KR101917159B1 - Composition for Facilitating the Differentiation of Monocyte Comprising Fractalkine as an Effective Ingredient - Google Patents

Abstract

The present invention relates to a composition for inducing differentiation of mononuclear cells including a fractal can, and it is possible to convert a monocyte into a monocyte that induces angiogenesis by adding a fractalcain during monocyte culture. Therefore, , And monocytes capable of inducing angiogenesis obtained by the present invention can be used as an active ingredient of a therapeutic agent for ischemic diseases.

Description

TECHNICAL FIELD [0001] The present invention relates to a composition for inducing differentiation of mononuclear cells including a fractalkin,

The present invention relates to a composition for inducing differentiation of monocytes and a method for inducing differentiation of monocytes using the same.

In the ischemic state, a collateral vessel grows in the existing blood vessels and supplies blood to the ischemic area. Myeloid derived suppressor cells (MDSCs), which are myeloid derived suppressor cells, are attracting attention in relation to angiogenesis. They coexpress Gr1 and CD11b on the cell surface and participate in angiogenesis in the tumor.

The present inventors have studied bone marrow-derived inhibitory cells involved in angiogenesis. When the femoral artery of the C57BL / 6 mouse was excised, the surface antigen in the ischemic muscle was recovered from the bone marrow-derived inhibitory cells (CD11b ⁺ Gr1dim) (CD11b ⁺ Gr1dim cells) were injected into the ischemic muscle of the C57BL / 6 mice, which resulted in a significant increase in blood flow, resulting in a significant increase in CD11b ⁺ Gr1dim cells It was confirmed that it is a cell capable of promoting angiogenesis (Non-Patent Document 1). The CD11b ⁺ Gr1dim cell was a monocyte / macrophage cell line containing CX3CR1 ⁺ , CCR2 ⁺ , CCR5 ⁺ , and CXCR4 ⁺ monocytes. After analysis of all subset in ischemic muscle after femoral artery incision, CD11b ⁺ CX3CR1 ⁺ Cells was increased by a factor of 100 compared with that before surgery, and the subsequent experiments focused on CD11b ⁺ CX3CR1 ⁺ cells.

Studies on cells involved in angiogenesis in the ischemic state have been conducted, and studies have been made on application of ischemic muscle-derived cells as an effective ingredient of a therapeutic agent for ischemic diseases. However, in the case of ischemic muscle-derived cells, It is difficult to obtain a sufficient amount to be applicable, so it is necessary to develop a substance or a method for converting monocytes into monocytes that can induce angiogenesis by differentiating monocytes into specific cells.

On the other hand, one kind of chemokine, fractalkine, is expressed in activated endothelial cells. Expression of fractal kines is upregulated by tumor necrosis factor-alpha, TNF-alpha, interleukin-1 beta, and lipopolysaccharide (LPS). Fracticain exists in a chemically soluble form that is either fixed on the membrane or liberated. The full-length, membrane-penetrating fractal kain acts as an adhesion molecule and efficiently captures cells in a physiological flow environment.

Soluble forms of fractal kines function as potent chemotactic factors for monocytes, T cells and natural killer cells, and these fractal kines can be used for atherosclerosis, heart transplant rejection, HIV infection, rheumatoid arthritis and sepsis It is known that in various diseases, its expression is increased at the site of injury to blood vessels and tissues. Therefore, the regulation of the expression of fractal kain in vascular endothelial cells seems to be important for the prevention and treatment of these diseases. However, the functions other than the above effect of the fractal car have not been clarified enough.

Accordingly, the inventors of the present invention conducted a study to apply monocyte isolated from bone marrow to the treatment of ischemic diseases. In the process of treating the monocytes isolated from the bone marrow, the bone marrow-derived mononuclear cells are differentiated into monocytes capable of inducing angiogenesis The present invention has been completed.

Jeong A. Kim et al., Blood 116, 1623-1626 (2010)

It is an object of the present invention to provide a method for producing monocytes which can induce angiogenesis by converting or differentiating monocytes derived from bone marrow into monocytes capable of inducing angiogenesis, To provide the technology.

In order to achieve the above object, one aspect of the present invention provides a composition for inducing differentiation of mononuclear cells comprising a fractal can.

According to another aspect of the present invention, there is provided a method for inducing differentiation of monocytes comprising treating a monocyte with a fractalkin.

