KR101919220B1 - Lysine Decarboxylase mutant with an Enhanced Affinity for Pyridoxal 5-Phosphate and a method for producing cadaverine using the same - Google Patents

Abstract

The present invention relates to a lysine decarboxylase mutant enzyme having improved affinity for pyridoxal 5-phosphate compared to the wild type, a gene encoding the lysine decarboxylase mutant, a production of cadaverine using the transformant for producing cadaverine or a culture thereof containing the same, ≪ / RTI >

Description

FIELD OF THE INVENTION The present invention relates to a lysine decarboxylase mutant having improved affinity for pyridoxal 5-phosphate and a method for producing cadaverine using the mutant. [0002] Lysine decarboxylase mutant has an enhanced affinity for pyridoxal 5-phosphate,

The present invention relates to a lysine decarboxylase mutant enzyme having improved affinity for pyridoxal 5-phosphate compared to the wild type, a gene encoding the lysine decarboxylase mutant, a production of cadaverine using the transformant for producing cadaverine or a culture thereof containing the same, And a process for producing the crystals of the enzyme protein.

Cadaverine is a base material used in various petrochemical products such as polyamides, polyurethanes, chelating agents and additives. Excessive consumption of petroleum raw materials accelerates global warming, and as environmental regulations tighten, there is a growing demand for cadaverine production through bio-based routes.

Bio-based cadaverine is produced using lysine decarboxylase (LDC). However, when lysine decarboxylase is reacted with lysine to generate cadaverine, carbon dioxide is generated by the decarbonation of lysine, and cadaverine, which is a divalent cation, is produced from lysine, which is a monovalent cation, Rise. At high pH, the activity of lysine decarboxylase is drastically reduced, thereby reducing the yield of cadaverine.

To solve this problem, studies have been reported on developing lysine decarboxylase that maintains enzyme activity even at high pH (Korea Patent Publication No. 2016-0097691, Korean Patent Publication No. 2016-0085602).

Meanwhile, a method of continuously supplying the co-factor pyridoxal 5-phosphate (PLP) to the lysine decarboxylase reaction process has been reported (Kind S et al., Metabolic engineering 12: 341-351 , 2010). However, since PLPs are expensive, there have been many attempts to reduce these costs. In order to enhance the intracellular level of PLP, a dehydrogenated PLP biosynthesis was added to a cadaverine-producing strain, and a 5'-phosphate ciprofloxacin And introduces a route.

The main object of the present invention is to provide a lysine decarboxylase mutant having increased activity compared to wild type, wherein at least two even residues of the wild type lysine decarboxylase are substituted with cysteine.

Another object of the present invention is to provide a lysine decarboxylase mutant enzyme gene encoding a mutant enzyme.

Another object of the present invention is to provide a lysine decarboxylase mutant enzyme gene encoding a protein in which the amino acids at positions 225 and 302 are substituted with cysteine in the amino acid sequence of SEQ ID NO: 1.

Another object of the present invention is to provide a cassette for producing cadaverine, which comprises the gene.

It is another object of the present invention to provide a transformant for producing cadaverine, which comprises the cassette.

Another object of the present invention is to provide a composition for producing cadaverine, which comprises the transformant or a culture thereof.

Another object of the present invention is to provide a method for producing cadaverine comprising culturing the transformant.

It is still another object of the present invention to provide a method for improving the affinity of an enzyme protein for pyridoxal 5-phosphate, which comprises introducing a disulfide bond into an enzyme protein having a pyridoxal 5-phosphate binding site Method.

The present inventors have made extensive efforts to develop a lysine decarboxylase having improved affinity for PLP. As a result, it has been found that when a disulfide bond is introduced into a wild-type lysine decarboxylase, affinity to PLP is improved and PLP is almost Or not added at all, the enzyme activity and the conversion of cadaverine are greatly increased, and the pH and the temperature resistance are increased, thus completing the present invention.

In one aspect of the present invention, there is provided a lysine dicarboxylase mutant having increased activity as compared with wild type, wherein 2n amino acid residues of wild type lysine decarboxylase are substituted with cysteine (n is an integer of 1 or more). The " lysine dicarboxylase " is an enzyme that catalyzes the decarboxylation of lysine, and can be used herein with LDC, or lysine decarboxylase. As used herein, " wild-type lysine dicarboxylase " may be mixed with LDC ^WT , a wild-type enzyme, or a recombinant enzyme.

For example, when n is 1, one of the two substituted amino acid residues is a closed conformation (R-loop) connecting an R-loop connecting? -8 and? -9 (residues 220-231) ), It may be any one selected from the 220th to 231st amino acids of the wild-type lysine decarboxylase.

For example, the mutant enzyme may be one in which the 225th amino acid and the 302th amino acid of the wild-type lysine decarboxylase are substituted with cysteine, respectively.

For example, the mutant enzyme may be one in which alanine (Ala), which is the 225th amino acid of wild-type lysine decarboxylase, and threonine (Thr), which is the 302th amino acid, are substituted with cysteine.

We first identified the structure of the crystals of the wild-type lysine decarboxylase protein (Table 3), and found that the three loops (PS-, R-, AS-loops) It was confirmed for the first time that affinity with PLP is inhibited because it has high flexibility. In particular, the R-loop connecting β-8 and α-9 (residues 220-231) is a loop that stabilizes the binding of PLP to lysine decarboxylase proteins (β-7 and α-8 178-187 residues), it is possible to significantly improve the affinity of lysine decarboxylase for PLP when the R-loop is kept in a closed form For the first time.

For example, in the mutant enzyme, the two substituted cysteines may form a disulfide bond. When a disulfide bond is artificially induced, a structural redesign of the lysine decarboxylase protein occurs, and the activity of the protein can be improved because the R-loop is maintained in a closed form (FIG. 7B).

Refers to all the ability of the lysine decarboxylase enzyme to have in the Invivo, Intro, including affinity for PLP, affinity for substrate, and ability to convert lysine to cadaverine. The present inventors confirmed that the induction of the disulfide bond significantly increased the PLP affinity and the cadarin conversion ability of the mutant enzyme (Fig. 7C to Fig. 7H).

For example, the wild-type lysine decarboxylase may be selected from the group consisting of lysine decarboxylase of Selenomonas ruminantium , lysine / ornithine decarboxylase of Vibrio vulnificus ; Vv L / ODC), ODC ( Mm ODC) of Mus musculus , and ODC ( Tb ODC) of Trypanosoma brucei .

As a non-limiting example, the wild-type lysine decarboxylase may be any amino acid sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 3 to SEQ ID NO: In addition to the above sequence, a protein having substantially the ability to convert to catarrhine as an amino acid sequence having 80% or more, specifically 90% or more, more specifically 95% or more, more specifically 98% or more, If any, may be included without limitation. Also, in the case where an amino acid sequence having such homology is substantially the same as or has a biological activity equivalent to that of the protein of the above sequence, it is also within the scope of the present invention that some sequences have amino acid sequences deleted, modified, substituted or added Included is self-explanatory.

The term " homology ", as used herein in connection with a sequence, refers to the degree to which it is consistent with a given amino acid sequence or base sequence and may be expressed as a percentage. In the present specification, its homologous sequence having the same or similar activity as a given amino acid sequence or base sequence is indicated as "% homology ". For example, standard software for calculating parameters such as score, identity and similarity, specifically BLAST 2.0, or by sequential hybridization experiments under defined stringent conditions, , And the appropriate hybridization conditions to be defined are within the skill of the art and can be determined by methods well known to those skilled in the art.

For example, the mutant enzyme may be an amino acid sequence represented by SEQ ID NO: 6, but is not limited thereto. On the other hand, the polynucleotide coding for the protein may be modified in a range that does not change the amino acid sequence of the protein expressed from the coding region, due to codon degeneracy or considering the codon preference in the organism to which the protein is to be expressed Various modifications can be made to the coding region. In addition to the above sequence, a protein having substantially the ability to convert to catarrhine as an amino acid sequence having 80% or more, specifically 90% or more, more specifically 95% or more, more specifically 98% or more, If any, may be included without limitation. Also, in the case where an amino acid sequence having such homology is substantially the same as or has a biological activity equivalent to that of the protein of the above sequence, it is also within the scope of the present invention that some sequences have amino acid sequences deleted, modified, substituted or added Included is self-explanatory.

For example, the mutant enzyme may have improved stability against temperature or pH as compared with the wild type. Since one hydrogen per decarboxylation reaction of lysine decarboxylase is consumed, the pH is increased as the reaction progresses, so that the reactivity decreases over time. According to one embodiment of the present invention, LDC activity and cadarin conversion ability of the mutant enzyme were greatly improved even when PLP was little or no added. This is presumably because the stability of the PLP binding site was increased by structural redesign due to the disulfide bond.

As used herein, the term " stability " may be used in the same sense as resistance or tolerance.

According to one embodiment of the present invention, when the reaction conditions except for temperature or pH are the same, the mutant enzyme has an affinity for the assistant PLP or a catarrhine conversion ability of about 5 to 20 times higher than that of the wild-type lysine decarboxylase , Specifically 5 to 10 times.

For example, the mutant enzyme may have a K _d value of 21 μM. According to one embodiment of the invention, K _d values of the UV / Vis absorption resulting mutant enzyme analysis of the spectrum, while the 21μM, K _d values of the wild-type lysine decarboxylase was found with 72 μM.

