186), CHRNA3 (fold change, control vs. test group: 1.000 ± 0.475 vs. 0.488 ± 0.154, P = 0.442) and CHRNB4 (fold change, control vs. test group: 1.000 ± 0.450 vs. 0.489 ± 0.257, P = 0.207) showed a tendency to decrease in the test group but no significant change 1C). In addition, CAMK2B (βCaMKII), the excitatory neural marker used as a negative control, did not change (fold change, control: test group: 1.000 ± 0.099 vs. 1.268 ± 0.160, P = 0.282).

< Example  3> Biological and behavioral changes of experimental animals according to stress exposure

<3-1> Chronic Constraint Stress chronic restraint stress , CRS induction

All animal procedures were carried out according to the approval of Korea University Animal Care and Use Committee and the guidelines of Korea University. The experimental animals used were Sprague-Dawley (SD) male rats (Japan SLC, Inc., Japan) and protocols for inducing chronic restraint stress (CRS) The procedure is based on the method of Andrus BM., Et al., Gene expression patterns in the hippocampus and amygdala of endogenous depression and chronic stress models, Mol Psychiatry., 2012; 17 (1): 49-61. Respectively. The animals were randomly divided into two groups: chronic restraint stress (CRS) and control (non-stressed, NS). As shown in FIG. 2A, the test piece was exposed to restraint stress for 2 hours each day for 2 weeks, and the control was left in the home cage and left for 5 minutes a day. During restraint, the rats were left in a breathable plastic cone (DC 200, DecapiCones, Braintree Scientific, USA) and sacrificed immediately after the last stress exposure on the last day of the stress period.

<3-2> Weight measurement

The body weight gain of the experimental animals (CRS) exposed to chronic restraint stress for 2 weeks was 50.400 ± 10.289 g, which was significantly lower than that of the control (NS) body weight of 97.667 ± 3.989 g ( P = 0.001) (Fig. 2B).

<3-3> Plasma Corticosterone ( corticosterone ) Level measurement

Immediately after cutting the neck of the experimental animal sacrificed in Example 3-1, the blood of the large blood vessel was collected and centrifuged at 10,000 xg and 4 ° C for 10 minutes. After separation of plasma, circulating corticosterone (circulating corticosterone) Levels were measured by radioimmunoassay using a kit (Coat-a-Count Rat Corticosterone kit, TKRC1, Siemens Healthcare Diagnostics, USA).

As a result, it was confirmed that the control (NS) was 125.771 ± 46.434 mg / mL and the CRS was 591.466 ± 99.732 mg / mL, which was significantly higher in the test group ( P = 0.002) (FIG.

<3-4> Adrenal adrenal gland ) Weighing

The weight of the adrenal gland of the experimental animal sacrificed in Example 3-1 was measured and found to be 127.661 ± 8.783 μg / g (body weight) in the control (NS) and 180.106 ± 12.075 μg / g (CRS) Body weight) ( P = 0.006) (Fig. 2D).

<3-5> Sucrose Preference Test sucrose preference test , SPT )

Animal behavior experiments were performed including sucrose preference test (SPT) and forced swim test (FST).

In the sucrose preference test, all rats were individually housed in individual cages and tilled into two beverage containers of 1% sucrose solution and tap water for 2 days prior to the start of the experiment. To reduce the preference for certain beverages, the positions of the two beverage containers were switched daily. On the day of the experiment, the animals were exposed to the same two beverage containers without water for 12 hours, and after 1 hour exposure, the weight of the container before the experiment and the weight of the container after the experiment were compared to record the sucrose aqueous solution and water intake . Sucrose preference was calculated by relative ratio (sucrose aqueous solution intake / total solution intake,%).

As a result, the intake of sucrose aqueous solution was significantly lower in the control group (NS) and the test group (CRS) was 85.083 ± 2.999 and 61.875 ± 5.991%, respectively, indicating anhedonia-like phenotype in the CRS model of depression ( P = 0.002) (Fig. 2E).

<3-6> Forced swimming experiment forced swim test , FST)

For forced swimming experiments, rats were exposed to cylinders filled with water at 24 - 25 ° C for 15 minutes 24 hours prior to the experiment. Experiments were carried out 24 hours later, and animal behavior was recorded using an infrared camera for 5 minutes. The diameter of the cylinder was 45 cm and the height was 60 cm. The depth of the water was set so as to measure active (swimming and climbing) or static (floating) behavior without the animal's limbs touching the floor.

As a result, it was confirmed that the immersion time was longer in the test group than in the control group (NS) of 120.00 ± 12.429 sec and the CRS was 170.00 ± 14.500 sec, indicating that the test group behaved like despair ( P = 0.002) (Fig. 2F).

< Example  4> Receptor nuclei of experimental animals ( Habenula ) Origin Choline ( Cholinergic ) Of the gene mRNA  Expression rate and analysis

Rats according to Example 3-1 were isolated from the brain immediately after amputation in the RNA stabilization solution (RNA later Stabilization Solution, AM7020, Ambion, USA). Total RNA was extracted using TRIZOL reagent (Invitrogen, USA). Total RNA samples (1 μl) were reverse transcribed using reverse transcriptase (Promega, USA) and oligo (dT) primer (oligo (dT) primer). Then 0.25 ug of the reverse transcribed product was used in a qPCR master mix (Thermo Sciencific Maxima SYBR Green qPCR Master Mix (2x), # K0251, Fermentas, USA) using a specific primer set and analyzer (LightCycler 1.5 Instrument, Roche, Switzerland) To perform qRT-PCR. The specific primer sets used were as shown in Table 3.

Gene symbol
Primer sequence 5 '→ 3' Size (bps)
Forward primer Reverse primer SLC18A3 (VACHT) AAACATCGTCCACTGGTCC
(SEQ ID NO: 24) CTTTCCCTAAGATGCCTCCAC
(SEQ ID NO: 25) 213 SLC5A7 (CHT) TTTCCAGATCCCAAGACCAAG
(SEQ ID NO: 26) ATGCTCCAAACACAAACACAG
(SEQ ID NO: 27) 253 CHAT TCCAAGACACCAATGACCAG
(SEQ ID NO: 28) GGACGCCATTTTGACTATCTTTC
(SEQ ID NO: 29) 350 CHRNA3 TTCTACCTGCCCTCCGACTGT
(SEQ ID NO: 30) AATCCCGCCGTTCCTAAAATG
(SEQ ID NO: 31) 594 CHRNB3 GAAAGGAGAGTGATACAGCCG
(SEQ ID NO: 32) AGAAAGAGCCACAGGAAGATG
(SEQ ID NO: 33) 223 CHRNB4 CTATCACTGTCCCAGCTCATC
(SEQ ID NO: 34) AGAACCATGTCAATCTCCGTG
(SEQ ID NO: 35) 377 CAMK2B CAGAAGCTGAGGGCCTCCCA
(SEQ ID NO: 36) GGTCACAGATTTTCGCATAGG
(SEQ ID NO: 37) 167 GAPDH CCTTCATTGACCTCAACTACAT
(SEQ ID NO: 38) CAAAGTTGTCATGGATGACC
(SEQ ID NO: 39) 497

The final product of qPCR was visualized by electrophoresis on 2% agarose gel and nucleic acid staining (View Nucleic Acid Stain, G108, Applied Biological Materials, Canada). The cycle number (C _t ) of the critical point for the fluorescent signal exceeding the background in each gene was measured by qRT-PCR, and then the expression value of each gene was expressed in the expression of GAPDH, an endogenous control in each sample . Relative amount to calculate the difference between the drain and the control plots was done using the comparative C _t method _{(comparative C t method, DDC t} ).