According to the composition or method of the present invention, monocytes derived from bone marrow can be transformed or differentiated into monocytes capable of inducing angiogenesis, and monocytes capable of inducing angiogenesis thus produced can be used as an active ingredient of a therapeutic agent for ischemic diseases The composition or method of the present invention can be used to mass-produce effective components for the treatment of ischemic diseases from bone marrow-derived mononuclear cells. However, the effects of the present invention are not limited to the above-mentioned effects, and other effects not mentioned can be clearly understood by those skilled in the art from the following description.

FIG. 1 is a graph comparing blood flow enhancement effects of CD11b ⁺ CX3CR1 ⁺ cells isolated from ischemic muscle and CD11b ⁺ CX3CR1 ⁺ cells in bone marrow.
FIGS. 2A and 2B show the results of analysis of the characteristics of CD11b ⁺ CX3CR1 ⁺ cells isolated from ischemic muscle. FIG. 2c shows the results of confirming the expression level of PF-4 in CD11b ⁺ CX3CR1 ⁺ cells isolated from ischemic muscle. FIG. 2d shows the results of confirming mRNA expression of PF-4 and HPRT in CD11b ⁺ CX3CR1 ⁺ cells isolated from ischemic muscle.
FIGS. 3A and 3B show the results of confirming the effect of the ischemic muscle-derived CD11b ⁺ CX3CR1 ⁺ cells on the angiogenic activity of the cells with and without PF-4. FIG. 3C and FIG. 3D show the results of confirming the effect of PF-4 on the angiogenic activity of VEGF.
FIG. 4A shows the results of confirming changes in the characteristics of CD11b ⁺ CX3CR1 ⁺ cells by fractalkine treatment. FIG. FIG. 4B shows the results of confirming the degree of angiogenic activity of bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells treated with fractal kain.
FIGS. 5A to 5E show the results of confirming changes in characteristics of mouse bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells by treatment with fractal kines. FIG. 5A shows the results of confirming the expression of PF-4 after the treatment with fractal kain by immunofluorescence staining. Figure 5b shows the effect of the HPRT (lane 1) on bone marrow derived CD11b ⁺ CX3CR1 ⁺ cells (lane 1), bone marrow derived CD11b ⁺ CX3CR1 ⁺ cells treated with fractal kain (lane 2), and ischemic muscle derived CD11b ⁺ CX3CR1 ⁺ cells Control group) and PF-4 mRNA expression level. FIG. 5C shows the results of confirming the expression amount of PF-4 according to the treatment amount of the fractal kain or the treatment time. FIG. 5D shows the degree of angiogenic activity of bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells treated with fractal kain. FIG. FIG. 5E is a graph showing the germination index relative to each test group. FIG. The mean ± SD is expressed relative to the control fragment (treated in control batch) set to 1.0. * p < 0.05.

First, terms used in the specification of the present invention will be described.

The term 'monocyte capable of inducing angiogenesis' referred to in the present invention is a monocyte having CD11b and CX3CR1 on the cell surface and expressing PF-4. Mononuclear cells capable of inducing angiogenesis induce blood vessel-forming cells, such as endothelial cells, smooth muscle cells and vascular progenitor cells, to form new blood vessels. Angiogenesis is mediated by the infiltration of endothelial cells and smooth muscle cells, and specifically 1) blood vessels can be generated from pre-existing blood vessels, 2) neovascularization of blood vessels can arise from vascular precursor cells, and 3) The diameter of the small blood vessel can be expanded. As described above, the monocytes capable of inducing angiogenesis of the present invention induce the endothelial cells, smooth muscle cells and vascular precursor cells involved in angiogenesis to form blood vessels.

Hereinafter, the present invention will be described in detail.

An aspect of the present invention provides a composition for inducing differentiation of mononuclear cells comprising fractalkine.

The fractal canine may be a protein comprising SEQ ID NO: 1 (a protein comprising Accession number NP_001291321). In addition, the fractal kain may be mutants or fragments of amino acids having different sequences by deletion, insertion, substitution, or a combination of amino acid residues within a range not affecting the function of the protein. Amino acid exchanges at the protein and peptide levels that do not globally alter the activity of the fractal kain are known in the art. In some cases, it may be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, and the like. Accordingly, the present invention includes a protein having substantially the same amino acid sequence as the protein of SEQ ID NO: 1, a mutant thereof, or an active fragment thereof. The substantially same protein means those having an amino acid sequence homology of not less than 80%, preferably not less than 90%, and most preferably not less than 95%, but is not limited thereto, and has homology of not less than 80% Is encompassed within the scope of the present invention.