For example, the mutant enzyme may have a melting point ( T _m ) of 56.9 ° C. According to one embodiment of the present invention, the T _m of the mutant enzyme was 56.9 ° C, and the T _m of the wild-type enzyme was higher than 52.27 ° C.

In one example, the mutant enzyme may be one that converts lysine to cadaverine without the addition of pyridoxal 5-phosphate. According to one embodiment of the present invention, the conversion enzyme of lysine to cadaverine is 20 to 60%, specifically 20 to 40%, even when pyridoxal 5-phosphate is not added.

For example, the mutant enzyme may be one in which pyridoxal 5-phosphate is added at a small concentration to convert lysine to cadaverine. The trace concentration may be 0.1 μM to 0.05 mM, specifically 0.1 μM to 0.02 mM, more specifically 0.1 μM to 0.01 mM. According to one embodiment of the present invention, the mutant enzyme exhibited a similar level of catarrhine conversion even when the PLP concentration was reduced to 1/20 as compared with the wild-type lysine decarboxylase (FIG. 7g).

For example, crystals of the mutant enzyme has the space group P 2 ₁ 2 ₁ in the _21, and unit cell parameters a = 55.91 Å, b = 122.85 Å, c = 136.85 Å, and α = β = γ = 90.0 ° Lt; / RTI >

On the other hand, apo-form I crystal of Sr LDC is a space group P 4 ₃ 2 ₁ 2 inside, and the unit cell parameters are a = b = 105.97 Å, c = 73.634 Å, α = β = γ = 90.0 ° to, Sr The apo-form II crystals of LDC belong to the space group C 2 and the unit cell parameters are a = 146.45 Å, b = 70.794 Å, c = 88.061 Å, α = γ = 90.0 ° and β = 101.03 °, It is clearly distinguished from the crystals of the enzyme.

In another aspect, the present invention provides a lysine decarboxylase mutant enzyme gene encoding the mutant enzyme. For example, the gene may encode a protein in which the amino acids at positions 225 and 302 are replaced by cysteine in the amino acid sequence of SEQ ID NO: 1.

In another aspect, the present invention provides a cassette for producing cadaverine or an expression vector comprising the cassette, comprising the gene.

For example, the gene may be contained in a cassette or operably linked to an expression vector.

As used herein, a " vector " may refer to a DNA construct containing a nucleotide sequence of a polynucleotide encoding the desired protein operably linked to a suitable regulatory sequence so as to be capable of expressing the protein of interest in the appropriate host. The regulatory sequence includes a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling the termination of transcription and translation. The vector may be transcribed into an appropriate host cell and then cloned or functioned independently of the host genome and integrated into the genome itself. The vector is not particularly limited as long as it is replicable in the host cell, and any vector known in the art can be used.

In another aspect, the present invention provides a transformant for producing cadaverine, comprising the cassette or expression vector.

For example, the cassette or expression vector may be contained in a transformant by being transduced with a chromosome in the host cell. For example, the transformant may refer to a microorganism transformed by introduction of a vector capable of replicating and functioning in a host cell regardless of host, into which the polynucleotide encoding the protein is operably linked.

The polynucleotide encoding the intrinsic target protein in the chromosome through the cassette or expression vector can be replaced with a mutated polynucleotide. The insertion of the polynucleotide into the chromosome can be accomplished by any method known in the art, for example, homologous recombination. Since the vector of the present invention can be inserted into a chromosome by causing homologous recombination, it may further include a selection marker for confirming whether or not the chromosome is inserted. A selection marker is used to select a cell transformed with a vector, that is, to confirm insertion of a target polynucleotide, and it is provided with a selectable phenotype such as drug resistance, nutritional requirement, tolerance to a cytotoxic agent, May be used.

Transformation herein may refer to introducing a vector comprising a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may be either inserted into the chromosome of the host cell or located outside the chromosome, so long as it can be expressed in the host cell.

The transformant or host cell may be selected from the group consisting of Escherichia sp., Shigella sp., Citrobacter sp., Salmonella sp., Enterobacter sp. , Enterobacter sp., Yersinia sp., Klebsiella sp., Erwinia sp., Corynebacterium sp., Brevibacterium sp. (Brevibacterium sp.), genus Lactobacillus (Lactobacillus sp.), celecoxib eggplant grandma in (Selenomanas sp.), in Vibrio (Vibrio sp.), Pseudomonas species (Pseudomonas sp.), Streptomyces sp., Arcanobacterium sp. sp.), Alcaligenes sp., and the like, but the present invention is not limited thereto.

In another aspect, the present invention provides a composition for producing cadaverine, comprising the transformant or a culture thereof.

For example, the composition may further comprise lysine.

In another aspect, the present invention provides a method for producing cadaverine, comprising culturing the transformant.

For example, the step of culturing may be performed in a medium containing lysine.

For example, the method may further comprise recovering the cadaverine from the cultured transformant or culture thereof.

For example, the step of culturing may be performed by treating PLP with 0 mM to 0.05 mM, specifically 0 mM to 0.02 mM, more specifically 0 mM to 0.01 mM.

In another aspect, the invention includes a method of mixing a lysine decarboxylase protein solution of SEQ ID NO: 1 with a reservoir solution comprising PEG (polyethylene glycol), sodium citrate tribasic-citric acid, and magnesium chloride The protein crystals of lysine decarboxylase of SEQ ID NO: 1.

According to one embodiment of the present invention, when PEG, sodium citrate, and magnesium chloride are used as a reservoir solution for preparing crystals of the lysine decarboxylase protein of SEQ ID NO: 1, the space group P 4 ₃ 2 ₁ 2 Apo-form I with a = b = 105.97 Å, c = 73.634 Å and α = β = γ = 90.0 ° is formed. On the other hand, the sodium citrate, Kakogawa dilsan sodium (sodium cacodylate) when used as a reservoir solution, and belongs to the space group C 2, the unit cell parameters are a = 146.45 Å, b = 70.794 Å, c = 88.061 Å, α = γ = Apo-form II of 90.0 DEG and beta = 101.03 DEG is formed. That is, the desired crystals can be obtained only when a specific reservoir solution is used.

In another aspect, the present invention provides a process for preparing a lysine decarboxylase mutant enzyme protein of SEQ ID NO: 6, which comprises mixing a solution of a reservoir containing ammonium sulfate, Of lysine dicarboxylase mutant enzyme crystals.

According to an embodiment of the present invention, a mutant enzyme crystal of SEQ ID NO: 6 can be obtained by using a reservoir solution different from the wild-type enzyme crystal of SEQ ID NO: 1. At this time belongs to the mutant enzyme crystals space group P2 ₁ 2 ₁ 2 _1, the unit cell parameters a = 55.91 Å, b = 122.85 Å, c = 136.85 Å, α = β = γ = 90.0 ° which can be a crystalline have.

In another aspect, the present invention provides a method for enhancing the affinity of an enzyme protein for PLP, comprising introducing a disulfide bond into an enzyme protein having a PLP binding site.

For example, the enzyme protein having the PLP binding site may be a PLP-dependent enzyme protein. As a non-limiting example, the enzyme protein may be an aspartate amino-transferase, a tryptophan synthase, an alanine racemase, a D-amino acid aminotransferase, aminotransferase, glycogen phosphorylase, and lysine dicarboxylase.

For example, the disulfide bond-introduced enzyme protein may be a protein whose active site is maintained in a 'closed' conformation.

According to one embodiment of the present invention, when a disulfide bond is introduced into a lysine dicarboxylase mutant enzyme, which is a typical enzyme protein using PLP as a cofactor or coenzyme, the affinity of the enzyme protein for PLP is greatly improved.

The mutant enzyme according to the present invention can produce cadaverine in a high yield even in an environment where PLP is little or no added, or in a high pH and / or temperature environment. In addition, the method of the present invention can improve the affinity of the enzyme protein for pyridoxal 5-phosphate.