As a result, it was confirmed that CHAT , VACHT , CHT , CHRNA3 , CHRNB3 And confirming that the mRNA expression of the gene CHRNB4 reduced both compared with the control group (NS) (fold change, the control vs. test group: CHAT, 1.000 ± 0.087 vs. 0.579 ± 0.024, P = 0.0004; VACHT, 1.000 ± 0.085 vs. 0.686 ± 0.027, P = 0.0033; CHT, 1.000 ± 0.069 vs. 0.624 ± 0.025, P = 0.0002; CHRNA3, 1.000 ± 0.070 vs. 0.649 ± 0.031, P = 0.0004; CHRNB3, 1.000 ± 0.025 vs. 0.638 ± 0.049, P = 0.0001; CHRNB4 , 1.000 占.085 vs. 0.611 占.33 , P = 0.0008) (Fig. 2G). Fold change in the negative control CAMK2B (control vs. test group: 1.000 ± 0.048 vs. 1.136 ± 0.075, P = 0.1484).

This was consistent with the gene expression rate in depressed suicide.

< Example  5> Inner reinforcement nucleus ( Medial Habenula , MHb ) Origin Choline (Cholinergic) gene mRNA  Expression rate and analysis

In order to analyze the mRNA expression rate of the MHb-derived cholinergic gene of the rat according to Example 3-1, a previous study (Stempel AJ, et al., Simultaneous visualization and cell-specific confirmation of RNA and protein in the mouse retina, Mol Vis , 2014; 20: 1366-73). In situ hybridization histochemical method ( In situ hybridization histochemistry). Specifically, the brain of the rats isolated according to Example 4 was cut into a tubular section with a thickness of 14 [mu] m so that the nucleus of the rein was visible in the same manner as in Example 1. [ The brain sections were thawed and placed on a microscope slide (Superfrost Plus Microscope Slides, Fisher Scientific, USA) and fixed in 4% formaldehyde for 10 minutes. Afterwards, the concentration of ethanol was gradually increased and dehydrated for 5 minutes and dried naturally. The dried tissue was pretreated with protease at room temperature for 10 minutes. Amplifier 1-FL, Amplifier 2-FL, Amplifier 3-FL, and Amplifier 4 Sub B-FL in a hybridization oven (Advanced Cell Diagnostocs, USA) Was treated and incubated. The labeled probe was conjugated with a fluorescent label (Altto 550). The brain sections were hybridized for 2 hours per slide at 40 ° C using labeled probe mixtures. Nonspecific hybridization probes were removed by washing and washed three times with 1 × wash buffer at room temperature for 30 minutes at 40 ° C., 30 minutes with amplification solution 1-FL, 15 minutes with amplification solution 2-FL, Solution 3-FL for 30 min and Amplification Solution 4 for Alt B-FL for 15 min. Each amplification solution was washed with 1 × wash buffer for 2 minutes at room temperature. Slides were observed and analyzed and photographed with a microscope (LSM 700 microscope, Zeiss, Germany). Image analysis was performed using image J program. The nucleotide sequence used to produce the probe was: CHAT (choline acetyltransferase), 259-1141 of NM_001170593.1 (NCBI Gene accession number); VACHT (vesicular acetylcholine transporter), 1693-2837 of NM_031663.2; CHT (choline transporter), 123-998 of NM_053521.1; CHRNA3 , 984-2228 of NM_052805.2; CHRNB3 , 255-1336 of NM_133597.1; CHRNB4 , 1139-2433 of NM_052806.2; CAMK2B , 1439-3560 of NM_001042354.1 (Advanced Cell Diagnostics, USA).

As a result, mRNA expression of the cholinergic gene was decreased in the dorsal MHb of the test group (CRS), and there was no change in negative control CAMK2B (Fig. 2H).

< Example  6> medial rein nucleus ( Medial Habenula , MHb ) My CHAT For gene knock-down RNAi (RNA interference) production and CHAT gene melt Induce knock-down

In order to inhibit the activity of cholinergic neurons in MHb, the expression of CHAT RNA interference (RNA interference) was generated. Specifically, virus vector AAV2 / 9 (adeno-associated virus 2/9) was prepared AAV-CHAT-RNAi was constructed using pAAV-U6-GFP vector (Cell Biolabs, Inc., USA) containing a PGK promoter expressing EGFP and a U6 promoter expressing shRNA (FIG. The fabricated AAV- CHAT -RNAi will pass the RNAi for gene CHAT, named AAV- CHAT shRNA or AAV-sh-CHAT, and in the graph was expressed as sh-CHAT (Fig. 3). The nucleotide sequence of the CHAT shRNA was 5'-GAGCGAGCCTTGTTGACAT-3 '(SEQ ID NO: 40) and the nucleotide sequence of the scrambled RNAi (shRNA) as a control without the suppression function of CHAT was 5'-TCGTCATAGCGTGCATAGG-3' ). Adeno-Associated Virus (AAV) virus packaging was supported by the Penn Vector Core of the University of Pennsylvania.

For viral injection, an 8-week-old SD rats were anesthetized with an intraperitoneal injection (ip injection) of pentobarbital at a dose of 50 mg / kg body weight, followed by a stereotaxic apparatus . Afterwards, a microinjection cannula (30 gauge, Plastics One, USA) at a low speed (50 nl / min) was placed on both sides of the MHb (located in the bregma: -3.0 mm anterior / posterior, And 1 μl of concentrated AAV was injected in the medial / lateral (medial / lateral), -5.28 mm (dorsal / ventral), and 26 ° angle in the midline direction in the coronal plane. The microinjection cannula was slowly withdrawn 20 minutes after virus injection.

< Example  7> medial rein nucleus ( Medial Habenula , MHb ) My CHAT Silencing (silencing)  Whether black

AAV-mediated CHAT according to Example 6 To confirm silencing, a rat brain section (30 μm) in a coronary tube with permeability imparted with a solution containing 0.3% Triton X-100 in PBS (phosphate buffer saline) was diluted with ChAT (1: 100, abcam, UK ), Primary antibody for EGFP (1: 500, abcam, UK) and VAChT (1: 500, synaptic system, Germany) and incubated with Cy3 and Alexa 488 conjugated secondary antibody ) (Jackson Immunoresearch, USA). Nuclei were visualized using Hoechst (1: 1000, Invitrogen, USA) staining. Fluorescence images were obtained using a confocal microscope (LSM710, Zeiss, Germany).

To perform western blotting, after 3 weeks (21 days) following the surgical treatment (injection) according to Example 6, a nuclear nuclear tissue lysate was obtained to obtain 15 μg of the nuclear protein derived from the nucleus . The nucleus-derived protein was isolated using SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membrane (GE Healthcare, UK). The membranes were blocked with PBS containing 5% (w / v) skim milk, 0.25% (v / v) tween-20 for 1 hour, followed by goat anti-ChAT (goat anti-ChAT, (mouse anti-β-actin, 1: 5000, Sigma-Aldrich, USA) and rabbit anti-VAChT (1: 1000, synaptic system, Germany) And incubated at 4 ° C overnight. Then, the cells were reacted with a secondary antibody (Life Technologies, USA) conjugated with horseradish peroxidase. Proteins were detected using a kit (ECL chemiluminescence detection kit) (GE Healthcare, UK). The same amount of protein was analyzed by immunoblotting against [beta] -actin.

As a result, the CHAT prepared in Example 6 SiRNAs (sh-CHAT) that specifically target transcripts Control group Compared to a scrambled (scrambled) siRNA (sh-SCR ) comprising a siRNA target sequences were effectively inhibit protein expression CHAT (sh-SCR vs. sh-CHAT : 1.000 ± 0.208 vs. 0.414 ± 0.142, P = 0.043) (Figures 3B, D and E). The VACHT gene is located in the first intron of the CHAT gene, but VACHT expression was not affected by sh-CHAT (sh-SCR vs. sh-CHAT: 1.000 ± 0.106 vs. 1.175 ± 0.027, P = 0.386) 3C-E). From these results, it was confirmed that sh-CHAT specifically inhibited CHAT protein expression.