The mononuclear cell may have CD11b and CX3CR1 on the cell surface. The monocyte may be selected from the group consisting of monocytes derived from human umbilical cord blood, human peripheral blood mononuclear cells, and human bone marrow mononuclear cells, and is preferably a human bone marrow derived mononuclear cell, but is not limited thereto. For example, cells containing CD11b and CX3CR1 and having other antigens on the cell surface are also applicable to the present invention.

The fractal kain may be contained in an amount of 0.1 to 10,000 ng / ml, preferably 1 to 9,000 ng / ml, more preferably 2 to 7,000 ng / ml, but is not limited thereto. In the case of containing the fractal canine at less than 0.1 ng / ml, there is a problem that monocytes are not sufficiently differentiated into monocytes capable of inducing angiogenesis, and even if the fractal can exceeds 10000 ng / ml, there is no particular problem but economically ineffective There are disadvantages. In treatment of the fractal cane at a concentration of 1000 ng / ml to 9000 ng / ml, monocytes having CD11b and CX3CR1 on the cell surface can be differentiated into monocytes capable of inducing angiogenesis, even if the treatment time is 5 to 20 minutes.

In a specific example of the present invention, bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells were treated with fractal kain at concentrations of 10 ng / ml and 50 ng / ml, respectively, for 10 minutes or 30 minutes, or treated at a concentration of 5000 ng / When reacted, it was confirmed that the bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells were converted into cells capable of inducing angiogenesis (see FIGS. 5A and 5C).

The composition may include a fractalkin alone or may include other cytokines, compounds, and the like capable of differentiating monocytes into monocytes capable of inducing angiogenesis.

In addition, the composition may be used in culturing mononuclear cells contained in a culture medium. The culture medium may be a conventional culture medium, which may be a conventional culture medium that can be used for the culture of mononuclear cells. Examples of the medium include Iscove's Modified Dulbecco's Medium medium, DMEM, MEM, alpha-MEM, A conventional cell culture medium such as Eagles basic medium, CMRL medium, RPMI 1640 medium, Ham's F-10/12 medium, Fisher's medium, McCoy's 5A medium, Leibovitz's medium and MCDB medium.

Another aspect of the present invention is to provide a method for inducing differentiation of monocytes comprising treating monocytes with a fractalkin.

The monocyte has CD11b and CX3CR1 on the cell surface. The mononuclear cell may be selected from the group consisting of monocytes derived from human umbilical cord blood, human peripheral blood mononuclear cells, and human bone marrow mononuclear cells, preferably monocytes derived from human bone marrow, but is not limited thereto. For example, it may be applied to the present invention if it has another antigen on the cell surface including CD11b and CX3CR1.

The fractal cane may be treated alone, mixed with the culture medium and treated, or monocyte may be first cultured in a culture medium first, followed by treatment with fractal kines, but not limited thereto . The time of treatment of the fractal cane may be treated after monocyte proliferation, or in the case of monocyte subculture, but not always limited thereto.

The fractalkin can be treated for 5 minutes to 3 hours, preferably 5 minutes to 2.5 hours, and more preferably 5 minutes to 2 hours, but is not limited thereto. When the fractal can is treated for less than 5 minutes, there is a problem that monocytes are not sufficiently differentiated into mononuclear cells capable of inducing angiogenesis, and when the fractal can is treated for more than 3 hours, the process is not efficient have.

The induction of differentiation of the monocytes may be performed in an in-vitro state or in an in-vivo state, and in particular in a CO ₂ incubator when performed in an in-vitro state.

The culture in the CO ₂ incubator can be carried out in an environment with a CO ₂ concentration of 5 to 15%, preferably 5 to 10%, more preferably 5 to 8% It is not limited. The inside of the CO ₂ incubator may be filled with O ₂ in addition to the CO ₂ .

The cultivation can be carried out at a temperature range of 25 to 45 캜, preferably 30 to 40 캜, more preferably 34 to 37 캜, but is not limited thereto. When the incubation temperature is outside the above temperature range, the differentiation of monocytes is not promoted efficiently and the number of mononuclear cells to be killed is increased.

In a specific example of the present invention, bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells were treated with 50 ng / ml of Fractalkine and reacted for 30 minutes. As a result, bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells were treated with PF- , And it was confirmed that sprouting of endothelial cells was significantly increased during scarring and culturing of the aorta (see FIGS. 5A to 5E).