1A to 1C are diagrams showing the overall structure of Sr LDC. Specifically, FIG. 1A shows the expression of wild type Sr LDC, lysine / ornithine decarboxylase ( Vv L / ODC, PDB code 2PLK) of Vibrio vulnificus , Mus musculus ) Of ODC ( Mm ODC, PDB code 7ODC). 1B is a diagram showing the monomer structure of Sr LDC. 1C is a diagram showing a dimer structure of Sr LDC.
Fig. 2 is a diagram showing an active site of Sr LDC. Fig. Specifically, (a) it is a view placed overlapping the structure of Sr LDC in combination with apo-form and PLP / cadaverine of Sr LDC. (b) and (c) show the b-factor of Sr LDC in three different crystals.
3A and 3B are graphs showing LDC activity and cadarin conversion ability of Sr LDC according to PLP concentration.
Fig. 4 is a diagram showing the conformation of the origin of the LDC. Fig. Specifically, (a) is a diagram in which open / closed shapes of Sr LDC, Tb ODC, Mm ODC, and Vv L / ODC are superimposed. (b) is an open / closed form of the Tb ODC, an open / closed form of the Mm ODC, and an open / closed form of the Vv L / ODC. (e) shows the hydrogen bonding form (red dotted line) between the Ser182 residue on the PS-loop of each of Sr LDC, Tb ODC, Mm ODC, and Vv L / ODC and the phosphate moiety of PLP.
Fig. 5 is a diagram showing the crystal structure of the mutant enzyme Sr LDC ^{A225C / T302C} . Fig. Specifically, (a) is a diagram showing the electron density map (Electron density map) of the disulfide bond of the mutant enzymes position, (b) is a diagram showing superimposed the structure of S r LDC ^{A225C / T302C} wild-type Sr LDC of closed form to be. (c) shows the b-factor of the mutant enzyme, and (d) shows the stable AS-loop, PS-loop and R-loop of the mutant enzyme.
Fig. 6 is a diagram showing two monomers of the mutant enzyme Sr LDC ^{A225C / T302C} superimposed. Fig.
FIG. 7A is a view showing positions of disulfide bonds derived from the mutant enzymes Sr LDC ^{A225C / T302C} and Sr LDC ^{K2C / G227C} , FIG. 7B is a diagram showing the positions of Sr LDC ^{A225C / T302C} in the closed form And the Sr LDC ^{K2C / G227C} of the open form (left side).
7C to 7H are diagrams comparing the activity of the mutant enzyme and the wild-type Sr LDC enzyme. Specifically, Fig. 7C shows each purified enzyme stored in lysine. 7D is a diagram showing the UV / vis absorption spectrum of each enzyme. FIG. 7E is a diagram showing the isothermal titration heat amount and the thermodynamic coefficient ( K _d ) according to the injection number of each enzyme. FIG. 7f is a graph showing the activity of each enzyme according to PLP concentration (concentration, mM). FIG. 7g is a graph showing cadavarine conversion (%) of each enzyme according to PLP concentration (concentration, mM). 7H is a graph showing the conversion of cadaverine of each enzyme according to the reaction time (min).
Figure 8 compares the thermal stability of mutant enzymes with wild type Sr LDC enzymes. (B) is a diagram showing the melting point curve of each enzyme according to the temperature (° C), (c) is the temperature at 37 ° C, and (d) Shows the activity of each enzyme according to incubation time (hour) at 60 ° C.

Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited by the following examples.

Example  1. Wild type Lysine Decarboxylase ( Sr LDC)  Manufacturing and refining

The gene coding for the wild-type lysine dicarboxylase ( Sr LDC, amino acid residue 1-393) of Selenomonas ruminantium was amplified from the chromosomal DNA of Selenomonas ruminantium using the primer shown in Table 1 below And amplified by polymerase chain reaction (PCR).

Name of the primer order SEQ ID NO: Sr LDC_F 5'-GCGCG CATATG AAAAACTTCCGTTTAAGCGAAAAAG -3 ' SEQ ID NO: 7 Sr LDC_R 5'-GCGCG CTCGAG GTGATGGTGATGGTGGTGAACTGCT -3 ' SEQ ID NO: 8

The amplified product was cloned into the pET-22b (+) vector (Life Science Research) to position the 6xHis-tag at the C-terminus. The expression vector pET-22b (+): and transforming the E. coli strain BL21 (DE3) -T1 ^R in Srldc, this in 1L LB medium containing 100 μg / mL of ampicillin until the OD600 reaches 0.7 37 ℃ Lt; / RTI > After induction of expression with 1.0 mM IPTG (Isopropyl β-D-1-thio-β-D-galactopyranoside), the cells were further cultured for 18 to 20 hours and centrifuged at 4000 × g for 20 minutes at 4 ° C. to recover the cell pellet Respectively. Thereafter, the cell pellet was resuspended in buffer A (40 mM Tris-HCl, pH 8.0) and sonicated for disruption. Cell debris was removed by centrifugation at 13,500 xg for 30 min and cell lysates were treated with Ni-NTA agarose column (Qiagen). After washing with Buffer A containing 30 mM imidazole, the proteins attached to the column were eluted with 300 mM imidazole in buffer A. Finally, traces of contaminants were removed by size-exclusion chromatography using a Superdex 200 prep-grade column (320 mL, GE Healthcare) equilibrated with buffer A. All purification experiments were carried out at 4 ° C.

As a result of SDS-PAGE analysis of the protein purified by the above procedure, a single polypeptide of 44.0 kDa was detected, which corresponds to the molecular weight of the Sr LDC monomer. The purified protein was concentrated to 65 mg / mL using 40 mM Tris-HCl, pH 8.0 and used in the experiment.

Example  2. Preparation and purification of mutant enzymes

Site-directed mutagenesis was performed using Quick Change site-directed mutagenesis kit (stratagene), and mutant proteins of Sr LDC were prepared and purified in the same manner as in Example 1 above. The primers used in the preparation of the mutants are shown in Table 2 below.

Name of the primer order SEQ ID NO: Sr LDC ^K2C _F 5'-GGAGATATACATATGTGTAACTTCCGTTTAAGC -3 ' SEQ ID NO: 9 Sr LDC ^K2C _R 5'-GCTTAAACGGAAGTTACACATATGTATATCTCC -3 ' SEQ ID NO: 10 Sr LDC ^G227C _F 5'-GTTCCCGATGCTAAGTGTCTGAACGTTGACCTG -3 ' SEQ ID NO: 11 Sr LDC ^G227C _R 5'-CAGGTCAACGTTCAGACACTTAGCATCGGGAAC -3 ' SEQ ID NO: 12 Sr LDC ^A225C_F Gt; SEQ ID NO: 13 Sr LDC ^A225C _R 5'-CGTTCAGACCCTTACAATCGGGAACCGGAAAGC -3 ' SEQ ID NO: 14 Sr LDC ^T302C _F 5'-CATGTATGACCATTGGTGCTATCCGCTTCACTG -3 ' SEQ ID NO: 15 Sr LDC ^T302C _R 5'-CAGTGAAGCGGATAGCACCAATGGTCATACATG -3 ' SEQ ID NO: 16 Sr LDC ^K143C _F 5'-CAGTCAGAAACAATTGTGCATTAGTAGACTTG -3 ' SEQ ID NO: 17 Sr LDC ^K143C _R 5'-CAAGTCTACTAATGCACAATTGTTTCTGACTG -3 ' SEQ ID NO: 18 Sr LDC ^L185C _F Gt; SEQ ID NO: 19 Sr LDC ^L185C _R 5'-CATACGCTGCTGTGGAGCAGGACTGGCTGCCAAC -3 ' SEQ ID NO: 20

The produced mutant enzyme Sr LDC ^{A225C / T302C} induces disulfide bonds by replacing Ala225 and Thr302 residues with cysteine, and the mutant enzyme Sr LDC ^{K2C / G227C} induces disulfide bonds by substituting cysteine for Lys2 and Gly227 residues.

Example  3. UV / Vis  Absorption spectrum analysis

In order to measure the amount of the PLP to covalently to Sr LDC protein, Sr LDC using a 0.1 M potassium phosphate buffer (pH 6.0) the UV / Vis absorption spectrum of from 300 nm of the protein up to 500 nm SHIMADZU UV-VIS spectrophotometer UV -1800. ≪ / RTI > 45.42 μM was the final concentration of Sr LDC protein.

Example  4. PLP affinity analysis of enzyme through isothermal titration calorimetry (ITC)

The binding force between the Sr LDC protein and the PLP was measured at 20 ° C using a Nano ITC model (TA Instruments). First, 100 μM of the protein sample was prepared with 40 mM Tris, pH 8.0, and for titration of Sr LDC protein and PLP , And 1.96 μl of 2.5 mM PLP were injected 25 times. The injection interval was 200 seconds, and the protein solution in the ITC reaction cell was padded at 250 rpm. At this time, the temperature difference between the heat and the heat of reaction in diluting the auxiliary factor (PLP) in the buffer was calculated. The thermodynamic coefficient ( K _d , binding affinity) was calculated according to the dependent coupling model using the calculated calories every injection.

Example  5. LDC  Enzyme activity assay

5-1. PLP  Enzyme activity analysis with and without addition

To measure the lysine decarboxylase activity of the Sr LDC protein and the mutant enzyme protein prepared in Example 1 and Example 2, 56.78 μM of the purified enzyme protein was dissolved in 0.1 M potassium phosphate, pH 6.0, 50 μM L-lysine , And 200 μl of reaction mixture containing various concentrations of PLP. Thereafter, the solution was heated at 90 DEG C for 5 minutes to terminate the LDC reaction, followed by centrifugation at 13,500 x g for 5 minutes. The remaining L-lysine was detected using the lysine oxidase / peroxidase method. The lysine oxidase is an enzyme that converts the remaining L-lysine to 6-amino-2-oxohexanoate, NH ₃ , and H ₂ O ₂ , and H ₂ O ₂ Is removed by peroxidase using ABTS (2,2'-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid)). Specifically, 2x lysine oxidase / peroxidase (0.1 unit / ml lysine oxidase, 1 unit / ml peroxidase, 3.6 mM ABTS in 0.1 M potassium phosphate buffer, pH 8.0) was added in the same volume as LDC reaction mixture. At this time, the amount of oxidized ABTS was measured at an absorbance of 412 nm.

5-2. Analysis of Enzyme Activity by pH

On the other hand, in order to examine the effect of pH on LDC activity, LDC activity analysis was performed in the range of pH 5 to 10. To confirm the thermal stability, each enzyme was stored at 37 ° C or 60 ° C for analysis. All experiments were repeated three times.