< Example  8> medial rein nucleus ( Medial Habenula , MHb ) My CHAT Animal behavior change test due to gene knock-down

Animal behavior tests were performed at least 21 days after the surgical treatment (injection) according to Example 6 and were performed in Examples 3 and 4, including the sucrose preference test (SPT) and the forced swim test (FST) Was performed in the same manner (Fig. 3A, below). At the end of all behavioral studies, the injection site was examined and only the data of the experimental animals with the correct injection were included.

As a result, the total solution uptake of the expression of CHAT reduced rats (sh-CHAT) and CHAT control rats (sh-SCR) expression was not decreased in the can, but the difference, the sucrose solution intake in the expression is reduced rats CHAT (Sh-SCR vs. sh-CHAT: 82.400 + 3.916% vs 64.148 + 4.726%, P = 0.007).

In addition, there was no effect on immobility time in forced swimming experiments (sh-SCR vs. sh-CHAT: 174.25 ± 19.636 s vs. 147.963 ± 13.197 s, P = 0.255).

This suggests that inactivation of the cholinergic signal in the nucleus of the brass does not induce desensitization but induce despair.

< Example  9> medial rein nucleus ( Medial Habenula , MHb ) My CHAT Antidepressant treatment of gene knock-down mouse model Drugs by long-term injection Refractory (drug treatment-refractory) test

Surgical treatment (injection) according to Example 6 resulted in a CHAT gene knock-down mouse model The current representative antidepressant fluoxetine (Prozac, selective serotonin reuptake inhibitor, SSRI, Sigma-Aldrich) was diluted in PBS to prepare an injectable fluoxetine solution, which was administered intraperitoneally once a day for more than 2 weeks sucrose preference test (SPT) and forced swim test (FST) were performed for control (scrambled siRNA, saline administration) after intraperitoneal injection (ip, 10 mg / 3 (Fig. 4A).

As a result, in the group of animals administered with fluoxetine, the sucrose preference decreased and the mitigating effect of the no-pleuritic effect was not exhibited at all, and the phenotype for despair did not change as in the previous results (Fig. 4B-D).

Thus, inhibition of the expression of CHAT specifically in the nuclear-cholinergic neurons of the reinforcement . Anorexia , which is seen in animal models, does not show therapeutic response by fluoxetine, and this results in controlling specific molecular substances of specific neurons located in specific regions of the brain Suggesting the possibility of treatment failure.

In view of the current trend of developing a refractory animal model in order to overcome the difficulties of treating depression, the present invention is based on the development of an animal model of anesthetics, a key symptom of depression, . These results are consistent with the results of previous clinical studies that anorexia is difficult to treat with fluoxetine.

< Example  10> DREADD  Reinforced core utilizing system ( Habenula ) My Choline  Activation of monoamine neurons by activation of neurons

Recently, it has been suggested that DREADD (Designer receptors exclusively activated by designer drug), a technique that can be used as an alternative to photogenetics, allows an experimenter to artificially control the degree of specific cell activity, And its relationship with neurons was confirmed.

1 μl of a virus (AAV-DIO-hSyn-hM3Dq-mCherry, FIG. 5A) capable of expressing Cre protein-dependent expression of hM3Dq, an artificially generated G protein-coupled receptor, was regulated in bregma, -3.14 mm front / back, ± 0.83 mm inside / side, -3.05 mm 10 ° angle from the back / abdomen and coronal plane towards the midline. After 4 weeks, the expression of hM3Dq-mCherry specific to choline nucleus in the nuclear nucleus of ChAT-cre transgenic mice was verified by immunohistochemistry using a specific antibody against ChAT protein 5B). In this study, we compared the effects of CNO (clozapine N-oxide, 5 mg / kg, Enzo Life Sciences, NY, USA)

Immunohistochemistry was performed in a mouse cerebral coronal slice (30 μm) with CHAT (1: 100, abcam), EGFP (1: 500, abcam), VACHT Immersed in 0.3% Triton X-100 PBS containing a primary antibody against 5-hydroxytryptamine, serotonin (1: 2000, ImmunoStar) and then incubated with secondary antibodies (Jackson Immunoresearch) coupled with Cy3- and Alexa 488- Lt; / RTI &gt; Nuclei were visualized using Hoechst (1: 1000, Invitrogen). Fluorescence images were obtained using a confocal microscope (LSM710).

Since the hM3Dq receptor for CNO promotes the activity of the cell, the expression of c-Fos, which is a cell activating molecule marker, was observed. As a result, the expression of c-Fos rapidly increased in the nucleus of the injected CNO-injected c-Fos (FIG. 5C-D).

In the ventral tegmental area, where dopamine secretory neurons are concentrated, the c-Fos of dopaminergic neurons (TH-positive cells) is increased while the cell-activating molecule marker, c-Fos, C-Fos of TH-negative cells was decreased (Fig. 5E-I). These results suggest that anthropogenic activation of the nuclear - cholinergic neurons in the rat can increase the activity of dopaminergic neurons in the dorsal skeletal muscle.

In addition, serotonergic neurons in the raphe nucleus, where serotonin-secreting neurons are present, were analyzed by immunohistochemistry using anti-5-HT antibodies As a result, it was confirmed that the content of serotonin in the cells was decreased when CNO was treated to activate the nucleus cholinergic neurons (FIG. 6A-B). On the contrary, it was confirmed that the serotonin content in serotonin neurons was increased in the animal model in which the expression of CHAT was specifically inhibited by the nuclear nuclear cholinergic neuron of the reinforcement , compared with the control (Fig. 6C-D). Thus, the decrease and increase of serotonin content in serotonin neurons seemed to be related to the increase and decrease of serotonin secretion outside the cell, respectively.

As shown in the above results, the change in the activity of the nuclear nuclear cholinergic neurons is closely related to the activity of dopamine and serotonergic neurons. Thus, the nucleus cholinergic neurons in the nucleus are involved in the regulation of the secretion of dopamine and serotonin, It was confirmed that the brain region plays a key role.

Statistical analysis according to the present embodiment was performed using SPSS v. Windows (Windows, IBM corp., USA). 22 &lt; / RTI &gt; The Student's t- test was applied when the data set was modeled as a normal distribution and the non-parametric data set was non-parametric Mann-Whitney U- test) was applied. P <0.05 was considered valid, and the values were expressed as mean ± SEM (standard error of the mean).