Another aspect of the present invention provides a composition for treating ischemic diseases for improving or treating ischemic diseases comprising monocytes capable of inducing angiogenesis obtained by the method of inducing differentiation of monocytes. Preferably, the composition for treating ischemic diseases of the present invention contains, as an active ingredient, a human monocytic cell expressing PF-4 obtained by the method for inducing differentiation of monocytes of the present invention.

Examples of ischemic diseases that can be treated with the therapeutic composition of the present invention include diabetic foot ulcer, Burger's disease, ischemic leg arterial disease, ischemic myocardial infarction heart failure, hypertensive heart disease, arrhythmia, congenital heart disease, stroke, peripheral vascular disease, Angina pectoris, cerebral vascular dementia, coronary artery insufficiency, cerebral insufficiency, and vascular disease.

The therapeutic composition of the present invention contains 1.0 × 10 ⁴ to 1.0 × 10 ⁸ cells per 1 ml, preferably 1.0 × 10 ⁵ to 1.0 × 10 ⁷ cells, more preferably 1.0 × 10 ⁶ cells per 1 ml .

In addition, the therapeutic composition of the present invention can be formulated into a unit dosage form suitable for intra-body administration of a patient according to a conventional method, and the preparation can be administered once or several times, Lt; / RTI &gt; effective dose. Examples of suitable formulations include injections such as injection ampoules, injection bags, etc., injected as parenteral administration preparations, and the like. The injectable ampoule may be mixed with the injection solution immediately before use. As the injection solution, physiological saline, glucose, mannitol, and Ringer's solution may be used. The injection bag may be made of polyvinyl chloride or polyethylene.

In addition to the active ingredient, the therapeutic composition may further comprise one or more pharmaceutically acceptable carriers. For example, in the case of an injection, a preservative, an anhydrous agent, a solubilizing agent or a stabilizer may be included, Formulations may include bases, excipients, lubricants or preservatives, and the like.

The therapeutic composition of the present invention can be administered by a conventional method of administration, preferably by a parenteral administration method, and can be administered, for example, by injection, by direct implantation into a diseased site, It is also possible to transplant by.

The daily dose of the cells of the present invention can be administered once or several times in the range of 1.0 × 10 ⁵ to 1.0 × 10 ⁷ cells / kg body weight, preferably 1.0 × 10 ⁵ to 1.0 × 10 ⁶ cells / kg body weight However, the actual dosage can be adjusted depending on the disease, the severity of the disease, the route of administration, the weight of the patient, age and sex, and the like.

Hereinafter, the present invention will be described in detail with reference to Production Examples, Examples and Experimental Examples.

However, the following Production Examples, Examples and Experimental Examples are for illustrating the present invention, and the contents of the present invention are not limited by the following Production Examples, Examples and Experimental Examples.

[ Example  And Experimental Example ]

In bone marrow or ischemic muscle CD11b ⁺ CX3CR1 ⁺ Isolation of cells

In accordance with the regulations of the Catholic University Animal Ethics Committee, ischemia was induced by removing the veins and arteries from the thighs of 10-12 week old C57BL / 6 mice. In addition, human-derived CD11b ⁺ CX3CR1 ⁺ cells used tissue that was discarded after surgery with the consent of the patient. (210 U / mg; Worthington, Lakewood, NJ) and dyspazate (0.2 mg / kg) from ischemia-induced vein and arterial muscle (adductor muscle) 0.95 U / mg; Invitrogen, Grand Island, NY). In addition, bone marrow of C57BL / 6 mice that did not induce ischemia were isolated, and 0.2% collagenase (210 U / mg; Worthington, Lakewodd, NJ) and distearate (0.95 U / mg; Invitrogen, Grand Island, NY) to isolate single cells.

For FACS analysis, each cell isolated from ischemic muscle or bone marrow was reacted with APC-conjugated anti-mouse CD11b, biotinylated anti-mouse CX3CR1 antibody for 30 minutes at 4 ° C. Thereafter, the cells were further reacted with FITC-conjugated streptavidin (Molecular Probes, Eugene, OR) for 30 minutes. CD11b ⁺ CX3CR1 ⁺ cells were analyzed and separated using a flow cytometer (MoFlo ™ XDP Cell Sorter (Beckman Coulter, Brea, CA)) to obtain ischemic muscle CD11b ⁺ CX3CR1 ⁺ cells and bone marrow derived CD11b ⁺ CX3CR1 ⁺ cells, respectively.