5-3. Cadaverine Switchability  analysis

4.5 mL of the protein purified in Example 1 and 5 mL of the conversion mixed solution containing 0.5 M potassium phosphate buffer solution (pH 6.0), 0.5 M L-lysine, and various concentrations of PLP were stored at 37 DEG C for 30 minutes to be used , The conversion ability of cadaverine was analyzed in the same manner as in Experimental Example 2-1. Samples were collected hourly, and the amount of L-lysine remaining was measured to observe the ability to convert cadaversine.

Example  6. Sr Of LDC  Melting point ( T _m ) Measure

The binding of the ligand to the target protein changes the heat resistance of the protein. In order to confirm the thermal stability of the Sr LDC protein, the melting point curve was measured using a Protein thermal shift dye (Applied Biosystems) in StepOnePlus Real-Time PCR (Thermo Fisher Scientific) with reference to the manufacturer's manual. Specifically, 1 μg of the protein was mixed with 20 μl of 1 × protein denatured dye, and the signal change (melting point) indicating protein denaturation was measured by raising the temperature from 25 to 90 ° C. The melting point was determined from the first derivative curve.

Example  7. Wild type Sr LDC  And mutant enzymes Sr LDC ^{A225C / T302C} of  Manufacture of crystals

7-1. Wild type Sr LDC  And mutant enzymes Sr LDC ^{A225C / T302C} Crystallization of

Crystallization of the proteins purified in Examples 1 and 2 was carried out at 20 DEG C in a hanging-drop vapor-diffusion method using a commercially available kit sparse-matrix screen (Rigaku, Molecular Dimensions). Specifically, 1.0 μL of protein solution (65 mg / mL in 40 mM Tris-HCl, pH 8.0) and 1.0 μL of reservoir solution were mixed and then equilibrated with 0.5 mL of the reservoir solution.

The crystals of apo-form I of Sr LDC were prepared and observed under various crystallization conditions. As a result, it was found that 28% (w / v) PEG (polyethylene glycol) 400, 0.1 M sodium citrate tribasic-citric acid, pH 6.0 and 0.2 M magnesium chloride The optimum crystal was obtained.

Apo-form II crystals of Sr LDC were prepared by crystallization using a reservoir solution containing 1.15 M sodium citrate, 0.1 M sodium cacodylate, pH 5.0.

On the other hand, crystals of Sr LDC complexed with PLP / cadavirin were precipitated by using a reservoir solution containing 50% PEG 200, 0.1 M sodium citrate, pH 4.2, 0.2 M sodium chloride, and 5 mM pyridoxal 5-phosphate .

The crystals were then soaked in 10 mM L-lysine for 30 minutes each.

Meanwhile, the mutant enzyme Sr LDC ^{A225C / T302C} was crystallized using a reservoir solution containing 1.4 M ammonium sulfate, 0.1 M sodium ^chacodylate , pH 6.5, and 0.2 M sodium chloride.

7-2. Model building of crystals

The crystal prepared in Experimental Example 7-1 was transferred to the above solution and 30% (v / v) glycerol of the cryoprotectant, taken out in a loop larger than the crystal, immersed in liquid nitrogen and immediately frozen.

X-ray diffraction data of the natural crystals were collected using a Quantum 270 CCD detector (ADSC, USA) in a 7A beamline of the Pohang Accelerator Laboratory (PAL, Pohang, Korea). The apo-form I and II crystals of Sr LDC were collected at diffraction data of 2.0 Å and 2.9 Å resolution, respectively. Crystalline Sr LDC and mutant enzyme Sr LDC ^{A225C / T302C} crystals complexed with PLP / ^cadavirin were collected with diffraction data at 2.5 Å and 1.8 Å resolution, respectively. All data was indexed, integrated, and scaled using the HKL2000 software package (Otwinowski & Minor, 1997).

As a result, the apo-form I crystals of Sr LDC belong to the space group P 4 ₃ 2 ₁ 2 and the unit cell parameters were a = b = 105.97 Å, c = 73.634 Å, and α = β = γ = 90.0 ° . The crystallite volume per molecular weight unit of the protein in the Sr LDC 1 molecule in the asymmetric unit was 2.35 Å ³ Da ^{- 1} indicating that the solvent content was 47.63%.

The apo-form II crystals of Sr LDC belong to the space group C 2 and the unit cell parameters are a = 146.45 Å, b = 70.794 Å, c = 88.061 Å, α = γ = 90.0 ° and β = 101.03 °. The crystallite volume per molecular weight unit of the protein in the Sr LDC 2 molecule in the asymmetric unit was 2.54 Å ³ Da ^{- 1} , indicating that the solvent content was 51.68%.

Crystals of Sr LDC complexed with PLP / cadavaline belong to space group P 6 ₃ 2 ₂ and the unit cell parameters are a = b = 111.73 Å, c = 112.97 Å, α = β = 90.0 °, γ = 120.0 Respectively. For one molecule in the asymmetric unit, the crystallite volume per molecular weight unit of protein was 2.31 Å ³ Da ^{- 1} indicating that the solvent content is 46.83%.

The variant enzyme Sr LDC ^{A225C / T302C} crystals ^belong to the space group P 2 ₁ 2 ₁ 2 ₁ and the unit cell parameters are a = 55.91 Å, b = 122.85 Å, c = 136.85 Å, α = beta = γ = 90.0 °. The crystallite volume per protein molecular weight unit in the two Sr LDC ^{A225C / T302C} molecules in the asymmetric unit was 2.67 Å ³ Da ^{- 1} indicating that the solvent content was 53.95%.

On the other hand, Vibrio The structure of apo-form I of Sr LDC was analyzed by molecular replacement method using CCP4 version of MOLREP using L / ODC (lysine / ornithine decarboxylase) structure derived from vulnificus as a search model. The model was manually established using the WinCoot program and adjusted using CCP4 refmac5.

The structure of the Sr LDC, Sr LDC ^{A225C / T302C} mutant complexed with apo-form II, PLP / cadaverine of Sr LDC was determined by the molecular substitution method using the above-mentioned structure of Sr LDC apo-form I . The model was established and adjusted in the same manner as Sr LDC apo-form I.

Data and purification statistics of the above four protein structures are shown in Table 3 below, and PDB codes 5GJN, 5GJM, 5GJP, and 5GJO were assigned to Protein Data Bank.

Experimental Example  One. Sr LDC  Structure analysis of

As a result of analyzing the structure of Sr LDC prepared in Example 1, as shown in FIG. 1A, the wild-type Sr LDC was found to contain lysine / ornithine decarboxylase ( Vv ) of Vibrio vulnificus It can be seen that the overall fold that is preserved and expressed in the ornithine decarboxylase such as L / ODC, PDB code 2PLK, and ODC of Mus musculus ( Mm ODC, PDB code 7ODC) . In the figure, the AS-loop is indicated as orange, the PS-loop as cyan, and the R-loop as magenta. The residues involved in PLP binding were marked with red triangle and the substrate with blue triangle. Residues substituted by cysteine to induce disulfide bonds are indicated by orange lines.

As shown in Figure IB, the monomeric form of Sr LDC is divided into two domains (PLP-binding 'barrier domain' and 'sheet domain'). The 'barrier domain' (Leu27-Cys261) consists of an intersecting pattern of 8 α-helix (α2 - α9; shown in red) and 8 parallel β - strands (β2 - β9; . Eight α-helix encircle eight twisted β-strand cores acting as cofactor binding sites. The 'sheet domain' (Met1-Ser26, Gly262-Val393; shown in cyan) is formed by seven twisted antiparallel β-sheets (β10-β15) surrounded by three short α-helixes. The domain plays a major role in dimerization. In the figure, PLP was expressed as salmon and cadaverine as yellow (hereinafter the same).

As shown in Figure 1c, a Sr LDC homodimer is formed by head-to-tail contact between the barrier domain of one monomer and the sheet domain of another monomer. Calculated by PISA software, the area of 2,474.4 Å of the interfaces accessible by the solvent for one monomer is buried, and the proportion of residues involved is only 19.7%. The same two active sites lie at the dimer interface and the two active sites contain residues of each monomer. 1B, the barrier domains of the other monomers are shown in bright orange and the sheet domains of the other monomers are shown in light blue.

As a result of observing the structure of Sr LDC complexed with PLP / cadaverine in Example 7, it was confirmed that the morphology of Sr LDC was significantly changed when it was combined with PLP which is an assistant.

Specifically, as shown in Fig. 2 (a), when the apo-forms of Sr LDC and Sr LDC, which are complexed with PLP / cadaverine, are overlapped, it can be seen that the two structures are almost similar (mean square root deviation ) 0.72 A). On the other hand, the active site shows a large structural difference. When compared with Sr LDC complexed with PLP / cadaverine, apo-form of Sr LDC has a loop connecting β-7 and α-8 (Phe178-Thr187) Lt; RTI ID = 0.0 > 5.0 < / RTI > In view of this, it appears that the loop is largely involved in the stabilization of PLP by forming a hydrogen bond between the His179 and Ser182 residues of the loop and the phosphate moiety of PLP. That is, when the morphological change occurs, the hydrogen bond between the loops and the phosphate moiety of the PLP is interfered, which can seriously inhibit the binding of PLP to the Sr LDC protein. Therefore, the loop connecting the? -7 and? -8 (Phe178-Thr187) will be referred to as a PLP stabilization loop, that is, a PS-loop.