<110> Korea University Research and Business Foundation <120> Use of Cholinergic genes for treating depressive disorder <130> DHP16-588 <160> 41 <170> KoPatentin 3.0 <210> 1 <211> 1893 <212> DNA <213> Homo sapiens <400> 1 cgtgcccccg ctgcagcaga ccctggccac gtacctgcag tgcatgcgac acttggtgtc tgaggagcag 120 ttcaggaaga gccaggccat tgtgcagcag tttggggccc ctggtggcct cggcgagacc 180 ctgcagcaga aactcctgga gcggcaggag aagacagcca actgggtgtc tgagtactgg 240 ctgaatgaca tgtatctcaa caaccgcctg gccctgcctg tcaactccag ccctgccgtg 300 atctttgctc ggcagcactt ccctggcacc gatgaccagc tgaggtttgc agccagcctc 360 atctctggtg tactcagcta caaggccctg ctggacagcc actccattcc cactgactgt 420 gccaaaggcc agctgtcagg gcagcccctt tgcatgaagc aatactatgg gctcttctcc 480 tcctaccggc tccccggcca tacccaggac acgctggtgg ctcagaacag cagcatcatg 540 ccggagcctg agcacgtcat cgtagcctgc tgcaatcagt tctttgtctt ggatgttgtc 600 attaatttcc gccgtctcag tgagggggat ctgttcactc agttgagaaa gatagtcaaa 660 atggcttcca acgaggacga gcgtttgcct ccaattggcc tgctgacgtc tgacgggagg 720 agcgagtggg ccgaggccag gacggtcctc gtgaaagact ccaccaaccg ggactcgctg 780 gacatgattg agcgctgcat ctgccttgta tgcctggacg cgccaggagg cgtggagctc 840 agcgacaccc acagggcact ccagctcctt cacggcggag gctacagcaa gaacggggcc 900 aatcgctggt acgacaagtc cctgcagttt gtggtgggcc gagacggcac ctgcggtgtg 960 gtgtgcgaac actccccatt cgatggcatc gtcctggtgc agtgcactga gcatctgctc 1020 aagcacatga cgcagagcag caggaagctg atccgagcag actccgtcag cgagctcccc 1080 gccccccgga ggctgcggtg gaaatgctcc ccggaaattc aaggccactt agcctcctcg 1140 gcagaaaaac ttcaacgaat agtaaagaac cttgacttca ttgtctataa gtttgacaac 1200 tatgggaaaa cattcattaa gaagcagaaa tgcagccctg atgccttcat ccaggtggcc 1260 ctccagctgg ccttctacag gctccatcga agactggtgc ccacctacga gagcgcgtcc 1320 atccgccgat tccaggaggg acgcgtggac aacatcagat cggccactcc agaggcactg 1380 gcttttgtga gagccgtgac tgaccacaag gctgctgtgc cagcttctga gaagcttctg 1440 ctcctgaagg atgccatccg tgcccagact gcatacacag tcatggccat aacagggatg 1500 gccattgaca accacctgct ggcactgcgg gagctggccc gggccatgtg caaggagctg 1560 cccgagatgt tcatggatga aacctacctg atgagcaacc ggtttgtcct ctccactagc 1620 caggtgccca caaccacgga gatgttctgc tgctatggtc ctgtggtccc aaatgggtat 1680 ggtgcctgct acaaccccca gccagagacc atccttttct gcatctctag ctttcacagc 1740 tgcaaagaga cttcttctag caagtttgca aaagctgtgg aagaaagcct cattgacatg 1800 agagacctct gcagtctgct gccgcctact gagagcaagc cattggcaac aaaggaaaaa 1860 gccacgaggc ccagccaggg acaccaacct tga 1893 <210> 2 <211> 1935 <212> DNA <213> Rattus norvegicus <400> 2 atgcccatcc tggaaaaggc tccccaaaag atgcctgtaa aggcttctag ctgggaggag 60 ctggacttac ctaaattacc agtgcccccg ctgcagcaaa ccctggccac ctacctacag 120 tgcatgcagc atctggtacc tgaagagcag ttcaggaaga gccaggccat tgtgaagcgg 180 tttggggccc ctggtggcct gggtgagacc ctgcaggaaa agctcttgga gagacaggag 240 aagacagcca attgggtctc tgaatactgg ctgaatgaca tgtacctgaa caaccgcctg 300 gccctgccag tcaactccag ccctgctgtg atctttgctc ggcagcactt ccaagacacc 360 aatgaccagc taagatttgc agcctgcctc atctctggtg tgcttagcta caaaactctg 420 ctggacagcc actcccttcc cactgactgg gccaaggggc agctctcagg gcagcccctc 480 tgtatgaagc aatattacag actcttctcc tcttaccggc ttcctggcca tacccaggac 540 acactggtgg cccagaagag cagtatcatg cccgagcctg agcatgtcat cgtggcctgc 600 tgcaaccagt tctttgtctt ggatgttgtc attaatttcc gccgtctcag tgagggtgat 660 ctgttcactc agttgagaaa gatagtcaaa atggcgtcca acgaggatga acgcctgcct 720 ccaatcggcc tgctgacgtc agacgggagg agcgagtggg ccaaggccag gacggtcctc 780 ttaaaagact ccaccaaccg ggactccctg gacatgatcg agcgctgcat ctgcctggta 840 tgcctggatg gtccaggcac aggagagctc agtgacaccc acagggccct ccaactcctt 900 cacggtggag gctgcagcct gaacggagcc aatcgctggt atgacaagtc cctgcagttc 960 gtggtgggcc gagatggcac ctgcggtgtg gtgtgtgagc attctccatt tgatggcatc 1020 gtcctggtgc agtgcacaga gcacctgctg aaacatatga tgacaagcaa caagaagctc 1080 gtcagggctg actcagtgag tgagctccct gcccccagaa ggctgaggtg gaaatgttcc 1140 ccagaaaccc aaggccatct cgcctcctca gcagagaaac ttcaaagaat agtaaagaat 1200 ctggatttca ttgtttacaa gtttgacaac tatggaaaaa catttatcaa gaagcagaaa 1260 tacagccccg acggcttcat ccaggtggcc ctccagctgg cttactacag gctttaccag 1320 agactggtgc ccacctatga gagcgcatcc atccgccgct tccaggaagg tcgggtggac 1380 aacatcagat cagccactcc agaggctctg gcttttgtgc aagccatgac tgaccacaag 1440 gctgccatgc cggcttctga gaaactgcag ctgctgcaga cagccatgca ggcccagact 1500 gcctgaca tccggccat aaccggcatg gccattgaca accatcttct ggcactgagg 1560 gagctggccc gagacctgtg caaagagcca cctgagatgt tcatggatga aacatacctg 1620 atgagcaacc ggtttgtcct ctccaccagc caggtgccca caaccatgga gatgttctgc 1680 tgttatggac ccgtggtccc caatggctat ggagcctgct acaaccccca gcccgaggcc 1740 atcaccttct gcatctccag ttttcacagc tgcaaagaga cctcgtctgt ggagtttgcg 1800 gaagctgtgg gagcgagcct tgttgacatg agagacctct gcagttcaag gcagcctgct 1860 gaccascaagc caccagcacc caaggaaaaa gctaggggcc caaccaagcc aagcaatctt 1920 gactccagcc actag 1935 <210> 3 <211> 1599 <212> DNA <213> Homo sapiens <400> 3 atggaatccg cggaacctgc gggccaggcc cgggcggcgg ccaccaagct gtcggaggct 60 gtgggcgcgg cgctgcagga gccccggcgg cagaggcgcc tggtgcttgt tatcgtgtgc 120 gtggcgctgt tactggacaa catgctgtac atggtcatcg tgcccatagt gcccgactac 180 atcgcccaca tgcgcggggg cggcgagggc cccacccgga ctcccgaggt gtgggagccc 240 accctgccgc tgcccactcc ggccaatgcc agcgcctaca cggccaacac ctcggcgtcc 300 ccgacagctg cgtggccagc gggctcagcc cttcggcccc gctaccctac ggagagcgaa 360 gacgtgaaga tcggggtgct gtttgcttcc aaggctatcc tgcagctgct agtgaacccc 420 ttgagcgggc ccttcatcga ccgcatgagc tacgacgtgc cgctgctgat cggcctgggc 480 gtcatgttcg cctctacagt cctgttcgcc ttcgccgagg actacgccac gctgttcgcg 540 gcgcgcagcc tgcagggcct gggctcagcc ttcgccgaca cgtctggcat agccatgatc 600 gccgataagt acccggagga gccggagcgc