Isolated from ischemic muscle CD11b ⁺ CX3CR1 ⁺ Cells and bone marrow CD11b ⁺ CX3CR1 ⁺ Comparison of intracranial blood flow enhancement

In order to examine the effect of the CD11b ⁺ CX3CR1 ⁺ cells obtained in Example 1 on blood flow, ischemic muscle-derived CD11b ⁺ CX3CR1 ⁺ cells and bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells were cultured in the same manner as in Example 1 The ischemic muscle of C57BL / 6 mice was injected and blood flow was measured.

As a result, a separation in the ischemic muscle CD11b ⁺ CX3CR1 ⁺ cells ^{(ischemic muscle derived-CD11b + CX3CR1} + cells; ■) for again injected into the ischemic muscle of C57BL / 6 mouse, CD11b ^- in comparison with the control group injected with cells ^- CX3CR1 Significant levels of blood flow increase occurred (Figure 1). On the other hand, when the CD11b ⁺ CX3CR1 ⁺ cells ( x ) isolated from the bone marrow were injected again into the ischemic muscle of the C57BL / 6 mouse, the blood flow was restored as compared with the group injected with CD11b ⁺ CX3CR1 ⁺ Respectively.

From these results, it was confirmed that CD11b ⁺ CX3CR1 ⁺ cells isolated from ischemic muscle were important for regeneration of neovascularization, and CD11b ⁺ CX3CR1 ⁺ cells derived from ischemic muscle derived CD11b ⁺ CX3CR1 ⁺ cells It was found that even if the same antigen was present on the surface, the similar blood flow recovery effect was not exhibited.

CD11b isolated from ischemic muscle ⁺ CX3CR1 ⁺ Characterization of cells

[3-1] MCP -One, MIP -One, PF -4, MMP -9 Confirm expression level

The expression levels of MCP-1, MIP-1, PF-4 and MMP-9 secreted from cultured cells were measured by culturing CD11b ⁺ CX3CR1 ⁺ cells isolated from ischemic muscle.

First, 48-well ischemia, remove the plate muscle-derived CD11b ⁺ CX3CR1 ^+, CD11b ⁺ CX3CR1 ^- cells, bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells cows 5x10 ⁴ 2.5% fetal calf serum (fetal bovine serum), containing the 100U streptomycin / penicillin The cells were cultured in RPMI-1640 (Life Technologies) medium at 37 占 폚 for 3 days in a 5% CO ₂ cell incubator. Each of the cultured cells was treated with 0.25% Trypsin-EDTA solution for 2 minutes. Cells were separated and centrifuged to prepare a single cell suspension. Proteins were extracted from the cultured cells using PRO-PREP protein extraction solution (iNtRON Biottechnology, Seoungnam) and quantified by Bradford Assay technique. The extracted protein (50 μg) of each cell group was assayed for 53 different angiogenesis-related protein expressions using the Proteome Profiler Mouse Angiogenesis Kit (ARY-015, R & D systems). Expression was measured using ImageQuant LAS 4000 (GE Healthcare, Piscataway, NJ, USA) and the protein density was measured for pixel density.

As a result, the ischemic muscle-derived CD11b ⁺ CX3CR1 ⁺ cell is a CD11b ⁺ CX3CR1 ⁺ cells and CD11b ⁺ CX3CR1 in the muscle away from the bone ^marrow-cells was higher than the expression of PF-4 (Figs. 2a and 2b).

[3-2] By immunofluorescence staining PF -4 Confirmation of expression level

The expression level of PF-4 secreted from cultured CD11b ⁺ CX3CR1 ⁺ cells isolated from ischemic muscle was measured by immunofluorescent staining. Anti-PF-4 antibody (SC-50300, Santa Cruz Biotechnology) was used.

Is a CD11b ⁺ CX3CR1 ⁺ cells isolated from the ischemic muscle, while expressing PF-4, muscle-derived CD11b ⁺ CX3CR1 ^- cells and bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells was confirmed that do not express PF-4 (Fig. 2c) .

[3-3] PF -4, HPRT mRNA  Check the expression level

CD11b ⁺ CX3CR1 ⁺ cells isolated from ischemic muscle were cultured and the amount of PF-4 mRNA expression was confirmed in the cultured cells. First, the culture solution was removed from the cultured cells, and only the cells were recovered. Then, mRNA was extracted according to the manufacturer's method using RNeasy Mini Kit, Qiagen. Separated mRNA was measured using a nano drop mass spectrometer for the degree of contamination of proteins and organic solvents. CDNA was prepared using 200 ng of extracted RNA (6110B, PrimeScript 1 ^st strand cDNA Synthesis Kit, Takara). The prepared cDNA was used as a template and the degree of mRNA expression was confirmed using primers for each gene. The primers used are shown in Table 1 below.