On the other hand, the form of a loop connecting the? -8 and? -9 (Phe220-Asp231) (hereinafter referred to as a regulatory loop, or R-loop) . Specifically, the R-loop located near the PLP binding site is 12.2 Å away from the PLP binding site in the PLP / cadaverine-bound Sr LDC structure ('complex structure') relative to the apo-form. This structural difference clearly shows that Sr LDC exists in the 'open' form in the apo-form and 'closed' in the complex structure (FIG. 2 (c)). The stabilization mode of the loop in each structure is also different. In the complex structure, the Phe220 main-chain forms a "water-related" hydrogen bond with the Gly257 and Arg258 main-chains, the Ala225 main-chain forms a direct hydrogen bond with the Thr302 main- Interacts with the PS-loop and hydrogen bonds between the Q183 side-chain and the Val222 main-chain. On the other hand, in the case of apo-form, the R-loop is stabilized by the N-terminus: the main-chain of Met1 and Leu228 form hydrogen bonds with each other and the main-chain of Pro223 and Ala225 form the main- Chain and hydrogen bonds.

Further, a loop connecting the? -6 and? -7 (Ile137-Gly153) (hereinafter referred to as an 'active site loop', or 'AS-loop') is a loop that greatly varies in the corresponding enzyme family And is known to effect morphological changes that regulate substrate access to active sites.

Due to the morphological changes of the three loops (PS-, R-, AS-loops) at the active site, the Sr LDC protein changes 'open / closed' morphology depending on the binding of cofactor PLP and / It happens.

On the other hand, the structures of the Sr LDC structure and the Sr LDC complexed with PLP / cadavirin belong to different space groups (Table 3), and the difference in the crystal structure affects the morphological change of the protein part. As shown in FIG. 2 (b), in the dimer of Sr LDC, each monomer shows very different forms of active sites even though no cofactor or substrate is bound. This suggests that the open / closed form of Sr LDC is predominantly determined by the different crystal structures, rather than the association of the cofactor PLP and / or substrate lysine.

On the other hand, the three loops (PS-, R-, AS- loop) as shown in FIG.'S 2 (c), Sr LDC was found to have a high flexibility (flexibility) compared to the other parts of Sr LDC.

Experimental Example  2. Wild type Sr Of LDC  Activity analysis

2-1. PLP  Enzyme activity analysis with and without addition

As a result of analyzing the enzyme activity by the method of Example 5-1, the recombinant Sr LDC protein prepared according to Example 1 did not cause any reaction to the reaction solution without addition of PLP, as shown in FIG. On the other hand, the activity of PLP was greater than 0.1 mM. This suggests that the cofactor PLP does not appear to be active without the PLP feed in the recombinant protein, since it is detached from the purification process of the recombinant Sr LDC protein.

Also, as shown in Fig. 3B, no conversion of lysine to cadaverine was observed without addition of PLP. On the other hand, when the PLP concentration was higher than 0.1 mM, lysine was converted to cadaverine by about 60%. Based on these results, the present inventors speculated that the binding capacity with the auxiliary PLP is extremely low because of the large flexibility of the enzyme active site.

2-2. L / ODC  Comparison of the flexibility of the active site according to its origin

The following experiments were conducted to compare the flexibility of the active site between structurally homologous enzymes. As a result of comparing PLP bound to Vd L / ODC, Mm ODC and Tb ODC in parallel with PLD-coupled Sr LDC protein, the total structure was found to have a mean square deviation of 1.2 Å, 1.4 Å and 1.4 Å, Respectively.

However, PS-loops and R-loops were somewhat different for each protein (Fig. 4 (a)). The PS-loop of Mm L / ODC and Tb ODC was located slightly away from the PLP binding site when compared to the PS-loop of Sr LDC, especially in the case of Mm ODC, between the Ser200 residue of the ODC and the phosphate moiety of the PLP ) -Independent " hydrogen bond, whereas other proteins showed direct hydrogen bonding (Figure 4 (e)). In addition, the R-loop of Mm O / LDC and Tb ODC represents the intermediate shape of the open / closed form of Sr LDC (Fig. 4 (a)). On the other hand, Vv L / ODC showed a lower b-factor compared to other structures, which seems to be due to the dense crystal structure.

Experimental Example  3. Wild type Sr LDC and  Mutant enzyme Sr LDC ^{A225C / T302C}  of PLP  Comparison of stability of binding site

3-1. Structure comparison

From the results of Experimental Example 1-1, Sr LDC seems to have a flexible active site requiring a 'closed' form for PLP binding. In order to confirm this, a mutated enzyme having a stable active site was prepared by maintaining the closed form. Specifically, it was confirmed that the hydrogen bond between the main-chain Ala225 and Thr302 located in the R-loop contributes to the stabilization of the R-loop. By substituting the residues of Ala225 and Thr302 with cysteine, Enzyme Sr LDC ^{A225C / T302C} was ^prepared by the method of Example 2.

Fig. 5 (a) shows a disulfide bond formed between the A225C and T302C residues as predicted by the mutant enzyme Sr LDC ^{A225C / T302C} prepared in Example 2. Fig. The Fo-Fc map of the disulfide bond portion shows contour lines at 3.0σ. The R-loop part is light blue and the mutated residue is represented by the rod model.

Figure 5 (b) shows the mutant enzyme Sr LDC ^{A225C / T302C} structure (AS-loop, PS-loop and R-loop are shown in green, salmon and light-blue respectively) and the wild-type enzyme Sr LDC ^WT When the structures (AS-loop, PS-loop, and R-loop are shown as orange, cyan and magenta respectively) are compared together, the PS- and R- And the b-factors of PS-loop and R-loop are Sr LDC ^WT (Fig. 5 (c)). This indicates that the stability of the loop position is significantly increased by an artificially induced disulfide bond. In addition, the mutant enzyme Sr LDC ^{A225C / T302C} appears to contribute to the type of substrate binding position because the AS-loop is in the 'closed' form (FIG. 5 (d)). In particular, the Val146 residue of the AS-loop is located near the substrate and appears to be involved in stabilizing the hydrocarbon moiety of the lysine substrate. This indicates that the disulfide bond also improves the substrate binding force.

Eventually, the disulfide bonds induced by the mutant enzymes increase the stability of the R-loop and also increase the stability of the PS-loop and ultimately affect the stability of the AS-loop.

On the other hand, when two monomers constituting the Sr LDC ^{A225C / T302C} dimer (represented by orange and cyan ^colors , respectively) are stacked together, they show the same 'closed' form (FIG. 6). Disulfide bonds were labeled as rod models. These results clearly show that disulfide bonds induced by mutant enzymes increase the stability of the active site of Sr LDC.

On the other hand, in order to confirm the opposite effect of the mutant enzyme, an open mutant enzyme was prepared. Specifically, it was confirmed that the R-loop was stabilized by interacting with the N-terminus in the open form of Sr LDC, and the disulfide bond was induced by substituting the Lys2 and Gly227 residues with the cysteine to obtain the mutant enzyme Sr LDC ^{K2C / G227C} 2 method.

Fig. 7A is a ^{graph showing the results of a comparison} between the mutant enzymes Sr LDC ^{A225C / T302C} and Sr LDC ^{K2C / G227C} And the position of the disulfide bond introduced in the molecule. Fig. 7B is a diagram ^{showing the relationship} between the Sr LDC ^{A225C / T302C} in the closed form (right side) And the Sr LDC ^{K2C / G227C} in open form (left).

3-2. Enzyme activity comparison

As shown in FIG. 7C, when 1 mg / ml of enzyme prepared and purified in Example 1 and Example 2 and immersed in lysine was photographed, The Sr LDC ^{A225C / T302C} showed a bright yellow while the mutant enzyme Sr LDC ^{A225C / T302C} showed a light yellow color and the wild type Sr LDC was transparent.

On the other hand, UV / Vis absorption spectra of the respective enzymes were analyzed according to Example 3, and as shown in FIG. 7d, Sr LDC ^{A225C / T302C} showed absorption peaks at 327 nm and 418 nm. This is a characteristic point in the enzyme bound to PLP. On the other hand, Sr LDC ^WT and Sr LDC ^{K2C / G227C} showed no such spectrum. These results suggest that the mutant enzymes Sr LDC ^{A225C / T302C} Sr LDC ^WT or Sr LDC ^{K2C / G227C} Lt; RTI ID = 0.0 > PLP < / RTI > at the enzyme binding site during purification and purification.

Meanwhile, in order to compare the affinity between PLP and enzyme, K _d was measured according to the method of Example 4. As a result, Sr LDC ^WT was 72 μM, while Sr LDC ^{A225C / T302C} was 21 μM. This ^{indicates that} the PLP affinity of the mutant enzyme Sr LDC ^{A225C / T302C} was significantly increased due to the induction of the disulfide bond.

3-3. PLP  Comparison of Enzyme Activities by Concentration

As a result of analyzing the enzyme activity by the method of Example 5-1, the mutant enzyme Sr LDC ^{A225C / T302C} showed more than two times higher activity than Sr LDC ^WT , as shown in FIG. 7f. Sr LDC ^{K2C / G227C} showed only 50% of the activity of Sr LDC ^WT when added with 0.2 mM PLP. More surprisingly, Sr LDC ^{A225C / T302C} showed 65% activity of Sr LDC ^WT activity when added with 0.2 mM PLP even in the absence of PLP. Furthermore, Sr LDC ^{A225C / T302C} showed activity to Sr LDC ^WT supplemented with 0.2 mM PLP as a result of addition of 0.01 mM PLP.