agtcgtgcac tgggcgtggc gctggccttc 660 attagcttcg gaagcctagt ggccccgccc ttcgggggca tcctctatga gttcgccggc 720 aagcgcgtgc ccttcttggt gctagctgcc gtgtcgctct ttgacgcgct gttgctgctg 780 gcagtggcca aacccttctc ggcggctgca cgggctcggg ccaacctgcc agtgggcact 840 cccatccacc gcctcatgct agacccctac attgccgtgg tggccggcgc gctcaccacc 900 tgtaacattc ccctcgcctt cctcgaaccc accattgcca cgtggatgaa gcatacgatg 960 gcggcttccg agtgggagat gggcatggcc tggctgccgg ccttcgtgcc tcatgtgctg 1020 ggcgtctacc tcaccgtgcg cctggcggcg cgctacccac acctgcagtg gctgtacggc 1080 gcgcttgggc tggctgtgat cggcgccagc tcgtgcatcg tgcccgcctg ccgctccttc 1140 gcgccgctag tggtctcact atgcggcctc tgttttggca tagccctagt cgacacagca 1200 ctgctgccca cgctcgcctt cctggtggac gtgcgccatg tctcagtcta tggcagcgtc 1260 tacgccatcg ccgacatctc ctattcggtg gcctacgcgc tcgggcccat agtggcaggc 1320 cacattgtgc actcgctggg ctttgagcag ctcagccttg gcatgggact ggccaacctg 1380 ctctatgctc ccgtcttgct gctgctccgc aacgtgggcc tcctgacgcg ctcccgttcc 1440 gagcgcgatg tgctgcttga tgagccaccg caaggtctgt acgatgcggt gcgcctgcgt 1500 gagcgtcctg tgtctggcca ggacggcgag cctcgcagcc cgcctggccc ttttgatgcg 1560 tgcgaggacg actacaacta ctactacacc cgcagctag 1599 <210> 4 <211> 1593 <212> DNA <213> Rattus norvegicus <400> 4 atggaaccca ccgcgccaac cggtcaggcc cgggcggcgg ccaccaaact gtcggaagcg 60 gtgggagccg cgctacaaga gccccagagg cagcggcgcc tggtgctggt catcgtgtgc 120 gttgcactgt tactggacaa catgttgtac atggtcatcg tgcccattgt tcccgactat 180 atcgcccaca tgcgcggggg cagcgagggc ccgaccctgg tctctgaggt gtgggaaccc 240 actctgccgc cgcccactct ggctaatgcc agtgcctact tggccaacac gtcggcgtcc 300 ccgacggctg ccgggtcggc tcggtcaatc ctgcgacctc gctaccccac agaaagcgaa 360 gatgtgaaga taggtgtgct gtttgcctcc aaggctatcc tgcagcttct ggtgaacccc 420 ttaagcgggc ctttcattga tcgcatgagc tacgacgtgc cgctgcttat aggcctgggc 480 gtcatgttcg cctccacagt catgtttgcc tttgcagaag actatgccac gctcttcgct 540 gcgcgcagtc tacaaggcct gggctcggcc ttcgcggaca cgtctggcat tgccatgatc 600 gccgacaagt atcccgagga gcctgagcgc agtcgtgccc tgggcgtggc gctagccttt 660 attagctttg gaagcctagt ggcgccaccg tttgggggca tcctctacga gttcgcgggc 720 aagcgtgtac cctttctagt gctcgccgct gtgtcccttt tcgacgcgct cctgctcctg 780 gcggtggcta agcccttctc ggctgcggct cgggcgcgag ccaacctgcc ggtgggcaca 840 cctatccatc gcctcatgct agacccttac atcgctgtgg tagccggcgc gctcaccact 900 tgtaacattc cccttgcgtt cctcgagccc accatagcca cgtggatgaa gcacacaatg 960 gccgcatgg agtgggagat gggcatggtt tggctgccgg ctttcgtgcc acacgtgtta 1020 ggcgtctacc tcaccgtgcg cctggcggcg cgttatccac acctgcagtg gctgtacggc 1080 gctctcgggc tagcggtaat tggagtgagc tcttgcgtcg tacctgcctg tcgctcattc 1140 gcgccgttag tggtctcgct ctgcggactc tgcttcggca tcgcgttagt ggacacagcg 1200 ctcctaccca cgctcgcctt tctggtggac gtgcgccacg tatccgtcta tggcagtgtc 1260 tatgccatag ctgacatctc ctattctgtg gcctacgcgc tcgggcccat agtggcaggc 1320 cacatcgttc actctcttgg ctttgagcag ctcagcctgg gcatgggcct ggccaacctg 1380 ctctacgcac cagtccttct tcttttgcgc aatgtaggcc tccttacacg ctcgcgttcg 1440 gagcgcgatg tgttgcttga tgaaccgccg cagggtctgt acgacgcggt gcgcctgcgt 1500 gaggtgcagg gcaaggatgg cggcgaacct tgtagcccac ctggcccttt tgacgggtgc 1560 gaggacgact acaactatta ctcccgcagc tag 1593 <210> 5 <211> 1743 <212> DNA <213> Homo sapiens <400> 5 atggctttcc atgtggaagg actgatagct atcatcgtgt tctaccttct aattttgctg 60 gttggaatat gggctgcctg gagaaccaaa aacagtggca gcgcagaaga gcgcagcgaa 120 gccatcatag ttggtggccg agatattggt ttattggttg gtggatttac catgacagct 180 acctgggtcg gaggagggta tatcaatggc acagctgaag cagtttatgt accaggttat 240 ggcctagctt gggctcaggc accaattgga tattctctta gtctgatttt aggtggcctg 300 ttctttgcaa aacctatgcg ttcaaagggg tatgtgacca tgttagaccc gtttcagcaa 360 atctatggaa aacgcatggg cggactcctg tttattcctg cactgatggg agaaatgttc 420 tgggctgcag caattttctc tgctttggga gccaccatca gcgtgatcat cgatgtggat 480 atgcacattt ctgtcatcat ctctgcactc attgccactc tgtacacact ggtgggaggg 540 ctctattctg tggcctacac tgatgtcgtt cagctctttt gcatttttgt agggctgtgg 600 atcagcgtcc cctttgcatt gtcacatcct gcagtcgcag acatcgggtt cactgctgtg 660 catgccaaat accaaaagcc gtggctggga actgttgact catctgaagt ctactcttgg 720 cttgatagtt ttctgttgtt gatgctgggt ggaatcccat ggcaagcata ctttcagagg 780 gttctctctt cttcctcagc cacctatgct caagtgctgt ccttcctggc agctttcggg 840 tgcctggtga tggccatccc agccatactc attggggcca ttggagcatc aacagactgg 900 aaccagactg catatgggct tccagatccc aagactacag aagaggcaga catgatttta 960 ccaattgttc tgcagtatct ctgccctgtg tatatttctt tctttggtct tggtgcagtt 1020 tctgctgctg ttatgtcatc agcagattct tccatcttgt cagcaagttc catgtttgca 1080 cggaacatct accagctttc cttcagacaa aatgcttcgg acaaagaaat cgtttgggtt 1140 gt actgtgtatg ggctctggta cctcagttct gaccttgttt acatcgttat cttcccccag 1260 ctgctttgtg tactctttgt taagggaacc aacacctatg gggccgtggc aggttatgtt 1320 tctggcctct tcctgagaat aactggaggg gagccatatc tgtatcttca gcccttgatc 1380 ttctaccctg gctattaccc tgatgataat ggtatatata atcagaaatt tccatttaaa 1440 accttgcca tggttacatc attcttaacc aacatttgca tctcctatct agccaagtat 1500 ctatttgaaa gtggaacctt gccacctaaa ttagatgtat ttgatgctgt tgttgcaaga 1560 cacagtgaag aaaacatgga taagacaatt cttgtcaaaa atgaaaatat taaattagat 1620 gaacttgcac ttgtgaagcc acgacagagc atgaccctca gctcaacttt caccaataaa 1680 gaggccttcc ttgatgttga ttccagtcca gaagggtctg ggactgaaga taatttacag 1740 tga 1743 <210> 6 <211> 1428 <212> DNA <213> Rattus norvegicus <400> 6 atgcgttcta agggatatgt gactatgtta gacccgtttc aacagatcta tggaaagcgc 60 atgggtgggc tgctgttcat ccctgcactg atgggagaga tgttctgggc tgcagcgatt 120 ttctctgcat taggggctac catcagcgta atcattgatg tggatgtgaa catatcggtc 180 attgtctccg cactcattgc cattctttat accctcgtgg gagggctcta ctctgtggca 240 tatactgatg ttgtacagct attctgcatt tttataggat tgtggatcag tgtcccattt 