Name of the primer 5 'to 3' SEQ ID NO: PF-4 forward GTCCAGTGGCACCCTCTTGA 3 PF-4 reverse AATGACATTTAGGCAGCTGA 4 HPRT forward GTTGGGCTTACCTCACTGCT 5 HPRT reverse TAATCACGACGCTGGGACTG 6

PF-4 mRNA was highly expressed in CD11b ⁺ CX3CR1 ⁺ cells in ischemic muscle (FIG. 2d, Lane 1), but expression was low in CD11b ⁺ CX3CR1 ^- cells (FIG. 2d, Lane 2) PF-4 was not expressed at all in CD11b ⁺ CX3CR1 ⁺ cells (Fig. 2d, Lane 3).

PF -4 on angiogenic activity

[4-1] Ischemic muscle-derived CD11b containing PF-4 ⁺ CX3CR1 ⁺  Effect of cell culture media on angiogenic activity

The culture medium of ischemic muscle-derived CD11b ⁺ CX3CR1 ⁺ cells cultured as in Example 3 was recovered to obtain a supernatant. C57BL / 6 mouse derived aortic ring segments were removed and blood vessels were washed with phosphate buffered saline (PBS, Welgene), and all of the fine blood vessels attached to the aorta were removed. The aorta, from which blood and blood vessels were removed, was cut to a thickness of about 1 mm, placed on a matrigel-coated dish, and incubated at 37 ° C for 30 minutes. (CM of CD11b ⁺ CX3CR1 ⁺ cells) of ischemic muscle-derived CD11b ⁺ CX3CR1 ⁺ cells on a stiffer aorta surrounded by Matrigel. After 7 days, the cells were observed under a microscope and the number of cells formed around the aorta was counted to determine the number of sprouting.

As a result, it was confirmed that when the supernatant of CD11b ⁺ CX3CR1 ⁺ cells isolated from the ischemic muscle was treated, the sprouting of endothelial cells in the aorta fragment was markedly increased as compared with the control (aortic fragment alone) (Figs. 3a and 3b ).

From these results, it can be seen that CD11b ⁺ CX3CR1 ⁺ cells isolated from ischemic muscle produce substances that proliferate vascular endothelial cells.

Further, PF-4 is the column for PF-4 protein from the supernatant of the CD11b ⁺ CX3CR1 ⁺ cells isolated from the ischemic muscle in order to make sure that involved in blood vessel formation of the CD11b ⁺ CX3CR1 ⁺ cells isolated from the ischemic muscles (Streptavidin agarose column, Thermo Fisher Scientific), and the cells were cultured in the same manner as described in [4-1] above. After culturing, the cells were observed under a microscope and the number of cells formed around the aorta was counted to determine germination (number of sprouting).

As a result, the effect of increasing the sprouting was lost by the supernatant from which PF-4 was removed (FIGS. 3A and 3B).

From the above results, it can be seen that PF-4 produced in CD11b ⁺ CX3CR1 ⁺ cells in the ischemic muscle plays an important role in endothelial cell sprouting.

[4-2] PF -4 Of VEGF  Identification of the effect on angiogenic activity

VEGF (100-20, PeproTech, Rocky Hill, NJ), which is known to be involved in angiogenesis as well as being secreted in the ischemic state, was identified as PF- 4 (Cat No. 300-16, PeproTech, Rockey Hill, NJ).

Previously, PF-4 was known to be a typical angiostatic factor, and it was expected that angiogenesis would be decreased. However, unlike this prediction, when VEGF is mixed with PF-4, the angiogenic effect of VEGF is remarkably increased (Figs. 3C and 3D).

From the above results, it can be seen that PF-4 alone acts as an anti-angiogenic factor but acts as an angiogenic factor in the ischemic state in which VEGF is produced.

[4-3] PF The effect of angiogenic activity on angiogenesis

From the results of Examples 4-1 and 4-2, PF-4 alone acts as an anti-angiogenic factor but acts as an angiogenic factor when it is contained in the supernatant of CD11b ⁺ CX3CR1 ⁺ cells derived from ischemic muscle, VEGF also acts as an angiogenic factor.

Therefore, a supernatant of CD11b ⁺ CX3CR1 ⁺ cells derived from ischemic muscle may be used to induce angiogenesis, and the supernatant may be used in combination with VEGF.