Similar results were observed when analyzing the ability of lysine to convert to cadaverine by the method of Example 5-3 (Fig. 7g). When 0.2 mM PLP was added, the mutant enzyme Sr LDC ^{A225C / T302C} showed nearly 100% conversion, whereas wild type Sr LDC ^WT Of the respondents said that their conversion ability was only 60%. The most surprising result was when little or no PLP was added. When PLP was not added, the mutant enzyme Sr LDC ^{A225C / T302C converted} 25% lysine to cadaverine, while Sr LDC ^WT and Sr LDC ^{K2C / G227C} did not show any such conversion. Furthermore, the addition of 0.02 mM PLP to Sr LDC ^{A225C / T302C resulted} in a much higher conversion rate compared to the addition of 0.2 mM PLP to Sr LDC ^WT . On the other hand, when the cataryline conversion ability was measured and compared with time, the difference became clear (Fig. 7H).

Thus it is a hardly or no addition of PLP when mutant enzyme Sr LDC ^{A225C / T302C} a much improved ability LDC activity and cadaverine converted, displayed because the stability of the PLP binding site increased by structural redesign due to the disulfide bond .

Experimental Example  4. Wild type Sr LDC and  Mutant enzyme Sr LDC ^{A225C / T302C}  Comparison of pH and Temperature Resistance

4-1. Comparison of pH Resistance

LDC is known to have a low activity and a decrease in activity when the pH is lowered. This is because one hydrogen per decarboxylation reaction is consumed and the pH is increased as the reaction progresses, .

To determine whether the mutant enzyme Sr LDC ^{A225C / T302C} is resistant to pH increase, the LDC activity according to the pH was measured according to the method of Example 5-2. As a result, as shown in FIG. 8 (a), both Sr LDC ^{A225C / T302C} and Sr LDC ^WT showed the highest activity at pH 6.0 and the activity gradually decreased with increasing pH. However, the mutant enzyme showed high activity on the pH buffer, and showed LDC activity better than that of Sr LDC ^WT even when the PLP treatment concentration was reduced to 20 times. Especially at pH 10, Sr LDC ^{A225C / T302C} with 0.01 mM PLP Lt; / RTI > activity of < RTI ID = 0.0 > Sr LDC ^WT , and maintained high activity over time.

4-2. Comparison of temperature resistance

The melting point ( T _m ) was measured according to the method of Example 6 to confirm that the thermal stability was also improved due to the induction of the internal disulfide bond. As a result, as shown in (b) of FIG. 8, variation enzyme Sr LDC ^{A225C / T302C} the T _m is to 56.9 ℃, it exhibited higher thermal stability than the T _m of 52.27 ℃ Sr LDC ^WT.

On the other hand, when the two proteins were stored at 37 캜 and their activities were observed, as shown in Fig. 8 (c), Sr LDC ^WT Activity of the mutant enzyme Sr LDC ^{A225C / T302C} was maintained at a high level even after 4 hours.

Next, the two proteins were stored at 60 DEG C and their activities were observed. As a result, as shown in FIG. 8 (d), Sr LDC ^WT Activity of the mutant enzyme Sr LDC ^{A225C / T302C} was still active even after 3 minutes of storage.