300 gccctgtcac atcctgcagt caccgacatt ggattcactg ctgtgcatgc taaataccag 360 agtccctggc tgggaaccat tgaatcaatt gaagtctaca cctggcttga taattttctg 420 ttgttgatgc tgggtggaat accatggcaa gcctacttcc agagggtcct ctcttcatcg 480 tcagcgacct atgctcaggt gctgtccttc ctggcagctt ttgggtgcct ggtgatggct 540 ctaccagcca tatgcattgg ggccattgga gcctccacag actggaacca aactgcatat 600 gggtttccag atcccaagac caaggaggaa gcagacatga ttctcccgat tgttctacag 660 tacctctgcc ctgtgtacat ttccttcttt gggcttggtg ctgtttctgc tgctgtcatg 720 tcctcggctg actcatccat cctatcagca agttccatgt ttgctcggaa tatctaccag 780 ctttccttca gacaaaatgc atcagacaag gaaattgtgt gggtcatgag gatcactgtg 840 tttgtgtttg gagcatctgc aacagccatg gccttgctca cgaagactgt gtatgggctc 900 tggtacctga gctctgacct tgtctacatc atcatcttcc cacagctgct ctgtgtactc 960 ttcatcaaag gaaccaacac ttatggggca gttgctggtt atatttttgg acttttcctg 1020 agaattaccg gaggagagcc atatctatac ttgcagccct taatcttcta ccctggttat 1080 taccctgaca agaatggtat atacaatcag aggttcccat ttaaaactct ctccatggtt 1140 acctcattct ttaccaacat ttgtgtttcc tatctagcca agtatctatt tgaaagtgga 1200 accttgcctc caaaattaga tatatttgat gctgttgtct caaggcacaga tgaagagaac 1260 atggacaaga ccattctagt cagaaatgaa aacatcaaat taaatgaact tgcacctgta 1320 aagcctcgac agagcctaac cctcagttca actttcacca ataaagaggc tctccttgat 1380 gttgattcca gtccagaggg atctgggact gaagataact tacaatga 1428 <210> 7 <211> 1518 <212> DNA <213> Homo sapiens <400> 7 atgggctctg gcccgctctc gctgcccctg gcgctgtcgc cgccgcggct gctgctgctg 60 ctgctgctgt ctctgctgcc agtggccagg gcctcagagg ctgagcaccg tctatttgag 120 cggctgtttg aagattacaa tgagatcatc cggcctgtag ccaacgtgtc tgacccagtc 180 atcatccatt tcgaggtgtc catgtctcag ctggtgaagg tggatgaagt aaaccagatc 240 atggagacca acctgtggct caagcaaatc tggaatgact acaagctgaa atggaacccc 300 tctgactatg gtggggcaga gttcatgcgt gtccctgcac agaagatctg gaagccagac 360 attgtgctgt ataacaatgc tgttggggat ttccaggtgg acgacaagac caaagcctta 420 ctcaagtaca ctggggaggt gacttggata cctccggcca tctttaagag ctcctgtaaa 480 atcgacgtga cctacttccc gtttgattac caaaactgta ccatgaagtt cggttcctgg 540 tcctacgata aggcgaaaat cgatctggtc ctgatcggct cttccatgaa cctcaaggac 600 tattgggaga gcggcgagtg ggccatcatc aaagccccag gctacaaaca cgacatcaag 660 tacaactgct gcgaggagat ctaccccgac atcacatact cgctgtacat ccggcgcctg 720 cccttgttct acaccatcaa cctcatcatc ccctgcctgc tcatctcctt cctcactgtg 780 ctcgtcttct acctgccctc cgactgcggt gagaaggtga ccctgtgcat ttctgtcctc 840 ctctccctga cggtgtttct cctggtgatc actgagacca tcccttccac ctcgctggtc 900 atccccctga ttggagagta cctcctgttc accatgattt ttgtaacctt gtccatcgtc 960 atcaccgtct tcgtgctcaa cgtgcactac agaaccccga cgacacacac aatgccctca 1020 tgggtgaaga ctgtattctt gaacctgctc cccagggtca tgttcatgac caggccaaca 1080 agcaacgagg gcaacgctca gaagccgagg cccctctacg gtgccgagct ctcaaatctg 1140 aattgcttca gccgcgcaga gtccaaaggc tgcaaggagg gctacccctg ccaggacggg 1200 atgtgtggtt actgccacca ccgcaggata aaaatctcca atttcagtgc taacctcacg 1260 agaagctcta gttctgaatc tgttgatgct gtgctgtccc tctctgcttt gtcaccagaa 1320 atcaaagaag ccatccaaag tgtcaagtat attgctgaaa atatgaaagc acaaaatgaa 1380 gccaaagaga ttcaagatga ttggaagtat gttgccatgg tgattgatcg tatttttctg 1440 tgggttttca ccctggtgtg cattctaggg acagcaggat tgtttctgca acccctgatg 1500 gccagggaag atgcataa 1518 <210> 8 <211> 1500 <212> DNA <213> Rattus norvegicus <400> 8 atgggtgttg tgctgctccc gccgccgctg tccatgctga tgctggtgct gatgctgctg 60 ccagcggcca gtgcctcaga agctgagcac cgcctgttcc agtacctgtt cgaagattac 120 aacgagatca tccggccagt ggctaatgtg tcccatccag tcatcatcca gtttgaggtg 180 tccatgtctc agctggtgaa ggtggatgaa gtaaaccaga tcatggaaac caacctgtgg 240 ctgaagcaaa tctggaatga ctacaagctg aaatggaaac cctctgacta ccaaggggtg 300 gagttcatgc gtgttcctgc agagaagatc tggaaaccag acatcgtact gtacaacaac 360 gctgatgggg atttccaggt ggatgacaag accaaagctc tactcaagta cacaggagaa 420 gtgacttgga tcccgccggc catctttaag agctcatgca aaatcgacgt gacctacttc 480 ccattcgact accaaaactg caccatgaag ttcggctcct ggtcctacga caaggcaaag 540 atcgacctgg tcctcatcgg ctcctccatg aacctcaagg actactggga gagtggcgag 600 tgggctatca ttaaagcccc gggctacaaa catgaaatca agtacaactg ctgtgaggag 660 atctaccaag acatcacgta ctcgctgtac atccgtcgcc tgccgctgtt ctacaccatc 720 aacctcatca tcccctgcct gctcatctcc ttcctcactg tgcttgtctt ctacctgccc 780 tccgactgtg gggagaaggt gacactctgc atctctgtgc tcctctccct gactgtcttt 840 ctcctggtga tcaccgagac cattccttcc acctcgctgg tcatccccct gattggggag 900 tacctcctct tcactatgat ttttgtcacc ttgtccattg tcatcacagt ctttgtgctc 960 aatgtgcact atagaactcc aaccacacac accatgccca cttgggtcaa ggccgtgttc 1020 ttgaacctgc tccccagggt catgtttatg actaggccga ccagtggtga gggggacact 1080 cctaagacga ggaccttcta cggcgctgag ctctcaaacc tgaactgctt cagccgtgca 1140 gactccaaaa gctgcaagga aggctacccc tgccaagatg ggacctgtgg ctactgccac 1200 caccgtaggg taaaaatctc aaatttcagt gccaacctca caagaagctc cagttctgag 1260 tctgtcgacg ctgtgttgtc cctctctgcc ctgtcaccag aaatcaaaga agccatccaa 1320 agtgtgaagt acattgccga aaacatgaaa gcacagaatg tagccaaaga gattcaagat 1380 gattggaagt acgttgccat ggtgattgat cgcatctttc tctgggtttt catcctggtg 1440 tgcattttag gaacggcggg attatttctg caacccttga tggccagaga tgacacatag 1500                                                                         1500 <210> 9 <211> 1377 <212> DNA <213> Homo sapiens <400> 9 atgctcccag attttatgct ggttctcatc gtccttggca tcccttcctc agccaccaca 60 ggtttcaact caatcgccga aaatgaagat gccctcctca gacatttgtt ccaaggttat 120 cagaaatggg tccgccctgt attacattct aatgacacca taaaagtata ttttggattg 180 aaaatatccc agcttgtaga tgtggatgaa aagaatcagc tgatgacaac caatgtgtgg 240 ctcaaacagg aatggacaga ccacaagtta cgctggaatc ctgatgatta tggtgggatc 300 cattccatta aagttccatc agaatctctg tggcttcctg