Fractal Cain ( fractalkine ) Treatment CD11b ⁺ CX3CR1 ⁺ Changes in cell characteristics: human bone marrow derived CD11b ⁺ CX3CR1 ⁺ Cell use

Human bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells were seeded (seeding) to 5 × 10 ⁴ in 48 well plates dish, fractal Cain (571-MF, R & D Systems, Minneapolis, MN) to 5ng / ㎖ treatment at a concentration of, and 30 min . After completion of the reaction, the culture medium was removed, the cells were fixed with 4% paraformaldehyde (Sigma Aldrich), and the cells were washed three times with sterilized PBS. The cells were then treated with 1% Triton X-100 for 5 minutes, and the treated cells were washed three times with sterile phosphate buffered saline. The washed cells were blocked with 1% bovine serum albumin solution diluted in phosphate buffered saline. After the primary antibody of PF-4 was treated for 1 hour, the secondary antibody was treated in the dark for 1 hour. The cover slips were mounted with mounting media containing 4 ', 6'-diamidine-2'-phenylindole dihydrochloride (DAPI). Relative PF-4 expression was confirmed by fluorescence microscopy.

As a result, PF-4 was not expressed in bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells not treated with fractal kain, whereas in bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells treated with fractal kain, expression of PF-4 was remarkable (Fig. 4A).

From the above results, it can be seen that the fractal kain converts the bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells into cells similar to CD11b ⁺ CX3CR1 ⁺ cells derived from ischemic muscle.

Since the bone marrow derived CD11b ⁺ CX3CR1 ⁺ cells are converted into cells similar to the ischemic muscle-derived CD11b ⁺ CX3CR1 ⁺ cells, the cells thus transformed can be useful for the treatment of ischemic diseases.

Fractal Cain  Derived bone marrow derived CD11b ⁺ CX3CR1 ⁺ Determination of cell angiogenic activity: derived from human bone marrow CD11b ⁺ CX3CR1 ⁺ Cell use

Fractalkine-treated bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells C57BL / 6 mouse-derived aortic pieces and cultured for 7 days. The aorta fragments were placed on a matrigel-coated dish and incubated at 37 ° C for 30 minutes in the same manner as in Example [4-1]. Bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells (5 × 10 ⁴ cells) were seeded on the stained aorta surrounded by Matrigel, and cultured for 7 days. The cells were observed under a microscope and the number of cells formed around the aorta was counted to determine the number of sprouting. As a control group, aortic fragment, bone marrow derived CD11b ⁺ CX3CR1 ^- cells and bone marrow derived CD11b ⁺ CX3CR1 ⁺ cells were used.

As a result, in the case of bone marrow-derived cytokine fractal not treated with the CX3CR1 ⁺ CD11b ⁺ cells as compared to bone marrow-derived cytokine treatment fractal CX3CR1 ⁺ CD11b ⁺ cells were endothelial cells increasing the germination considerably (Fig. 4b).

From the above results, it can be seen that the bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells treated with the fractal can be useful for the treatment of ischemic diseases.

Fractal Cain ( fractalkine ) Treatment CD11b ⁺ CX3CR1 ⁺ Changes in cell characteristics: derived from mouse bone marrow CD11b ⁺ CX3CR1 ⁺ Cell use

[7-1] Confirmation of expression level of PF-4

Bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells were treated, and 30 minutes of reaction the concentration of the seeding (seeding), and the fractal Cain (571-MF, R & D Systems, Minneapolis, MN) to 5 × 10 ⁴ in 48 well plates dish 50ng / ㎖ . After completion of the reaction, the culture medium was removed, the cells were fixed with 4% paraformaldehyde (Sigma Aldrich), and the cells were washed three times with sterilized PBS. The cells were then treated with 1% Triton X-100 for 5 minutes, and the treated cells were washed three times with sterile phosphate buffered saline. The washed cells were blocked with 1% bovine serum albumin solution diluted in phosphate buffered saline. After the primary antibody of PF-4 was treated for 1 hour, the secondary antibody was treated in the dark for 1 hour. The cover slips were mounted with mounting media containing 4 ', 6'-diamidine-2'-phenylindole dihydrochloride (DAPI). Relative PF-4 expression was confirmed by fluorescence microscopy.

As a result, PF-4 was not expressed in bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells not treated with fractal kain, whereas in bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells treated with fractal kain, expression of PF-4 was remarkable (Fig. 5A).