These results indicate that the structural redesign by disulfide bonds affects not only the stability but also the thermal stability of the enzyme.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Lysine decarboxylase mutant with an Enhanced Affinity for          Pyridoxal 5-Phosphate and a method for producing cadaverine using          the same <130> KPA161035-KR <160> 20 <170> Kopatentin 2.0 <210> 1 <211> 393 <212> PRT <213> Selenomonas ruminantium <400> 1 Met Lys Asn Phe Arg Leu Ser Glu Lys Glu Val Lys Thr Leu Ala Lys   1 5 10 15 Arg Ile Pro Thr Pro Phe Leu Val Ala Ser Leu Asp Lys Val Glu Glu              20 25 30 Asn Tyr Gln Phe Met Arg Arg His Leu Pro Arg Ala Gly Val Phe Tyr          35 40 45 Ala Met Lys Ala Asn Pro Thr Pro Glu Ile Leu Ser Leu Leu Ala Gly      50 55 60 Leu Gly Ser His Phe Asp Val Ala Ser Ala Gly Glu Met Glu Ile Leu  65 70 75 80 His Glu Leu Gly Val Asp Gly Ser Gln Met Ile Tyr Ala Asn Pro Val                  85 90 95 Lys Asp Ala Arg Gly Leu Lys Ala Ala Ala Asp Tyr Asn Val Arg Arg             100 105 110 Phe Thr Phe Asp Asp Pro Ser Glu Ile Asp Lys Met Ala Lys Ala Val         115 120 125 Pro Gly Ala Asp Val Leu Val Arg Ile Ala Val Arg Asn Asn Lys Ala     130 135 140 Leu Val Asp Leu Asn Thr Lys Phe Gly Ala Pro Val Glu Glu Ala Leu 145 150 155 160 Asp Leu Leu Lys Ala Ala Gln Asp Ala Gly Leu His Ala Met Gly Ile                 165 170 175 Cys Phe His Val Gly Ser Gln Ser Leu Ser Thr Ala Ala Tyr Glu Glu             180 185 190 Ala Leu Val Ala Arg Arg Leu Phe Asp Glu Ala Glu Glu Met Gly         195 200 205 Met His Leu Thr Asp Leu Asp Ile Gly Gly Gly Phe Pro Val Pro Asp     210 215 220 Ala Lys Gly Leu Asn Val Asp Leu Ala Ala Met Met Glu Ala Ile Asn 225 230 235 240 Lys Gln Ile Asp Arg Leu Phe Pro Asp Thr Ala Val Trp Thr Glu Pro                 245 250 255 Gly Arg Tyr Met Cys Gly Thr Ala Val Asn Leu Val Thr Ser Val Ile             260 265 270 Gly Thr Lys Thr Arg Gly Glu Gln Pro Trp Tyr Ile Leu Asp Glu Gly         275 280 285 Ile Tyr Gly Cys Phe Ser Gly Ile Met Tyr Asp His Trp Thr Tyr Pro     290 295 300 Leu His Cys Phe Gly Lys Gly Asn Lys Lys Pro Ser Thr Phe Gly Gly 305 310 315 320 Pro Ser Cys Asp Gly Ile Asp Val Leu Tyr Arg Asp Phe Met Ala Pro                 325 330 335 Glu Leu Lys Ile Gly Asp Lys Val Leu Val Thr Glu Met Gly Ser Tyr             340 345 350 Thr Ser Val Ser Ala Thr Arg Phe Asn Gly Phe Tyr Leu Ala Pro Thr         355 360 365 Ile Ile Phe Glu Asp Gln Pro Glu Tyr Ala Ala Arg Leu Thr Glu Asp     370 375 380 Asp Asp Val Lys Lys Lys Ala Ala Val 385 390 <210> 2 <211> 1182 <212> DNA <213> Selenomonas ruminantium <400> 2 atgaaaaatt tcagacttag cgaaaaagaa gtaaaaacgc ttgccaagcg tatcccgacg 60 ccctttttgg tggcttcact ggacaaggtt gaggaaaact accagtttat gcgccgtcat 120 ttgccgcggg cgggagtgtt ttatgccatg aaggcgaatc ctacgccaga aatactgtcc 180 ctgctggctg gccttggttc tcactttgat gtggcctctg ccggggagat ggagatcctc 240 catgaattgg gcgtagatgg ttcccagatg atatatgcca atccggtaaa ggatgcccgt 300 ggcctcaagg ctgcggctga ctacaatgtc cgccggttta ctttcgacga tccgtcggaa 360 atcgacaaga tggccaaggc tgtgccggga gccgatgtgc tggtgcgcat cgccgtgcgc 420 aacaacaaag ctttggtgga tctgaatacg aagtttggtg cgccggtgga agaagcgctg 480 gatcttttaa aggctgcgca ggatgctggc ctgcatgcca tggggatttg cttccatgtg 540 ggcagccagt ccctgtctac ggcggcttat gaggaagccc tgctggtggc tcgtaggctc 600 tttgatgagg cggaagaaat gggcatgcac ctgactgacc tcgacatcgg cggcggtttc 660 cctgttcccg atgccaaggg gctcaatgtg gatctggcgg ccatgatgga agccatcaac 720 aagcagatcg accgcctgtt cccggataca gctgtttgga cggaaccggg ccgttatatg 780 tgcggtacgg cggtgaacct cgtcacatcg gttatcggca cgaaaacccg tggtgagcag 840 ccttggtata tcttagatga aggcatctat ggctgcttct ccggcatcat gtatgaccac 900 tggacgtacc cgcttcattg cttcggcaag gggaataaga aaccttcgac tttcggcggc 960 cccagctgcg atggcatcga tgtgctctat cgcgacttca tggcaccgga gctcaagatc 1020 ggggacaagg tgctggtgac ggaaatgggt tcctatacca gcgtcagcgc tacgcgtttc 1080 aacggtttct acctggcgcc caccatcatc tttgaggacc agccggaata tgcagcccgt 1140 ctgacggaag atgatgatgt gaagaaaaag gcggctgtat aa 1182 <210> 3 <211> 399 <212> PRT <213> Vibrio vulnificus <400> 3 Met Ala His Ser His Pro Ile Phe Asp Ile Gln Ser Leu Thr Ser Pro   1 5 10 15 Ala Leu Ser Ala Glu Glu Ile Gln Val Ile Glu Thr Ser Val Glu Gln              20 25 30 Phe Gly Ala Pro Leu Leu Leu Leu Asp Cys Asp Val Ile Arg Gln Gln          35 40 45 Tyr Arg Ala Leu Lys Asn Ala Leu Pro Asn Val Thr Leu His Tyr Ala      50 55 60 Leu Lys Pro Leu Pro His Pro Val Val Val Arg Thr Leu Leu Ala Glu  65 70 75 80 Gly Ala Ser Phe Asp Leu Ala Thr Thr Gly Glu Val Glu Leu Val Ala                  85 90 95 Ser Glu Gly Val Pro Ala Glu Leu Thr Ile His Thr His Pro Ile Lys             100 105 110 Arg Asp Ala Asp Ile Arg Asp Ala Leu Ala Tyr Gly Cys Asn Val Phe         115 120 125 Val Val Asp Asn Leu Asn Glu Leu Glu Lys Phe Lys Ala Tyr Arg Asp     130 135 140 Glu Val Glu Leu Leu Val Arg Leu Ser Phe Arg Asn Ser Glu Ala Phe 145 150 155 160 Ala Asp Leu Ser Lys Lys Phe Gly Cys Ser Pro Glu Gln Ala Leu Val                 165 170 175 Ile Ile Glu Thr Ala Lys Glu Trp Asn Ile Arg Ile Lys Gly Leu Ser             180 185 190 Phe His Val Gly Ser Gln Thr Thr Asn Pro Asn Lys Tyr Val Glu Ala         195 200 205 Ile His Thr Cys Arg Asn Val Met Glu Gln Val Val Glu Arg Gly Leu     210 215 220 Pro Ala Leu Ser Thr Leu Asp Ile Gly Gly Gly Phe Pro Val Asn Tyr 225 230 235 240 Thr Gln Gln Val Met Pro Ile Asp Gln Phe Cys Val Pro Ile Asn Glu                 245 250 255 Ala Leu Ser Leu Leu Pro Glu Thr Val His Val Leu Ala Glu Pro Gly             260 265 270 Arg Phe Ile Cys Ala Pro Ala Val Thr Ser Val Ala Ser Val Met Gly         275 280 285 Gln Ala Glu Arg Glu Gly Gln Ile Trp Tyr Tyr Leu Asp Asp Gly Ile     290 295 300 Tyr Gly Ser Phe Ser Gly Leu Met Phe Asp Asp Ala Arg Tyr Pro Leu 305 310 315 320 Thr Ile Lys Gln Gly Gly Glu Leu Ile Pro Ser Val Leu Ser Gly                 325 330 335 Pro Thr Cys Asp Ser Val Asp Val Ile Ala Glu Asn Ile Leu Leu Pro             340 345 350 Lys Leu Asn Asn Gly Asp Leu Val Ile Gly Arg Thr Met Gly Ala Tyr         355 360 365 Thr Ser Ala Thr Ala Thr Asp Phe Asn Phe Phe Lys Arg Ala Gln Thr     370 375 380 Ile Ala Leu Asn Glu Phe Val Ala Gly Ser Glu Arg Met Ile Gly 385 390 395 <210> 4 <211> 461 <212> PRT <213> Mus musculus <400> 4 Met Ser Ser Phe Thr Lys Asp Glu Phe Asp Cys His Ile Leu Asp Glu   1 5 10 15 Gly Phe Thr Ala Lys Asp Ile Leu Asp Gln Lys Ile Asn Glu Val Ser              20 25 30 Ser Ser Asp Asp Lys Asp Ala Phe Tyr Val Ala Asp Leu Gly Asp Ile          35 40 45 Leu Lys Lys His Leu Arg Trp Leu Lys Ala Leu Pro Arg Val Thr Pro      50 55 60 Phe Tyr Ala Val Lys Cys Asn Asp Ser Arg Ala Ile Val Ser Thr Leu  65 70 75 80 Ala Ala Ile Gly Thr Gly Phe Asp Cys Ala Ser Lys Thr Glu Ile Gln                  85 90 95 Leu Val Gln Gly Leu Gly Val Pro Ala Glu Arg Val Ile Tyr Ala Asn             100 105 110 Pro Cys Lys Gln Val Ser Gln Ile Lys Tyr Ala Ala Ser Asn Gly Val         115 120 125 Gln Met Met Thr Phe Asp Ser Glu Ile Glu Leu Met Lys Val Ala Arg     130 135 140 Ala His Pro Lys Ala Lys Leu Val Leu Arg Ile Ala Thr Asp Asp Ser 145 150 155 160 Lys Ala Val Cys Arg Leu Ser Val Lys Phe Gly Ala Thr Leu Lys Thr                 165 170 175 Ser Arg Leu Leu Leu Glu Arg Ala Lys Glu Leu Asn Ile Asp Val Ile             180 185 190 Gly Val Ser Phe His Val Gly Ser Gly Cys Thr Asp Pro Glu Thr Phe         195 200 205 Val Gln Ala Val Ser Asp Ala Arg Cys Val Phe Asp Met Ala Thr Glu     210 215 220 Val Gly Phe Ser Met His Leu Leu Asp Ile Gly Gly Gly Phe Pro Gly 225 230 235 240 Ser Glu Asp Thr Lys Leu Lys Phe Glu Glu Ile Thr Ser Val Ile Asn                 245 250 255 Pro Ala Leu Asp Lys Tyr Phe Pro Ser Asp Ser Gly Val Arg Ile Ile             260 265 270 Ala Glu Pro Gly Arg Tyr Tyr Val Ala Ser Ala Phe Thr Leu Ala Val         275 280 285 Asn Ile Ile Ala Lys Lys Thr Val Trp Lys Glu Gln Pro Gly Ser Asp     290 295 300 Asp Glu Asp Glu Ser Asn Glu Gln Thr Phe Met Tyr Tyr Val Asn Asp 305 310 315 320 Gly Val Tyr Gly Ser Phe Asn Cys Ile Leu Tyr Asp His Ala His Val                 325 330 335 Lys Ala Leu Leu Gln Lys Arg Pro Lys Pro Asp Glu Lys Tyr Tyr Ser             340 345 350 Ser Ser Ile Trp Gly Pro Thr Cys Asp Gly Leu Asp Arg Ile Val Glu         355 360 365 Arg Cys Asn Leu Pro Glu Met His Val Gly Asp Trp Met Leu Phe Glu     370 375 380 Asn Met Gly Ala Tyr Thr Val Ala Ala Ser Thr Phe Asn Gly Phe 385 390 395 400 Gln Arg Pro Asn Ile Tyr Tyr Val Met Ser Arg Pro Met Trp Gln Leu                 405 410 415 Met Lys Gln Ile Gln Ser His Gly Phe Pro Pro Glu Val Glu Glu Gln             420 425 430 Asp Asp Gly Thr Leu Pro Met Ser Cys Ala Gln Glu Ser Gly Met Asp         435 440 445 Arg His Pro Ala Ala Cys Ala Ser Ala Arg Ile Asn Val     450 455 460 <210> 5 <211> 423 <212> PRT <213> Trypanosoma brucei <400> 5 Met Asp Ile Val Val Asn Asp Asp Leu Ser Cys Arg Phe Leu Glu Gly   1 5 10 15 Phe Asn Thr Arg Asp Ala Leu Cys Lys Lys Ile Ser Met Asn Thr Cys              20 25 30 Asp Glu Gly Asp Pro Phe Phe Val Ala Asp Leu Gly Asp Ile Val Arg          35 40 45 Lys His Glu Thr Trp Lys Lys Cys Leu Pro Arg Val Thr Pro Phe Tyr      50 55 60 Ala Val Lys Cys Asn Asp Asp Trp Arg Val Leu Gly Thr Leu Ala Ala  65 70 75 80 Leu Gly Thr Gly Phe Asp Cys Ala Ser Asn Thr Glu Ile Gln Arg Val                  85 90 95 Arg Gly Ile Gly Val Pro Pro Glu Lys Ile Ile Tyr Ala Asn Pro Cys             100 105 110 Lys Gln Ile Ser His Ile Arg Tyr Ala Arg Asp Ser Gly Val Asp Val         115 120 125 Met Thr Phe Asp Cys Val Asp Glu Leu Glu Lys Val Ala Lys Thr His     130 135 140 Pro Lys Ala Lys Met Val Leu Arg Ile Ser Thr Asp Asp Ser Leu Ala 145 150 155 160 Arg Cys Arg Leu Ser Val Lys Phe Gly Ala Lys Val Glu Asp Cys Arg                 165 170 175 Phe Ile Leu Glu Gln Ala Lys Lys Leu Asn Ile Asp Val Thr Gly Val             180 185 190 Ser Phe His Val Gly Ser Gly Ser Thr Asp Ala Ser Thr Phe Ala Gln         195 200 205 Ala Ile Ser Asp Ser Arg Phe Val Phe Asp Met Gly Thr Glu Leu Gly     210 215 220 Phe Asn Met His Ile Leu Asp Ile Gly Gly Gly Phe Pro Gly Thr Arg 225 230 235 240 Asp Ala Pro Leu Lys Phe Glu Glu Ile Ala Gly Val Ile Asn Asn Ala                 245 250 255 Leu Glu Lys His Phe Pro Pro Asp Leu Lys Leu Thr Ile Val Ala Glu             260 265 270 Pro Gly Arg Tyr Tyr Val Ala Ser Ala Phe Thr Leu Ala Val Asn Val         275 280 285 Ile Ala Lys Lys Val Thr Pro Gly Val Gln Thr Asp Val Gly Ala His     290 295 300 Ala Glu Ser Asn Ala Gln Ser Phe Met Tyr Tyr Val Asn Asp Gly Val 305 310 315 320 Tyr Gly Ser Phe Asn Cys Ile Leu Tyr Asp His Ala Val Val Arg Pro                 325 330 335 Leu Pro Gln Arg Glu Pro Ile Pro Asn Glu Lys Leu Tyr Pro Ser Ser             340 345 350 Val Trp Gly Pro Thr Cys Asp Gly Leu Asp Gln Ile Val Glu Arg Tyr         355 360 365 Tyr Leu Pro Glu Met Glu Val Gly Glu Trp Leu Leu Phe Glu Asp Met     370 375 380 Gly Ala Tyr Thr Val Gly Thr Ser Ser Phe Asn Gly Phe Gln Ser 385 390 395 400 Pro Thr Ile Tyr Val Val Ser Gly Leu Pro Asp His Val Val Arg                 405 410 415 Glu Leu Lys Ser Gln Lys Ser             420 <210> 6 <211> 393 <212> PRT <213> Artificial Sequence <220> <223> Lysine decarboxylase mutant <400> 6 Met Lys Asn Phe Arg Leu Ser Glu Lys Glu Val Lys Thr Leu Ala Lys   1 5 10 15 Arg Ile Pro Thr Pro Phe Leu Val Ala Ser Leu Asp Lys Val Glu Glu              20 25 30 Asn Tyr Gln Phe Met Arg Arg His Leu Pro Arg Ala Gly Val Phe Tyr          35 40 45 Ala Met Lys Ala Asn Pro Thr Pro Glu Ile Leu Ser Leu Leu Ala Gly      50 55 60 Leu Gly Ser His Phe Asp Val Ala Ser Ala Gly Glu Met Glu Ile Leu  65 70 75 80 His Glu Leu Gly Val Asp Gly Ser Gln Met Ile Tyr Ala Asn Pro Val                  85 90 95 Lys Asp Ala Arg Gly Leu Lys Ala Ala Ala Asp Tyr Asn Val Arg Arg             100 105 110 Phe Thr Phe Asp Asp Pro Ser Glu Ile Asp Lys Met Ala Lys Ala Val         115 120 125 Pro Gly Ala Asp Val Leu Val Arg Ile Ala Val Arg Asn Asn Lys Ala     130 135 140 Leu Val Asp Leu Asn Thr Lys Phe Gly Ala Pro Val Glu Glu Ala Leu 145 150 155 160 Asp Leu Leu Lys Ala Ala Gln Asp Ala Gly Leu His Ala Met Gly Ile                 165 170 175 Cys Phe His Val Gly Ser Gln Ser Leu Ser Thr Ala Ala Tyr Glu Glu             180 185 190 Ala Leu Val Ala Arg Arg Leu Phe Asp Glu Ala Glu Glu Met Gly         195 200 205 Met His Leu Thr Asp Leu Asp Ile Gly Gly Gly Phe Pro Val Pro Asp     210 215 220 Cys Lys Gly Leu Asn Val Asp Leu Ala Ala Met Met Glu Ala Ile Asn 225 230 235 240 Lys Gln Ile Asp Arg Leu Phe Pro Asp Thr Ala Val Trp Thr Glu Pro                 245 250 255 Gly Arg Tyr Met Cys Gly Thr Ala Val Asn Leu Val Thr Ser Val Ile             260 265 270 Gly Thr Lys Thr Arg Gly Glu Gln Pro Trp Tyr Ile Leu Asp Glu Gly         275 280 285 Ile Tyr Gly Cys Phe Ser Gly Ile Met Tyr Asp His Trp Cys Tyr Pro     290 295 300 Leu His Cys Phe Gly Lys Gly Asn Lys Lys Pro Ser Thr Phe Gly Gly 305 310 315 320 Pro Ser Cys Asp Gly Ile Asp Val Leu Tyr Arg Asp Phe Met Ala Pro                 325 330 335 Glu Leu Lys Ile Gly Asp Lys Val Leu Val Thr Glu Met Gly Ser Tyr             340 345 350 Thr Ser Val Ser Ala Thr Arg Phe Asn Gly Phe Tyr Leu Ala Pro Thr         355 360 365 Ile Ile Phe Glu Asp Gln Pro Glu Tyr Ala Ala Arg Leu Thr Glu Asp     370 375 380 Asp Asp Val Lys Lys Lys Ala Ala Val 385 390 <210> 7 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> SrLDC_F primer <400> 7 gcgcgcatat gaaaaacttc cgtttaagcg aaaaag 36 <210> 8 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> SrLDC_R primer <400> 8 gcgcgctcga ggtgatggtg atggtggtga actgct 36 <210> 9 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> SrLDC (K2C) _F primer <400> 9 ggagatatac atatgtgtaa cttccgttta agc 33 <210> 10 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> SrLDC (K2C) _R primer <400> 10 gcttaaacgg aagttacaca tatgtatatc tcc 33 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> SrLDC (G227C) _F primer <400> 11 gttcccgatg ctaagtgtct gaacgttgac ctg 33 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> SrLDC (G227C) _R primer <400> 12 caggtcaacg ttcagacact tagcatcggg aac 33 <210> 13 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> SrLDC (A225C) _F primer <400> 13 gctttccggt tcccgattgt aagggtctga acg 33 <210> 14 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> SrLDC (A225C) _R primer <400> 14 cgttcagacc cttacaatcg ggaaccggaa agc 33 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> SrLDC (T302C) _F primer <400> 15 catgtatgac cattggtgct atccgcttca ctg 33 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> SrLDC (T302C) _R primer <400> 16 cagtgaagcg gatagcacca atggtcatac atg 33 <210> 17 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> SrLDC (K143C) _F primer <400> 17 cagtcagaaa caattgtgca ttagtagact tg 32 <210> 18 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> SrLDC (K143C) _R primer <400> 18 caagtctact aatgcacaat tgtttctgac tg 32 <210> 19 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> SrLDC (L185C) _F primer <400> 19 gttggcagcc agtcctgctc cacagcagcg tatg 34 <210> 20 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> SrLDC (L185C) _R primer <400> 20 catacgctgc tgtggagcag gactggctgc caac 34