acatagttct ctttgaaaat 360 gctgacggcc gcttcgaagg ctccctgatg accaaggtca tcgtgaaatc aaacggaact 420 gttgtctgga cccctcccgc cagctacaaa agctcctgca ccatggacgt cacgtttttc 480 ccgttcgacc gacagaactg ctccatgaag tttggatcct ggacttatga tggcaccatg 540 gttgacctca ttttgatcaa tgaaaatgtc gacagaaaag acttcttcga taacggagaa 600 tgggaaatac tgaacgcaaa ggggatgaag gggaacagaa gggacggcgt gtactcctat 660 ccctttatca cgtattcctt cgtcctgaga cgcctgcctt tattctatac cctctttctc 720 atcatcccct gcctggggct gtctttccta acagttcttg tgttctattt accttcggat 780 gaaggagaaa aactttcatt atccacatcg gtcttggttt ctctgacagt tttcctttta 840 gtgattgaag aaatcatccc atcgtcttcc aaagtcattc ctctcattgg agagtacctg 900 ctgttcatca tgatttttgt gaccctgtcc atcattgtta ccgtgtttgt cattaacgtt 960 caccacagat cttcttccac gtaccacccc atggccccct gggttaagag gctctttctg 1020 cagaaacttc caaaattact ttgcatgaaa gatcatgtgg atcgctactc atccccagag 1080 aaagaggaga gtcaaccagt agtgaaaggc aaagtcctcg aaaaaaagaa acagaaacag 1140 cttagtgatg gagaaaaagt tctagttgct tttttggaaa aagctgctga ttccattaga 1200 tacatttcga gacatgtgaa gaaagaacat tttatcagcc aggtagtaca agactggaaa 1260 tttgtagctc aagttcttga ccgaatcttc ctgtggctct ttctgatagt gtcagtaaca 1320 ggctcggttc tgatttttac ccctgctttg aagatgtggc tacatagtta ccattag 1377 <210> 10 <211> 1395 <212> DNA <213> Rattus norvegicus <400> 10 atgacaggct tcctaagggt cttcttggtt ctcagtgcca ctctctcagg ttcctgggtg 60 actcttacgg ccactgcagg actcagctca gtggctgaac acgaagacgc actcctcaga 120 catttgttcc aaggttacca gaaatgggtc cgccctgtgt tgaattccag tgacatcata 180 aaagtgtatt ttggattaaa aatatcccag cttgtggatg tggatgaaaa gaatcagctg 240 atgacgacaa atgtgtggct gaagcaggaa tggacagacc aaaaattacg ctggaatccg 300 gaagaatatg gtggaattaa ttcgataaag gttccatcag aatcgctctg gctgccggac 360 atagttctct ttgaaaatgc tgacggacgt tttgagggct ccctcatgac caaggccatt 420 gtgaagtcca gtggaaccgt cagctggact cctcccgcca gctacaagag ttcctgcacc 480 atggatgtca catttttccc gttcgacagg cagaactgct cgatgaagtt tggatcctgg 540 acttacgacg gtaccatggt tgacctcatt ctaatcaatg aaaacgttga ccggaaagac 600 ttttttgata acggagagtg ggagatactc aacgcaaagg ggatgaaggg caacagaaga 660 gaaggctttt actcctatcc gtttgttacc tactcttttg tcctgagacg cctgcccttg 720 ttttacacgc tctttttgat aatcccctgc ctggggttgt cttttctcac ggtcctggtg 780 ttctacctac cctcggacga aggggaaaaa ctctcattat ccacctccgt tttggtctct 840 ttgacggtgt ttcttttagt gattgaagaa ataatcccgt cctcttcgaa ggtcatcccc 900 ctcattggcg agtacctcct cttcattatg atttttgtca cgctgtctat tatcgtcacg 960 gtttttgtaa ttaatgtcca ccacagatct tcctcaacgt accatcccat ggccccctgg 1020 gtgaagaggc tgtttctaca aagactcccg agatggcttt gcatgaagga ccccatggac 1080 cgcttctctt tcccggatgg aaaggagagt gatacagccg tgagggggaa agtctcaggc 1140 aaaaggaaac agactcccgc cagcgatgga gaaagagttc tggtcgcttt cctcgagaag 1200 gcctccgagt ccatcagata catttcgagg catgtgaaaa aggaacactt catcagccag 1260 gtagtgcaag actggaaatt tgtggctcaa gttctggacc gcatcttcct gtggctcttt 1320 ctgatagctt ctgtgttggg ttccattctg atttttattc cagccttgaa gatgtggata 1380 catcgtttcc actag 1395 <210> 11 <211> 1497 <212> DNA <213> Homo sapiens <400> 11 atgaggcgcg cgccttccct ggtccttttc ttcctggtcg ccctttgcgg gcgcgggaac 60 tgccgcgtgg ccaatgcgga ggaaaagctg atggacgacc ttctgaacaa aacccgttac 120 aataacctga tccgcccagc caccagctcc tcacagctca tctccatcaa gctgcagctc 180 tccctggccc agcttatcag cgtgaatgag cgagagcaga tcatgaccac caatgtctgg 240 ctgaaacagg aatggactga ttaccgcctg acctggaaca gctcccgcta cgagggtgtg 300 aacatcctga ggatccctgc aaagcgcatc tggttgcctg acatcgtgct ttacaacaac 360 gccgacggga cctatgaggt gtctgtctac accaacttga tagtccggtc caacggcagc 420 gtcctgtggc tgccccctgc catctacaag agcgcctgca agattgaggt gaagtacttt 480 cccttcgacc agcagaactg caccctcaag ttccgctcct ggacctatga ccacacggag 540 atagacatgg tcctcatgac gcccacagcc agcatggatg actttactcc cagtggtgag 600 tgggacatag tggccctccc agggagaagg acagtgaacc cacaagaccc cagctacgtg 660 gacgtgactt acgacttcat catcaagcgc aagcctctgt tctacaccat caacctcatc 720 atcccctgcg tgctcaccac cttgctggcc atcctcgtct tctacctgcc atccgactgc 780 ggcgagaaga tgacactgtg catctcagtg ctgctggcac tgacattctt cctgctgctc 840 atctccaaga tcgtgccacc cacctccctc gatgtgcctc tcatcggcaa gtacctcatg 900 ttcaccatgg tgctggtcac cttctccatc gtcaccagcg tctgtgtgct caatgtgcac 960 caccgctcgc ccagcaccca caccatggca ccctgggtca agcgctgctt cctgcacaag 1020 ctgcctacct tcctcttcat gaagcgccct ggccccgaca gcagcccggc cagagccttc 1080 ccgcccagca agtcatgcgt gaccaagccc gaggccaccg ccacctccac cagcccctcc 1140 aacttctatg ggaactccat gtactttgtg aaccccgcct ctgcagcttc caagtctcca 1200 gccggctcta ccccggtggc tatccccagg gatttctggc tgcggtcctc tgggaggttc 1260 cgacaggatg tgcaggaggc attagaaggt gtcagcttca tcgcccagca catgaagaat 1320 gacgatgaag accagagtgt cgttgaggac tggaagtacg tggctatggt ggtggaccgg 1380 ctgttcctgt gggtgttcat gtttgtgtgc gtcctgggca ctgtggggct cttcctaccg 1440 cccctcttcc agacccatgc agcttctgag gggccctacg ctgcccagcg tgactga 1497 <210> 12 <211> 1488 <212> DNA <213> Rattus norvegicus <400> 12 atgaggggta cgcccctgct cctcgtctct ctgttctctc tgcttcagga cggggactgc 60 cgcctggcca acgcagagga gaagctgatg gatgacctcc tgaacaaaac ccggtacaac 120 aacctgatcc gcccagccac cagctcctct cagctcatct ccatccgcct ggagctatca 180 ctgtcccagc tcatcagtgt gaatgagcga gaacagatca tgaccaccag catctggctg 240 aaacaggaat ggactgacta ccgcctggcc tggaacagct cctgctatga aggggtgaac 300 attctgagga tccccgcaaa gcgtgtctgg ttgcctgaca tcgtgttgta caacaatgcc 360 gatggcacct atgaggtgtc tgtctacacc aacgtgattg tgcgttccaa tggcagcatc 420 cagtggctgc cccctgctat ctacaagagt gcctgcaaga ttgaggtgaa gcactttccc 480 ttcgaccagc agaactgcac cctcaaattc cgctcctgga cctatgacca cacggagatt 540 gacatggttc ttaagtcgcc cacggccatc atggatgact tcacccccag tggtgaatgg 600 gacattgtgg ccctcccagg