From the above results, it can be seen that the fractal kain converts the bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells into cells similar to CD11b ⁺ CX3CR1 ⁺ cells derived from ischemic muscle.

Since the bone marrow derived CD11b ⁺ CX3CR1 ⁺ cells are converted into cells similar to the ischemic muscle-derived CD11b ⁺ CX3CR1 ⁺ cells, the cells thus transformed can be useful for the treatment of ischemic diseases.

[7-2] PF -4 mRNA  Check the expression level

The same procedure as in Example 3-3 for confirming the mRNA expression level was carried out except that the samples used were different.

As a result, when bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells PF-4 expression ateuna degree is low, in the case of a fractal Cain to 50ng / ㎖ concentration of 30 minutes into the bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells treated for ischemic muscle-derived CD11b ⁺ CX3CR1 ⁺ And express PF-4 mRNA as much as the cells (Fig. 5B).

[7-3] Determination of the expression level of PF-4 according to the throughput or treatment time of fractal kain

 The amount of PF-4 released in accordance with the treatment amount of the fractal can or the treatment time was confirmed in the same manner as in the method of Example [7-1], except that the throughput or the treatment time of the fractal carine was changed. The concentration of the fractal can was 10 ng / ml, 50 ng / ml and 5000 ng / ml, respectively, and the treatment time was 10 minutes and 30 minutes, respectively.

As a result, bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells not treated with fractal kain did not express PF-4, whereas in the case of bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells treated with fractal kain, treatment concentrations were 10 ng / / Ml for 10 minutes or 30 minutes, the amount of PF-4 expression was remarkable. In addition, it was confirmed that the expression level of PF-4 was remarkable even when the concentration of the fractalkin treatment was adjusted to 5000 ng / ml and treated for 10 minutes (see FIG. 5C).

From the above results, it can be seen that the bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells are converted into cells similar to the ischemic muscle-derived CD11b ⁺ CX3CR1 ⁺ cells by treating the fractal can in a wide concentration range from 10 ng / ml to 5000 ng / It can be seen that when the bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells are converted into cells similar to the ischemic muscle-derived CD11b ⁺ CX3CR1 ⁺ cells, the concentration of the fractal can be selected and used as needed.

Fractal Cain  Derived bone marrow derived CD11b ⁺ CX3CR1 ⁺ Determination of cell angiogenic activity: derived from mouse bone marrow CD11b ⁺ CX3CR1 ⁺ Cell use

The bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells treated with the fractal cane of Example 7 C57BL / 6 mouse-derived aortic pieces and cultured for 7 days. The aorta fragments were placed on a matrigel-coated dish and incubated at 37 ° C for 30 minutes in the same manner as in Example [4-1]. CD11b ⁺ CX3CR1 ⁺ cells 1 × 10 ⁵ cells were seeded on the stained aorta surrounded by matrigel, cultured for 7 days, and observed with a microscope. The number of cells formed around the aorta was counted to determine the number of sprouting.

As a result, in the case of bone marrow-derived CD11b ⁺ untreated fractal Cain compared to CX3CR1 ⁺ cells treated with fractal Cain bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells are endothelial cell sprouting was markedly increased (Fig. 5d and 5e).

From the above results, it can be seen that the bone marrow-derived CD11b ⁺ CX3CR1 ⁺ cells treated with fractal cane can be effectively used for the treatment of ischemic diseases.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the scope of the invention is not limited to the disclosed exemplary embodiments. It will be possible to change it appropriately.

Claims (11)

A composition for inducing differentiation of mononuclear cells comprising fractalkine,
Wherein the monocyte comprises CD11b and CX3CR1 on the cell surface, wherein the differentiation is to differentiate monocytes into monocytes that induce angiogenesis, the monocytes are human bone marrow-derived mononuclear cells, the differentiated monocytes express PF-4, And a fractalkin of 0.1 to 10,000 ng / ml. delete delete delete delete delete A method for inducing differentiation of monocytes comprising the step of treating a monocyte with a fractalkin,
Wherein the monocyte comprises CD11b and CX3CR1 on the cell surface, wherein the differentiation is to differentiate monocytes into monocytes that induce angiogenesis, the monocytes are human bone marrow-derived mononuclear cells, the differentiated monocytes express PF-4, And the fractal can is 0.1 to 10,000 ng / ml. delete delete delete The method of claim 7,
Wherein the fractalkin is treated for 5 minutes to 3 hours.

Images