Claims (21)

Wherein the activity of the lysine decarboxylase mutant is increased relative to the wild type, wherein the 225th amino acid and the 302th amino acid of the wild type lysine decarboxylase consisting of the amino acid sequence of SEQ ID NO: 1 are substituted with cysteine, respectively.
The method according to claim 1,
Wherein the mutant enzyme is one wherein two substituted cysteines form a disulfide bond.
delete The method according to claim 1,
Wherein the mutant enzyme has improved stability against temperature or pH as compared to the wild-type enzyme.
The method according to claim 1,
Wherein said mutant enzyme converts lysine to cadaverine without the addition of pyridoxal 5-phosphate.
The method according to claim 1,
Wherein the mutant enzyme is an amino acid sequence represented by SEQ ID NO: 6.
The method according to claim 1,
Wherein the mutant enzyme exhibits any one or more of the following characteristics (a) to (c):
(a) K _d = 21 μM;
(b) 20-60% conversion to cadaverine when pyridoxal 5-phosphate is not added; And
(c) Melting point ( T _m ) = 56.9 ° C.
The method according to claim 1,
The crystals of the mutant enzyme belong to the space group P 2 ₁ 2 ₁ 2 ₁ and the unit cell parameters are a = 55.91 Å, b = 122.85 Å, c = 136.85 Å, and α = beta = gamma = 90.0 [deg.].
A lysine decarboxylase mutant enzyme gene encoding the mutant enzyme of any one of claims 1, 2, and 4 to 8.
A lysine decarboxylase mutant enzyme gene encoding a protein in which the amino acids at positions 225 and 302 are substituted with cysteine in the amino acid sequence of SEQ ID NO: 1.
A cassette for producing cadaverine, comprising the gene of claim 9.
A transformant for producing cadaverine, comprising the cassette of claim 11.
A composition for the production of cadaverine, comprising the transformant of claim 12 or a culture thereof.
14. The method of claim 13,
&Lt; / RTI &gt; wherein the composition further comprises lysine.
A method for producing cadaverine, comprising culturing the transformant of claim 12.
16. The method of claim 15,
Wherein the culturing is carried out in a medium comprising lysine.
16. The method of claim 15,
Wherein the method further comprises recovering cadaverine from the cultured transformant or a culture thereof.
delete The lysine decarboxylase mutation of SEQ ID NO: 6, comprising the step of mixing a lysine decarboxylase mutant enzyme protein solution of SEQ ID NO: 6 with a reservoir solution comprising ammonium sulfate, sodium chocodylate, and sodium chloride, A method for producing an enzyme crystal.
delete delete

Images