acggaggacg gtgaaccctc aggaccccag ctacgtggac 660 gtgacctatg acttcatcat caagcgcaag ccgctcttct acaccatcaa tcttatcatt 720 ccttgtgtgc tcatcacctc gctggctatc ctggtcttct acctgccctc cgactgtggg 780 gagaagatga cgctctgcat ctctgtgctg ctggcactca cgttcttcct gctgctcatc 840 tccaagatcg tgcctcccac ctcccttgac ataccgctca ttggcaagta cctcttgttc 900 accatggtgc tggtcacctt ttccatcgtc accactgtgt gtgtcctcaa tgtgcaccac 960 cgctcaccca gcactcacac catggcatcc tgggtcaagg agtgcttcct gcacaaactg 1020 cccaccttcc tcttcatgaa gcgtcccggt cttgaagtca gcctggtcag ggtccctcat 1080 cccagccagc tgcacttggc cacagctgat actgcagcca cctctgcctt aggccccacc 1140 agcccatcca acctctatgg gagttccatg tactttgtga accctgtccc tgccgctcct 1200 aagtctgcag tcagctccca cacagcaggc ctccccaggg atgcccgtct gaggtcctcc 1260 gggaggttcc gggaagatct acaggaagca ttagagggtg tcagcttcat cgcccagcat 1320 ctggagagcg atgaccgaga tcaaagtgtc atcgaggact ggaagttcgt cgcgatggtt 1380 gtgggggcc catggggctc 1440 ttcctgccac cccttttcca gatccacgca ccctccaagg actcctag 1488 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> human VACHT Probe <400> 13 gtcatcgtgc ccatagtgcc cgact 25 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> human CHT Primer_Forward <400> 14 gaacatctac cagctttcct tcaga 25 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> human CHT Primer_Reverse <400> 15 tgattcgcat aacccaaacg atttc 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> human CHAT Probe <400> 16 agtgaggagt ctgggctgcc caaac 25 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> human CHRNA3 Probe <400> 17 acctgtggct caagcaaatc tggaa 25 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> human CHRNB3 Probe <400> 18 ttgaaaatgc tgacggccgc ttcga 25 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> human CHRNB4 Probe <400> 19 cctttgcggg cgcgggaact gccgc 25 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> human CAMK2B Probe <400> 20 agcattccaa catcgtgcgt ctcca 25 <210> 21 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> human GAPDH Probe <400> 21 gggcgcctgg tcaccagggc tgctt 25 <210> 22 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> human TBP Probe <400> 22 gcagctgcaa aatattgtat ccaca 25 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> human CYC1 Probe <400> 23 tcttagagtt tgacgatggc acccc 25 <210> 24 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> mouse VACHT Primer_Forward <400> 24 aaacatcgtc cactggtcc 19 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse VACHT Primer_Reverse <400> 25 ctttccctaa gatgcctcca c 21 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse CHT Primer_Forward <400> 26 tttccagatc ccaagaccaa g 21 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse CHT Primer_Reverse <400> 27 atgctccaaa cacaaacaca g 21 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse CHAT Primer_Forward <400> 28 tccaagacac caatgaccag 20 <210> 29 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> mouse CHAT Primer_Reverse <400> 29 ggacgccatt ttgactatct ttc 23 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse CHRNA3 Primer_Forward <400> 30 ttctacctgc cctccgactg t 21 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse CHRNA3 Primer_Reverse <400> 31 aatcccgccg ttcctaaaat g 21 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse CHRNB3 Primer_Forward <400> 32 gaaaggagag tgatacagcc g 21 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse CHRNB3 Primer_Reverse <400> 33 agaaagagcc acaggaagat g 21 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse CHRNB4 Primer_Forward <400> 34 ctatcactgt cccagctcat c 21 <210> 35 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse CHRNB4 Primer_Reverse <400> 35 agaaccatgt caatctccgt g 21 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse CAMK2B Primer_Forward <400> 36 cagaagctga gggcctccca 20 <210> 37 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> mouse CAMK2B Primer_Reverse <400> 37 ggtcacagat tttcgcatag g 21 <210> 38 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> mouse GAPDH Primer_Forward <400> 38 ccttcattga cctcaactac at 22 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> mouse GAPDH Primer_Reverse <400> 39 caaagttgtc atggatgacc 20 <210> 40 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> CHAT shRNA <400> 40 gagcgagcct tgttgacat 19 <210> 41 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> scrambled RNAi <400> 41 tcgtcatagc gtgcatagg 19

Claims (21)

delete delete delete delete delete delete delete delete delete delete delete delete delete delete delete Preparing a recombinant viral vector expressing an RNAi sequence for CHAT (choline acetyltransferase) gene represented by SEQ ID NO: 1 or SEQ ID NO: 2; And
And injecting the recombinant viral vector into the brain Habenula of normal mammals other than humans to knock-down the CHAT gene. Preparing a recombinant viral vector expressing an RNAi sequence for CHAT (choline acetyltransferase) gene represented by SEQ ID NO: 1 or SEQ ID NO: 2; And
And knocking down the CHAT gene by injecting the recombinant viral vector into the brain Habenula of normal mammals other than humans. 18. The method according to any one of claims 16 to 17, wherein the recombinant vector is an AAV- CHAT shRNA which is a vector having a cleavage map as shown in Fig. 3A. 18. The method according to any one of claims 16 to 17, wherein the normal mammal except for the human is a mouse or a rat. An antidepressant treatment-refractory animal model prepared according to the method of claim 16. 17. An anesthesia animal model prepared according to the method of claim 17.

Images